qpcr Quantification Protocol Guide
|
|
|
- Archibald Hicks
- 9 years ago
- Views:
Transcription
1 qpcr Quantification Protocol Guide FOR RESEARCH USE ONLY Topics 3 Introduction 5 User-Supplied Consumables and Equipment 7 Select Template 8 Dilute qpcr Template 9 Dilute Libraries 10 Prepare Reaction Mix 11 Aliquot to 96-Well Plate 12 Quantify by qpcr 13 Analyze 15 Appendix A - Determine Cluster Numbers for Library 17 Appendix B - Preparation for Cluster Generation 19 Appendix C - Determine Relative GC Content of Library ILLUMINA PROPRIETARY Catalog # SY Part # Rev. A September 2009
2 This document and its contents are proprietary to Illumina, Inc. and its affiliates ( Illumina ), and are intended solely for the contractual use of its customers and for no other purpose than to use the product described herein. This document and its contents shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way whatsoever without the prior written consent of Illumina, Inc. For the proper use of this product and/or all parts thereof, the instructions in this document must be strictly and explicitly followed by experienced personnel. All of the contents of this document must be fully read and understood prior to using the product or any of the parts thereof. FAILURE TO COMPLETELY READ AND FULLY UNDERSTAND AND FOLLOW ALL OF THE CONTENTS OF THIS DOCUMENT PRIOR TO USING THIS PRODUCT, OR PARTS THEREOF, MAY RESULT IN DAMAGE TO THE PRODUCT, OR PARTS THEREOF, AND INJURY TO ANY PERSONS USING THE SAME. RESTRICTIONS AND LIMITATION OF LIABILITY This document is provided as is, and Illumina assumes no responsibility for any typographical, technical or other inaccuracies in this document. Illumina reserves the right to periodically change information that is contained in this document and to make changes to the products, processes, or parts thereof described herein without notice. Illumina does not assume any liability arising out of the application or the use of any products, component parts, or software described herein. Illumina does not convey any license under its patent, trademark, copyright, or common-law rights nor the similar rights of others. Illumina further reserves the right to make any changes in any processes, products, or parts thereof, described herein without notice. While every effort has been made to make this document as complete and accurate as possible as of the publication date, no warranty of fitness is implied, nor does Illumina accept any liability for damages resulting from the information contained in this document. ILLUMINA MAKES NO REPRESENTATIONS, WARRANTIES, CONDITIONS, OR COVENANTS, EITHER EXPRESS OR IMPLIED (INCLUDING WITHOUT LIMITATION ANY EXPRESS OR IMPLIED WARRANTIES OR CONDITIONS OF FITNESS FOR A PARTICULAR PURPOSE, NON-INFRINGEMENT, MERCHANTABILITY, DURABILITY, TITLE, OR RELATED TO THE PERFORMANCE OR NONPERFORMANCE OF ANY PRODUCT REFERENCED HEREIN OR PERFORMANCE OF ANY SERVICES REFERENCED HEREIN). This document may contain references to third-party sources of information, hardware or software, products or services, and/or third-party web sites (collectively the Third-Party Information ). Illumina does not control and is not responsible for any Third-Party Information, including, without limitation, the content, accuracy, copyright compliance, compatibility, performance, trustworthiness, legality, decency, links, or any other aspect of Third-Party Information. Reference to or inclusion of Third-Party Information in this document does not imply endorsement by Illumina of the Third-Party Information or of the third party in any way Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator, Sentrix, GoldenGate, GoldenGate Indexing, DASL, BeadArray, Array of Arrays, Infinium, BeadXpress, VeraCode, IntelliHyb, iselect, CSPro, and GenomeStudio are registered trademarks or trademarks of Illumina, Inc. All other brands and names contained herein are the property of their respective owners.
3 3 Introduction This document describes a qpcr method for quantifying libraries generated using the Illumina sample preparation protocols. qpcr is a method of quantifying DNA based on PCR. qpcr tracks target concentration as a function of PCR cycle number in order to derive a quantitative estimate of the initial template concentration in a sample. As with conventional PCR, it uses a polymerase, dntps, and two primers designed to match sequences within a template. For the purposes of this protocol, the primers match sequences within the adapters flanking an Illumina sequencing library. qpcr is, therefore, an ideal method for measuring libraries in advance of generating clusters, because it will only measure templates that have both adaptor sequences on either end which will subsequently form clusters on a flowcell. Moreover, qpcr is a very sensitive method of measuring DNA and thus dilute libraries with concentrations below the threshold of detection of conventional spectrophotometric methods are amenable to quantification by qpcr. Scope Quantification Workflow There are several different qpcr instruments available from instrument vendors, each with its own proprietary software for running experiments and analyzing data. It is beyond the scope of this document to describe protocols for all instruments and analysis packages. Instead, this document describes a protocol designed around a Stratagene Mx3000P qpcr machine and Stratagene MxPro software. You will need to adapt this protocol to your specific qpcr platform. Figure 1 illustrates the qpcr quantification workflow. Dilute the control template and the libraries for quantification to the pm range and run qpcr. From the qpcr results, calculate the concentration of the quantified libraries and dilute them to a standard concentration (e.g., 2 nm). qpcr Quantification Protocol Guide
4 4 Template + Libraries for quantification Dilute control template and libraries for quantification to pm range Run qpcr and generate Ct values Ct x x x Plot standard curve and read off concentrations of quantified libraries Log initial Concentration Figure 1 qpcr Quantification Workflow During qpcr setup, it is important to avoid DNA crosscontamination. Clean the set up area, including all equipment to be used, thoroughly with 0.5% sodium hypochlorite (10% bleach). Illumina also recommends using a dedicated set of pipettes for qpcr to minimize contamination. The accuracy of qpcr is highly dependent on accurate pipetting and thorough mixing of solutions. Take extra care to avoid pipetting errors during qpcr set up and when preparing templates for clustering. Catalog # SY Part # Rev. A
5 5 User-Supplied Consumables and Equipment Check to ensure that you have all of the necessary user-supplied consumables and equipment before proceeding. Table 1 User-Supplied Consumables Consumable Supplier 0.1N NaOH General lab supplier 0.5% sodium hypochlorite (10% bleach) General lab supplier 0.1% Tween 20 General lab supplier 96-well plates Stratagene, part # template (10 nm) General lab supplier Hybridization buffer Illumina, part # KAPA SYBR FAST Master Mix Universal 2X qpcr Master Mix (2 x 5 ml =10 ml) Kapa Biosystems, part #KK4602 Libraries to be quantified diluted to approximately 10 nm General lab supplier Optical strip caps Stratagene, part # Pipettes (P2, P10, P200, P1000, and an 8 channel multichannel dispensing 18 μl) General lab supplier QIAGEN EB 250 ml elution buffer QIAGEN, part # qpcr primer 1.1: 5' AATGATACGGCGACCACCGAGAT 3' HPLC purified qpcr primer 2.1: 5' CAAGCAGAAGACGGCATACGA 3' HPLC purified One or more of the following kits in order to correspond to the number of libraries to be quantified: a. Single-Read Cluster Generation Kit (1 flow cell) b.single-read Cluster Generation Kit (10 flow cells) c. Paired-End Cluster Generation Kit (1 flow cell) d.paired-end Cluster Generation Kit (5 flow cells) General lab supplier General lab supplier a.illumina, part # GD b.illumina, part # GD c. Illumina, part # PE d.illumina, part # PE qpcr Quantification Protocol Guide
6 6 Table 2 Equipment Checklist Equipment Benchtop centrifuge with swing out rotor Benchtop microcentrifuge Genome Analyzer qpcr machine Vortexer Suggested Supplier Sorvall Legend RT General lab supplier Illumina, part # SY Stratagene Mx3000P General lab supplier Catalog # SY Part # Rev. A
7 7 Select Template Before starting qpcr, select the control template against which the libraries for quantification can be measured. In principle, any library prepared for sequencing on the Illumina platform can be used as a control for qpcr and you may wish to tailor a control template to suit your specific needs. The control template should be as similar as possible in terms of template size, GC content and library type (e.g., genomic, CHIP-seq, etc.) to the libraries for quantification. It is also important to note that the control template needs to be available in sufficient quantity, as specified in this protocol, for it to be used in multiple qpcr reactions. In order to correlate library concentration with cluster number, it is recommended to generate a titration flowcell for the control template (see Appendix A - Determine Cluster Numbers for Library and Appendix B - Preparation for Cluster Generation). The GC content of a given library is not always known and this poses a problem for matching the library to an appropriate control template for qpcr quantification. However, it is possible to estimate the GC content of Illumina libraries relative to other Illumina libraries of the same template size by performing a limited number of cycles of qpcr followed by a dissociation curve. The higher the GC content of the library, the higher the melting temperature of the PCR product (see Appendix C - Determine Relative GC Content of Library). Once the GC content of a library is known, an appropriate control template can be selected for qpcr quantification. qpcr Quantification Protocol Guide
8 8 Dilute qpcr Template Use the appropriate control library for the libraries you wish to quantify. Illumina recommends using a control library that gives a good range of cluster numbers when clustered between 2 20 pm. Consumables qpcr control template (10 nm) Store the qpcr 10 nm library template in small aliquots to avoid multiple freeze and thaw cycles. 0.1% Tween 20 stored at room temperature (e.g., 50 ml water + 50 μl Tween 20) Procedure 1. Add 198 μl of the 0.1% Tween 20 to 2 μl of the qpcr control template to make a 100-fold dilution. 2. Vortex the dilution to thoroughly mix the samples. 3. Add 100 μl of the 0.1% Tween 20 to 100 μl of the diluted template to make a titration curve of six 2x serial dilutions. This will give 7 control template dilutions in the range of pm. It is important to make fresh dilutions of the qpcr control template immediately before qpcr as the DNA does not store well at low concentrations. 4. Vortex the dilution to thoroughly mix the samples. 5. Repeat steps 1 through 4 to produce 3 independent serial dilutions of the control template. dilutions are diluted a further 10X into the final SYBR mix, so the final concentration in the qpcr is pm. Catalog # SY Part # Rev. A
9 9 Dilute Libraries The libraries for quantification need to be diluted to the same range as the control template for qpcr. Consumables Libraries for quantification diluted to approximately 10 nm in QIAGEN EB Buffer It is important to make fresh dilutions of the qpcr unknown library template before qpcr as the DNA does not store well at low concentrations. 0.1% Tween 20 stored at room temperature (e.g., 50 ml water + 50 μl Tween 20) Procedure 1. Add 998 μl of the 0.1% Tween 20 to 2 μl of the unknown library template to make a 500-fold dilution. This will give an approximate concentration of 20 pm. 2. Vortex the dilution to thoroughly mix the samples. 3. Repeat steps 1 and 2 to produce 3 independent dilutions of the library template. Triplicate results for qpcr are important for subsequent analysis. Unknown sample dilutions are diluted a further 10X into the final SYBR mix so the final concentration in the qpcr is approximately 2 pm. qpcr Quantification Protocol Guide
10 10 Prepare Reaction Mix It is important to make a master mix to minimize pipetting errors. The method here makes enough master mix to fill a 96-well plate, but it is possible to make less master mix if you do not wish to use all 96 wells. Consumables KAPA SYBR FAST Master Mix Universal (2x) qpcr primer 1.1 qpcr primer 2.1 Water Procedure 1. Prepare the SYBR master mix reaction mix as follows: Consumable μl/well μl/plate (master mix for 110) KAPA SYBR FAST Master Mix Universal (2x) qpcr Primer 1.1 (10 μm) qpcr Primer 2.1 (10 μm) Water Mix gently but thoroughly. 3. Place the reaction mix on ice and protect it from light until use. Catalog # SY Part # Rev. A
11 11 Aliquot to 96-Well Plate The next step in the process is to aliquot the control template dilutions, unknown library dilutions, and master mix. It is important during this step to pipette as accurately as possible, because small variations in volumes will greatly affect the qpcr results. Consumables template dilutions (see Dilute qpcr Template) Libraries for quantification dilutions (see Dilute Libraries) Reaction Mix (see Prepare Reaction Mix) 96-well plates Optical strip caps Procedure 1. Add 2 μl of the control template dilutions, the unknown library dilutions, or water to each well in a 96-well plate. Take care to pipette accurately into the wells as small variations will affect the assay. For example, the 96-well plate can be filled as follows: A 100pM 100pM 100pM B 50pM 50pM 50pM C 25pM 25pM 25pM D 12.5pM 12.5pM 12.5pM E 6.25pM 6.25pM 6.25pM F 3.13pM 3.13pM 3.13pM G 1.56pM 1.56pM 1.56pM H NTC NTC NTC Figure 2 Well Plate Format Wells in columns 1 3 contain the control template dilutions and the no template control (NTC) in triplicate. Wells in columns 4 12 contain the sample dilutions in triplicate. 2. Dispense 18 μl of the master mix into each well of the 96-well plates using a multichannel pipette. Take care to pipette accurately into the wells as variations in volume will affect the assay. Change tips for each new column. 3. Place the optical strip lids on the wells, taking care to avoid cross contamination and to avoid smudging the surface of the lids. 4. Centrifuge the 96-well plate to 280 xg for 1 minute. qpcr Quantification Protocol Guide
12 12 Quantify by qpcr Quantify the libraries by qpcr. Procedure 1. Place the 96-well plate in the qpcr machine in the correct orientation and clean the optical lids with lens tissue to remove any dust before closing the qpcr machine lid. 2. Use the following thermal profile: Procedure Temperature Time Hot start 95ºC 3 minutes 95ºC 3 seconds X40 60ºC 30 seconds Catalog # SY Part # Rev. A
13 13 Analyze The final step in the qpcr procedure is to analyze the quantified libraries. Procedure 1. Check the NTC wells for any amplification. There should be no amplification, but data is acceptable if any amplification is >10 cycles after your last control template amplification. 2. Ensure that there is good amplification for the control template and remove any bad replicates (Figure 3). Figure 3 Example of Template Amplification 3. Generate a standard curve from the control template by plotting the Ct values against the log initial concentration (Figure 4). qpcr Quantification Protocol Guide
14 14 Figure 4 Example of Standard Curve Log Fit Values SYBR Standards, RSq:0.998 SYBR, Y = -3.31*LOG(X) , Eff. = 100.4% 4. Ensure that the efficiency of amplification of the control template is % (a slope of to -3.10) and that the R2 >0.9. If not, reassess the datapoints you are using to calculate the standard curve. 5. Lock the threshold fluorescence based on the standard curve. 6. Ensure that there is good amplification for the unknown library templates and remove any bad replicates. 7. Calculate the initial concentration of your unknown library templates based on the standard curve generated from the control template dilutions. Remember to factor in the 5000-fold dilution of unknown sample. 8. Dilute the quantified library to a standard concentration for clustering. A suggested protocol for preparing sample DNA for cluster generation is given in Appendix B - Preparation for Cluster Generation on page 17. Catalog # SY Part # Rev. A
15 15 Appendix A - Determine Cluster Numbers for Library A titration flowcell can be generated by preparing serial dilutions of template hyb from the control library and counting the number of clusters following the sequencing cycles. The number of cycles required depends on the Pipeline used. Perform the same number of cycles as the Pipeline, plus 1 cycle, required for phasing. It is necessary to perform multiple cycles of sequencing to achieve an accurate cluster count, since the Pipeline analysis uses the cycles to identify individual clusters in a full length sequencing run. Cluster counts from a first cycle report are not accurate, particularly at high cluster density, due to the different way in which the clusters are counted. A cluster titration for the control template should be linear up until the point at which the clusters become too dense to count accurately, based on current version of the Illumina Genome Analyzer (GA) being used. An example of a library titration is shown in Figure 5. Consumables and Equipment library Sequencing reagents (enough for the required number of cycles) Single-Read or Paired-End Cluster Generation Kit GAII_qPCR_v#.xml Procedure 1. Prepare serial dilutions of the template hyb from the control library and cluster on a flowcell. The number of clusters required from the libraries to be quantified by qpcr should fall within the range of the titration flowcell. 2. Perform the sequencing cycles to count the clusters on the titration flowcell. Ensure that there is enough reagent for the run, with a minimum of the following per cycle. These can be left over reagents. 1 ml of incorporation mix 0.5 ml of cleavage mix 2.5 ml of scanning mix For GAII, use the recipe GAII_qPCR_v#.xml. This recipe will scan 9 tiles/ columns. 3. There is no need to change any configuration file on the instrument. The offsets may not be recalculated and the defaμlt_offsets.txt file used might be the one generated during the previous run analysis. To avoid any confusion, make sure that the run name states the name of the GA (e.g _eas139_0051_FC30BKFAAXX). qpcr Quantification Protocol Guide
16 16 4. Use the following settings for the Pipeline analysis: USE_BASES YY. ANALYSIS sequence. 5. Plot the cluster numbers displayed in the summary table against the initial concentration of control template. 6. Calculate the pm concentration required for the desired number of clusters using the equation of the line. Figure 5 Example of Library Titration In Figure 5, an E. coli control library with a template size of 300 bp was clustered on four flowcells at 16 pm, 8 pm, 4 pm, 2 pm, 1 pm, 0.5 pm, and 0.25 pm and clusters were counted through the Pipeline following five cycles of sequencing. Catalog # SY Part # Rev. A
17 17 Appendix B - Preparation for Cluster Generation Independently of DNA quantification, it is important to be able to achieve precise cluster numbers (i.e., a given library clustered at the same concentration should always give the same number of clusters). However, it is often observed that the same library clustered on separate occasions can give different cluster numbers and this can be attributed to the small pipetting volumes and large number of pipetting steps involved in the current cluster protocol. Illumina recommends a modified protocol for clustering to achieve more consistent cluster numbers when the same library will be used on multiple flow cells or lanes. Consumables and Equipment DNA Library QIAGEN EB Buffer + 0.1% Tween 20 (QIAGEN EB Tween) (e.g., 50 ml QIAGEN EB + 50 μl Tween) 0.1N NaOH Hybridization Buffer Vortexer Benchtop Microcentrifuge Pipettes (P2, P10, P200, P1000, and an 8 channel multichannel dispensing 18 μl) To minimize errors in preparing 0.1N NaOH fresh each day, prepare it in large batches and aliquot it into 50 ml sealed tubes. These aliquots may be stored up to 6 months at 2 to 8 C and used in the protocol as needed. Once you open an aliquot, use it on the same day that it was opened. Discard any reagent that is left at the end of the day. Procedure 1. Dilute the DNA library templates to 2 nm based on qpcr quantification in QIAGEN EB Tween using a minimum volume of 10 μl using a P10 pipette. 2. Denature 10 μl of 2 nm template DNA by adding 10 μl 0.1N NaOH to generate 20 μl of a 1 nm denatured template using a P10 pipette to make the dilutions. 3. Vortex the template solution. 4. Centrifuge the template solution to 280 xg for 1 minute. 5. Incubate for 5 minutes at room temperature to denature the template into single strands. 6. Add 980 μl of pre-chilled hybridization buffer using a P1000 pipette to the tube containing the denatured template solution to generate a 20 pm template hyb solution. qpcr Quantification Protocol Guide
18 18 7. Vortex the template hyb. You may aliquot into smaller volumes to avoid multiple freeze/thaws. If so, the volumes should be large (e.g., 250 μl) to enable accurate pipetting for further dilutions. The 20 pm template hyb solution can be diluted using large volume pipetting to the correct concentration for clustering, as judged from the qpcr control template titration flowcell. Any remaining 20 pm template hyb can be stored at -15º to -25ºC for up to 3 weeks. Storage of the 20 pm template hyb solution enables you to re-use the same template hyb with the possibility of clustering at a different concentration at a later time. By storing the 20 pm template hyb you do not have to begin the cluster process again from the 2 nm stock, thus preventing any further cluster number variability. Since the libraries are quantified by qpcr before clustering it is assumed that a concentration above 20 pm would not be required. Catalog # SY Part # Rev. A
19 19 Appendix C - Determine Relative GC Content of Library The GC content of a library is not always known, but it is possible to estimate the GC content of Illumina libraries relative to other Illumina libraries of the same size by performing a dissociation curve on the qpcr instrument. The higher the GC content of the library then the higher the melting temperature. Therefore, libraries of the same template length can be directly compared and GC content of unknown libraries estimated relative to libraries of known GC content (Figure 6). Plasmodium falciporum (20% GC) Human (40% GC) E. coli (50% GC) TB (65% GC) Figure 6 Example of Dissociation Curves Generated for 300 bp Illumina Libraries Consumables and Equipment Illumina libraries of known GC content (~10 nm) Illumina libraries of unknown GC content (~10 nm) KAPA SYBR FAST Master Mix Universal 2x qpcr machine 96-well plates Optical strip caps Benchtop centrifuge with swing out rotor qpcr Quantification Protocol Guide
20 20 Procedure 1. Prepare the following reaction mix for each library (including controls) in a 96-well plate/reaction Consumable μl/reaction KAPA SYBR FAST Master Mix Universal (2x) 10 qpcr Primer 1.1 (10 μm) 0.2 qpcr Primer 2.1 (10 μm) 0.2 Water 7.6 Illumina library (approx 10 nm) Put the optical strip lids on the wells and briefly spin the 96-well plate down in a bench top centrifuge to 280 xg for 1 minute. 3. Place the 96-well plate in the qpcr machine in the correct orientation and clean the optical lids with lens tissue to remove any dust before closing the qpcr machine lid. 4. Use the following thermal profile: Procedure Temperature Time Hot start 95ºC 3 minutes 95ºC 3 seconds X10 60ºC 30 seconds 5. At the end of the thermal profile ramp slowly from 60º to 95ºC to generate a dissociation curve. Catalog # SY Part # Rev. A
21
22 Illumina, Inc Towne Centre Drive San Diego, CA ILMN (4566) (outside North America)
Sequencing Library qpcr Quantification Guide
Sequencing Library qpcr Quantification Guide FOR RESEARCH USE ONLY Introduction 3 Quantification Workflow 4 Best Practices 5 Consumables and Equipment 6 Select Control Template 8 Dilute qpcr Control Template
Preparing Samples for Sequencing Genomic DNA
Preparing Samples for Sequencing Genomic DNA FOR RESEARCH ONLY Topics 3 Introduction 5 Kit Contents and Equipment Checklist 7 Fragment the Genomic DNA 11 Perform End Repair 12 Add A Bases to the 3' End
Cluster Generation. Module 2: Overview
Cluster Generation Module 2: Overview Sequencing Workflow Sample Preparation Cluster Generation Sequencing Data Analysis 2 Cluster Generation 3 5 DNA (0.1-5.0 μg) Library preparation Single Cluster molecule
Paired-End Sample Preparation Guide
Paired-End Sample Preparation Guide FOR RESEARCH USE ONLY Introduction 3 Sample Prep Workflow 4 Best Practices 5 DNA Input Recommendations 7 Kit Contents 9 Consumables and Equipment 11 Fragment DNA 13
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
Absolute Quantifi cation of Gene Expression using SYBR Green in the Eco Real-Time PCR System
Absolute Quantifi cation of Gene Expression using SYBR Green in the Eco System Introduction Gene expression is the process by which genetic information is converted into a functional product. This process
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
RealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
TruSeq DNA Methylation Library Preparation Guide
TruSeq DNA Methylation Library Preparation Guide Kit Contents 3 Consumables and Equipment 4 Preparation 5 Quality Control of Bisulfite-Converted DNA 6 TruSeq DNA Methylation Kit Protocol 7 Sequencing the
Paired-End Sequencing Sample Preparation Guide
Paired-End Sequencing Sample Preparation Guide FOR RESEARCH USE ONLY Topics 3 Introduction 5 Best Practices 6 DNA Input Recommendations 7 Paired-End Sample Preparation Kit Contents 9 User-Supplied Consumables
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
TruSeq Custom Amplicon v1.5
Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Illumina Sequencing Technology
Illumina Sequencing Technology Highest data accuracy, simple workflow, and a broad range of applications. Introduction Figure 1: Illumina Flow Cell Illumina sequencing technology leverages clonal array
Consistent Assay Performance Across Universal Arrays and Scanners
Technical Note: Illumina Systems and Software Consistent Assay Performance Across Universal Arrays and Scanners There are multiple Universal Array and scanner options for running Illumina DASL and GoldenGate
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Decode File Client User Guide
Contents Decode File Client User Guide Contents... 1 Notice... 2 Getting Started... 3 Workflow Overview... 3 Preliminary Steps... 3 Using the Decode File Client in Access by Account Mode... 3 Using the
iscan System Quick Reference Guide
iscan System Quick Reference Guide FOR RESEARCH USE ONLY iscan System Overview 3 Starting the iscan System 6 Imaging Data on BeadChips 7 Shutting Down the iscan System 14 Technical Assistance ILLUMINA
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems
USER GUIDE Encore PART NOS. 8041 and 8042 SP Rapid Library Systems Patents, Licensing and Trademarks 2012 2013 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
Illumina. LIMS Project Manager Guide. For Reasearch Use Only. ILLUMINA PROPRIETARY Catalog # SW-900-1003 Part # 15000396 Rev. C
Illumina LIMS Project Manager Guide For Reasearch Use Only ILLUMINA PROPRIETARY Catalog # SW-900-1003 Part # 15000396 Rev. C Notice This document and its contents are proprietary to Illumina, Inc. and
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
empcr Amplification Method Manual - Lib-A
GS Junior Titanium Series May 2010 (Rev. April 2011) For life science research only. Not for use in diagnostic procedures. 1. WORKFLOW The emulsion-based clonal amplification (empcr amplification) of a
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Quantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
Rat Creatine Kinase MB isoenzyme,ck-mb ELISA Kit
Rat Creatine Kinase MB isoenzyme,ck-mb ELISA Kit Catalog No: E0479r 96 Tests Operating instructions www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
Highly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
QPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Factors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
RealLine HCV PCR Qualitative - Uni-Format
Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Absolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07
Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf Life... 3
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
HBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide
PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria
Genomic DNA detection assay
Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Guide to using the Bio Rad CFX96 Real Time PCR Machine
Guide to using the Bio Rad CFX96 Real Time PCR Machine Kyle Dobbs and Peter Hansen Table of Contents Overview..3 Setup Reaction Guidelines 4 Starting up the Software 5 Setup Protocol on Software 6 Setup
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit
Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit Catalog Number. CSB-E14405r For the quantitative determination of rat creatine kinase MM isoenzyme (CK-MM) concentrations in serum, plasma and tissue
AxyPrep TM Mag PCR Clean-up Protocol
AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR
Mouse Keyhole Limpet Hemocyanin antibody(igm) ELISA Kit
Mouse Keyhole Limpet Hemocyanin antibody(igm) ELISA Kit Catalog No. MBS702810 (96 tests) This immunoassay kit allows for the in vitro semi-quantitative determination of mouse KLH(IgM)antibody concentrations
Human Free Testosterone(F-TESTO) ELISA Kit
Human Free Testosterone(F-TESTO) ELISA Kit Catalog Number. MBS700040 For the quantitative determination of human free testosterone(f-testo) concentrations in serum, plasma. This package insert must be
DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments
DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
ab185915 Protein Sumoylation Assay Ultra Kit
ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic
How To Get Rid Of Small Dna Fragments
AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique
Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System
Luciferase Assay System Proto col GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow Step 1: Seed cells in plate format.
quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System
i Technical Note: Reproductive Health Rapid Aneuploidy and CNV Detection in Single Cells using the MiSeq System Comparison between data generated from single cells using 24sure array-based screening and
Sanger Sequencing: Sample Preparation Guide
Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation
Canine creatine kinase MB isoenzyme (CK-MB)ELISA Kit
Canine creatine kinase MB isoenzyme (CK-MB)ELISA Kit Catalog No. CSB-E15852c (96T) This immunoassay kit allows for the in vitro quantitative determination of canine CK-MB concentrations in serum and plasma.
Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension
Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................
Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems
Technical Manual Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems INSTRUCTIONS FOR USE OF PRODUCTS A4011, A4021, A4031, A4041, A4051 AND
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit
Rat creatine kinase MM isoenzyme (CK-MM) ELISA Kit Catalog Number. CSB-E14405r For the quantitative determination of rat creatine kinase MM isoenzyme (CK-MM) concentrations in serum, plasma, tissue homogenates.
TaqMan Mutation Detection Assay
PROTOCOL TaqMan Mutation Detection Assay Competitive Allele-Specific TaqMan PCR Publication Part Number 4467011 Rev. B Revision Date April 2012 For Research Use Only. Not intended for any animal or human
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist [email protected] Pathway Focused Research from Sample Prep to Data Analysis! -2-
Inc. Wuhan. Quantity Pre-coated, ready to use 96-well strip plate 1 Plate sealer for 96 wells 4 Standard (liquid) 2
Uscn Life Science Inc. Wuhan Website: www.uscnk.com Phone: +86 27 84259552 Fax: +86 27 84259551 E-mail: [email protected] ELISA Kit for Human Prostaglandin E1(PG-E1) Instruction manual Cat. No.: E0904Hu
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum
SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Uscn Life Science Inc. Wuhan
Uscn Life Science Inc. Wuhan Website: www.uscnk.com Phone: +86 27 84259552 Fax: +86 27 84259551 E-mail: [email protected] ELISA Kit for Human Creatine Kinase,Mitochondrial 1A (CKMT1A) Instruction manual
Illumina Security Best Practices Guide
Illumina Security Best Practices Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Hardware Configuration 4 Domain Configuration 6 Windows Updates 7 Technical Assistance
Sequencing Analysis Software User Guide
Sequencing Analysis Software User Guide For Pipeline Version 1.5 and CASAVA Version 1.0 FOR RESEARCH USE ONLY ACGTACGTACGTACG TACGTACGTACGTACGTA A G T G AC CG C T AC CGT ILLUMINA PROPRIETARY Catalog #
REAL TIME PCR SYBR GREEN
REAL TIME PCR SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM QUANTITATION
Molecular Assessment of Dried Blood Spot Quality during Development of a Novel Automated. Screening
Molecular Assessment of Dried Blood Spot Quality during Development of a Novel Automated in situ TREC qpcr Assay for SCID Screening J Bai, T Henry, J Benfer, S Berberich, T Kreman, and L DesJardin State
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0
NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version
