Review of AB-Ambion systems for microrna Isolation, Analysis and Regulation
|
|
|
- Charla Hart
- 10 years ago
- Views:
Transcription
1 Review of AB-Ambion systems for microrna Isolation, Analysis and Regulation Marjorie JOINER Ingénieur Applications Applied Biosystems France Isabelle KAYSER Ingénieur Commercial Applied Biosystems France
2 mirnas: An Emerging Field 600 # of Publications lin-4-antisense RNA critical for C. elegans developmental timing mirnas discovered in human and mouse mirnas implicated in cancer mirnas implicated in viral infection mirna publications are increasing at a rate of two-fold per year 2 October 14, Applied Biosystems
3 mirnas: Genomics Short, single-stranded, endogenous, non-coding RNAs Cleaved from nt precursors by Drosha/Dicer Found in animals and plants Estimated > mirna genes in human Wider range of expression: Few to 100,000 copies per cell Mature mirnas can regulate multiple genes Target mrnas for translational repression or cleavage 3 October 14, Applied Biosystems
4 mirna Genes ~60% of mirnas are expressed independently ~15% of mirnas are expressed in clusters ~25% are in introns C. elegans 4 October 14, Applied Biosystems
5 mirna Expression 1. Transcription 2. Hairpin release in the nucleus 3. Export to cytoplasm 4. Dicer processing 5. Strand selection by RISC 6. Translational repression *mature active strand 5 October 14, Applied Biosystems
6 mirna Modes of Function The basic function of mirnas is the reduction of protein levels of targeted genes The three main mechanisms: Transcriptional silencing - mirnas can regulate many target genes mrna cleavage by perfect complementarity e.g plant mirnas Translational repression imperfect complementarity Each mirna appears to regulate the translation of multiple genes, and many genes appear to be regulated by multiple mirnas. 6 October 14, Applied Biosystems
7 Diverse mirna functions in animals and plants Development Timing (Lee et al. 1993) Cell proliferation (Brennecke et al. 2003) Stem cell & neuron (Krichevsky et al. 2003; Hatfield et al., 2005) Cell death (Baehrecke, 2003) Diseases Cancers (Lu et al. 2005) mirna oncogenes (He et al. 2005) Brain tumors (Ciafre et al. 2005; Chan et al. 2005) Leukemia (Calin et al. 2002; 2004) Diabetes (Poy et al. 2004) Cholesterol biosynthesis (Krutzfeldt et al. 2005) DNA methylation and chromatin modification (Bao et al. 2004) 7 October 14, Applied Biosystems
8 mirna Fundamental Questions Where and when are mirnas expressed? What mirnas are expressed? Isolate, clone, and sequence or bioinformatics mirna expression profiling What cell processes are regulated by mirnas? mirna library screening What genes do mirnas control? Functional analysis 8 October 14, Applied Biosystems
9 mirna analysis strategy mirna Isolation and Enrichment mirna Expression Profiling mirna Expression Verification mirna Functional Analysis mirvana mirna Kit TaqMan MicroRNA Cells-to-Ct mirvana PARIS Kit RecoverAll Total Nucleic Acid Isolation Kit flashpage Fractionator System RNAqueous - Micro Kit LeukoLOCK Total RNA Isolation System TaqMan MicroRNA Array TaqMan MicroRNA Assays TaqMan MicroRNA Array Pre-miR mirna Precursor Molecules Anti-miR mirna Inhibitor Molecules pmir-report Expression Vector Dual- Light Assay System Western-SuperStar Immunodetection System 9 October 14, Applied Biosystems
10 Isolation of MicroRNA
11 mirvana mirna Isolation Kit Efficient isolation of small RNAcontaining total RNA Optional mirna enrichment procedure improves mirna detection sensitivity in array and Northern applications Simple 30 minute procedure Compatible with fresh, frozen, RNAlater-treated, and RNAlater-ICE treated samples ( mg) Results in exceptional quality RNA 11 October 14, Applied Biosystems
12 mirvana mirna Isolation Kit 12 October 14, Applied Biosystems
13 mirna Isolation Solutions for Various Sample Types TaqMan MicroRNA Cells-to-CT Kit 13 October 14, Applied Biosystems
14 TaqMan MicroRNA Cells-to-CT Kit The first and only complete workflow solution for analyzing microrna expression when starting with ,000 cultured cells A fast, simple streamlined workflow skipping traditional RNA isolation with gold standard performance 14 October 14, Applied Biosystems
15 TaqMan MicroRNA Cells-to-CT Kit Fast, Simple, Convenient 1. Lysis All at room temp No centrifugations No organics No filter to clog Can be done directly in 96 or 384 culture plates 2. Reverse Transcription As much as 33% of RT can be composed of lysate can be used Compatible with Multiplex 3. Real-time PCR Enough reagents for 5 PCR reactions for each lysis 15 October 14, Applied Biosystems
16 Analysing MicroRNA Expression
17 AB Assay Objective: Develop a Real-Time PCR TaqMan Assay to quantify mature* micrornas Precursor mirna Mature mirna *Mature mirnas are the biologically active form 17 October 14, Applied Biosystems
18 mirna RT primer TaqMan MicroRNA Assays cdna Forward primer Step 1: Stem-loop RT Step 2: Real-time PCR Four oligos per mirna 1. RT primer 2. Forward primer 3. Reverse primer 4. TaqMan probe Two enzymes required 1. Reverse transcriptase 2. AmpliTaq Gold DNA Polymerase Q F TaqMan probe Reverse primer Nucleic Acid Research v33: e October 14, Applied Biosystems
19 Assay Specificity: looped vs. linear RT Mature mirnas Precursors mirna assays Perfectly matched C T Mismatched C T C T (Mismatch vs. match) C T C T (Precursor vs. mature) let-7a Looped Linear October 14, Applied Biosystems
20 Single-base Discrimination Relative detection (%) calculated based on C T difference between perfectly matched and mismatched assays ugagguaguagguuguauaguu ugagguaguagguugugugguu ugagguaguagguuguaugguu agagguaguagguugcauagu ugagguaggagguuguauagu Number of base differences between mirnas October 14, Applied Biosystems
21 mirna Quantitation Synthetic mirna Amplification plot and standard curve: 7-logs Normalized FAM dye signal ( Rn) Estimated synthetic mirna input (lin-4) based on A 260 : 7, 70, 700, 7,000, 70,000, 700,000, 7M, and 70M copies in PCR A 70M copies 7 copies Threshold Cycle (C T ) Slope = -3.4 R 2 = B PCR cycle Copy number (log 10 ) 21 October 14, Applied Biosystems
22 mirna Quantitation Total RNA Detection sensitivity: 25 pg total RNA Dynamic range: 10 4 using mouse lung total RNA R 2 = mir-2 mir-7 mir-10a Ct 30 mir-10b R 2 = Total RNA Input (ng) in RT mir-16 mir-20 mir-21 mir October 14, Applied Biosystems
23 TaqMan MicroRNA Assay Reproducibility 384 replicates of hsa-let-7a assays Total RNA input 15 ng per RT reaction Averaged standard deviation of C T : October 14, Applied Biosystems
24 Relative Quantitation Requires Normalization Controls No established endogenous controls for mirnas to date Candidates: snornas rrna or snrna genes: 18S, 2S, U6 etc. Endogenous microrna genes Housekeeping genes: GAPDH, Beta-actin etc. Ideal control: Mimic mirnas Size Assay chemistry Ubiquitous/abundant Stable expressors 24 October 14, Applied Biosystems
25 Relative Quantitation Requires Normalization Controls Expression in normal Human tissues RNU24 RNU66 RNU19 RNU38B RNU49 Z30 RNU6B RNU48 RNU44 RNU Ileum Jejunum Duodenum Proximal Colon Distal Colon Esophagus Trachea Vena Cava Pericardium Left Atrium Left Ventricle Right Atrium Right Ventricle Fallopian Tube Thyroid Uterus Lymph Node Placenta Breast Pancreas Adipose Liver Brain_lot# 114P B Thymus Heart Lung_C: lot # 025P B Spleen Testicle Ovary Kidney Skeletal Muscle Small Intestine Colon Prostate Bladder Cervix Adrenal Stomach 4330_Brain tissue A4126_ Brain tissue Average CT Tissues 25 October 14, Applied Biosystems
26 Relative Quantitation Requires Normalization Controls Endogenous Controls for Mouse mirnas snorna135 snorna142 snorna202 snorna234 snorna251 CT M. Stomach M. Bladder M. Placenta M. Colon M. Mamm. Gld M. Ovary M. Brain M. Lung M. Kidney M. Heart M. Liver M. Embryo Tissue 26 October 14, Applied Biosystems
27 Individual Assays Summary Total of >1600 predesigned Individual Assays 813 Human 584 Mouse 349 Rat 46 Endogenous controls RNU24, RNU66, RNU19, RNU38B, RNU49, RNU48, Z30, RNU6B, RNU44, RNU43, U18, RNU58B, RNU58A, RPL21, U54, HY3, U75, U47, snorna135, snorna142, snorna202, snorna234, snorna251, Additional Assays including Arabidopsis (62), C. elegans (74), Drosophila (76) Additional human, mouse, and rat assays released regularly NEW! Custom TaqMan Small RNA Assays 27 October 14, Applied Biosystems
28 What are stem cells? Stem cells are cells with unique qualities: Self-renewal Multipotency How to tell stem cells from adult cells Embryonic stem (ES) cells mrnas (Oct4, Nanog, Sox2, AFP et al.) Cell surface markers (CD34, c-kit, Sca-1 et al) Can mirnas be used as biomarkers to distinguish between ES and differentiated cells? 28 October 14, Applied Biosystems
29 MicroRNA Profiles Classify ES and Differentiated Cells Chen et al Mammalian Genome Vol. 18 & Strauss et al Mammalian Genome Vol EB ES Tissue 5. ES differentiation-related mirnas 1. Highly expressed mirnas 248 micrornas 4. Stem cell specific mirnas 5. ES differentiation-related mirnas 3. Somatic Tissue specific mirnas 5. ES differentiation-related mirnas 2. Rarely expressed mirnas 29 October 14, Applied Biosystems 3. Somatic Tissue specific mirnas
30 Mouse MicroRNA Markers ES cell-specific EBs ES Tissues Differentiation-specific EBs ES Tissues mir-302c mir-290 mir-367 mir-302b mir-302d mir-302a mir-295 mir-293 mir-294 mir-182* mir-133a mir-223 mir-27an mir-425 mir-187 mir-378 mir-196b mir-26an mir-26b mir-30a-5p mir-30c mir-30bn mir-30b mir-15a mir-126 Embryoid bodies (EBs): 1. EB35d9_Ad 4. EB60d6_Nad 2. EB60d9_NAd 5. EB35d6_Ad 3. EB60d6_Ad ES lines: 6. ES60b 7. ES60a 8. ES35 9. ES60c Mouse tissues: 10. Liver 13. Kidney 11. Heart 14. Brain 12. Lung 15. Embryo 30 October 14, Applied Biosystems
31 Mouse tissue-specific mirnas EB ES Tissues mir-153 mir-128b mir-128a mir-383 mir-341 mir-138 mir-154 mir-129 mir-196b mir-34cn mir-208 mir-122a EBs & ES lines: 1. EB35d9_Ad 2. EB60d9_NAd 3. EB60d6_Ad 4. EB60d6_NAd 5. EB35d6_Ad 6. ES60b ES60a 8. ES35 9. ES60c Brain Cloned in neurons by Ruvkun Lab (2004) EB, kidney, embryo Lung Heart Liver, embryo By Tuschl Lab (2003) Tissues: 10. Liver 11. Heart 12. Lung 13. Kidney 13. Kidney 14. Brain 15. Embryo 31 October 14, Applied Biosystems
32 TaqMan Array for MicroRNA Expression Analysis
33 TaqMan MicroRNA Array Applied Biosystems 7900 Fast Real Time PCR System 33 October 14, Applied Biosystems
34 TaqMan Performance in 384-Well Low Density Array 1 to to 8 Samples ~1µL reaction volume to to 380 Targets (per (per card) card) 1, 1, 2,3 or or 4 Replicates TaqMan Gene Expression Assays pre-loaded into each well 34 October 14, Applied Biosystems
35 35 October 14, Applied Biosystems
36 MicroRNA Profiling with TaqMan MicroRNA Arrays Megaplex Pools with v2.0 TaqMan Arrays Megaplex Pools and TaqMan MicroRNA Arrays Megaplex RT Primers Megaplex Preamp Primers (optional) TaqMan MicroRNA Arrays Benefits Gold-standard TaqMan quality data Streamlined workflow data within single working day Significant sample savings as low as 1ng input Broad coverage of Sanger v10 content Sanger v10 compatible Megaplex Pools 36 October 14, Applied Biosystems
37 Profiling Workflow without Preamplification 1 Prepare Sample mirna 2 Reverse Transcribe RNA Megaplex RT Primers & TaqMan MicroRNA Reverse Transcription Kit 3 Load TaqMan Array RT product & TaqMan Universal Master Mix 4 Run TaqMan Array Applied Biosystems 7900HT Fast Real- Time PCR System Total RNA 30 min. 150 min. 10 min. 120 min. Total time ~ 5 hrs 37 October 14, Applied Biosystems
38 Profiling Workflow with Preamplification 1 Prepare Sample 2 Reverse Transcribe RNA 3 Amplify cdna 4 Dilute cdna & load TaqMan Array 5 Run TaqMan Array mirna Megaplex RT Primers & TaqMan MicroRNA Reverse Transcription Kit Megaplex Preamp Primers & TaqMan Preamp Master Mix Diluted RT product &TaqMan Universal Master Mix Applied Biosystems 7900HT Fast Real- Time PCR System Total RNA 1:10 1:4 1: min. 150 min. 90 min. 10 min. 120 min. Total time ~ 6.5 hrs 38 October 14, Applied Biosystems
39 Preamplification Concept Conventional gene expression analysis Reverse transcribe RNA to cdna Perform real-time PCR with TaqMan Assays RNA cdna Gene expression analysis with preamplification Reverse transcribe RNA to cdna Preamplify cdna using pool of TaqMan Assays Perform real-time PCR with same TaqMan Assays RNA cdna 39 October 14, Applied Biosystems
40 Generate Data From Very Limited Sample Sources FACS, FNA, LCM, FFPE, stem cells Workflow Options Individual TaqMan MicroRNA Assay Megaplex Pools w/o preamp Megaplex Pools with preamp Supported input range 1 10 ng 350 1,000 ng ng RT reaction volume 15 µl 7.5 µl 7.5 µl Preamp reaction volume N/A N/A 25 µl TaqMan Assay reaction volume 20 µl 1 µl 1 µl Minimal input sample amount 1 ng per reaction 350 ng / RT reaction 1ng / RT reaction # of targets Minimal input sample amount per assay (target) 1,000 pg ~920 pg ~0.27 pg 40 October 14, Applied Biosystems
41 Megaplex MicroRNA Profiling - Pool Content Up Up to to targets Megaplex RT Primers Megaplex Preamp Primers (optional) Species Content Megaplex RT Primers Megaplex Preamp Primers TaqMan Array mirna Targets Controls +ve -ve Human A B Yes Yes Optional Optional Yes Yes Total 667 Rodent (Mouse & rat) A B Yes Yes Optional Optional Yes Yes Total October 14, Applied Biosystems
42 Megaplex Pools Design Distributed content for both human and rodent to mirbase v10.1 A content: matched Megaplex RT, Preamp and TaqMan Array MicroRNAs of greatest interest (functionally defined and/or broadly/highly expressed) Some pool optimization B content: matched Megaplex RT, Preamp and TaqMan Array MicroRNAs whose function is not clearly defined and/or are narrowly/lowly expressed Significant number of mir* sequences Minimal pool optimization 42 October 14, Applied Biosystems
43 TaqMan MicroRNA Arrays TaqMan Human microrna Array v2 Manufacturing Control- Mammalian U6 Endogenous Controls - RNU44, RNU48, Negative Control - ath-mir-159a, Pool B (290 assays) 3 additional controls (RNU24, RNU43, RNU6B), quadruplicate A and B provides 92% coverage of mirbase 10 content TaqMan Rodent microrna Array v2 Manufacturing Control- Mammalian U6 Endogenous Controls - snorna135, snorna202, U87 and Y1 Negative Control - ath-mir-159a Pool B (210 assays) 1 additional Endogenous Controls, snorna42 run in replicate A and B provide 89% coverage for mouse and 86% coverage for rat. 43 October 14, Applied Biosystems
44 Reproducibility of Human Megaplex Primer Pools on TaqMan Array- w/o PreAmp y = x R 2 = y = x R 2 = Ct of HPA Megaplex RT-II Ct of HPA Megaplex RT-III Ct of HPA Megaplex RT-III y = x R 2 = Ct of HPA Megaplex RT-I Ct of HPA Megaplex RT-I! Ct of HPA Megaplex RT-II 44 October 14, Applied Biosystems
45 Reproducibility of Human Megaplex Primer Pool A on TaqMan Array A w/ PreAmp y = 1.025x R 2 = y = x R 2 = Ct of HPA PreAmp-II Ct of HPA PreAmp-III y = x R 2 = Ct of HPA PreAmp I Ct of HPA PreAmp -III Ct of HPA PreAmp -I! "#$% Ct of HPA PreAmp-II 45 October 14, Applied Biosystems
46 Analyzing MicroRNA Function
47 mirna functionality Three different strategies to understand mirna function Correlate protein, mirna and mrna expressions to phenotypic differencies Alter endogenous levels of mirna with synthetic mirna specific reagents. In-silico mirna target prediction 47 October 14, Applied Biosystems
48 Correlate mirna expressions to phenotypic differences! October 14, Applied Biosystems
49 Alter endogenous levels of mirna with synthetic mirna specific reagents Pre-miR mirna Precursors (Ambion) Effective microrna mimics for performing gain-of-function experiments Anti-miR mirna Inhibitors (Ambion) Tight binding microrna inhibitors for performing loss-of-function experiments With these ready-to-transfect molecules, you can: Determine the biological function of a particular mirna Validate that a particular mirna regulates the expression of a putative target gene Screen for mirnas that affect a cellular process or that down-regulate a specific gene 49 October 14, Applied Biosystems
50 Alter endogenous levels of mirna with synthetic mirna specific reagents 50 October 14, Applied Biosystems Ambion Pre-miR mirna Precursor Molecules enter the mirna pathway when transfected into cultured mammalian cells Ambion Anti-miR mirna Inhibitors, reduce mirna activity when transfected into cells
51 An Onco-miR Case Study: let-7 mirna microarray data revealed that let-7 is significantly down-regulated in almost all lung cancer patients with squamous cell carcinomas Two putative target genes for let-7 are oncogenes, RAS and MYC (in C elegans; Frank Slack) Both RAS and MYC have been implicated along with p53 as key oncogenes in lung cancer let-7 is one of the best-characterized animal mirnas 51 October 14, Applied Biosystems
52 Confirmation of let-7 Target Genes mirna Addition Experiment HepG2 cells (low let-7) Precursor mirnas Neg Control let-7 Pre-miR Introduce let-7 mirna RAS protein expression Block target mrna translation MYC protein expression Measure target protein Johnson SM et al (2005) Cell 120: October 14, Applied Biosystems
53 Confirmation of let-7 Target Genes mirna Subtraction Experiment HeLa cells (high let-7) Anti-miR Negative Control let-7 Anti-miR Introduce let-7 inhibitors RAS protein expression Block mirna and induce target mrna translation MYC protein expression Measure target protein 53 October 14, Applied Biosystems Johnson SM et al (2005) Cell 120:
54 let-7 and RAS Expression in Lung Samples Pair 1 Pair 2 Pair 3 NAT T NAT T NAT T GAPDH protein Ras protein let-7 mirna U6 snrna 1200 Real time PCR Limited correlation between RAS mrna and RAS protein expression levels Actin mrna Ras mrna 54 October 14, Applied Biosystems
55 let-7 and RAS Expression in Lung Samples Pair 1 Pair 2 Pair 3 GAPDH protein NAT T NAT T NAT T Ras protein let-7 mirna U6 snrna 1200 Real time PCR Good correlation between let7 mirna and RAS protein expression levels Actin mrna Ras mrna let-7 = may regulate Ras oncogene expression in lung and is potentially a tumor suppressor in lung? 55 October 14, Applied Biosystems
56 let-7a let-7b mir-29a mir-19a mir-18 mir-20 mir mir a mir mir b mir-10a mir-24-1x 99a mir-15a mir-23b mir a % Viability mirnas Differentially Affects Cancerous and Non-Cancerous Cells Cancer repressing Leukemia Control % Viability let-7a mir-10b let-7b mir-17-3p 56 October 14, Applied Biosystems Cancer promoting % Viability mir-140 mir-155 mir-143
57 Some MicroRNA function publications Gene Regulation (Zamore et al. 2005, Rajewsky et al. 2006, Jackson & Standart, 2007) Cell proliferation (Brennecke et al. 2003, Sarnow et al. 2006) Metabolism (Poy et al. 2004) Cell death (Baehrecke, 2003, Miska et al. 2005) Stem cell & neuron development (Krichevsky et al. 2003, Tang et al. 2006, Tonelli et al. 2006) Cancer (Michael et al. 2003, Johnson et al. 2005, Calin et al. 2006, Esquela- Kerscher et al. 2006, Lu et al. 2005, Voorhoeve et al. 2006) DNA methylation and chromatin modification (Bao et al. 2004) Development: Timing (Lee et al. 1993), Cell proliferation (Brennecke et al. 2003), Neuron (Hatfield et al., 2005) Cell death (Baehrecke 2003; Chen et al. 2006) Diabetes (Poy et al. 2004) Epigenetics (Bao et al. 2004; Henderson et al. 2006) 57 October 14, Applied Biosystems
58 Conclusions
59 Conclusions mirna are key regulator of gene expression involved in various biological processes and diseases Specific research tools developed : To study mirna expression profiling To enable gain and loss of function studies In vivo functional screening and mirna gene target analysis Application for Therapeutics: mirna arrays speed up biomarker discovery for various diseases Accurate profiling demonstrated in tissues (fresh & FFPE) and blood Rapid target identification & biological validation mirnas and the genes they regulate are candidates for development of new therapeutic strategies 59 October 14, Applied Biosystems
60 Thanks for your attention! Any questions?
61 mir-100 mir-99a mir-98 mir-92 mir-96 mir-95 mir-34a mir-32 mir-31 mir-30a-3p mir-29a mir-28 mir-27a mir-26a mir-25 mir-24 mir-23b mir-23a mir-22 mir-21 mir-20 mir-19a mir-18 mir-17-3p mir-16 mir-15a mir-10b mir-10a mir-9 mir-7 mir-1 let-7g let-7d Let-7c let-7b Let-7a G2/M G1 S phase S phase How do mirnas affect cell cycle? G2/M Arrest G1 Arrest mir-191 mir-190 mir-188 mir-187 mir-186 mir-184 mir-183 mir-182 mir-181a mir-155 mir-153 mir-152 mir-151 mir-150 mir-149 mir-148 mir-147 mir-146 mir-145 mir-144 mir-143 mir-142 mir-141 mir-140 mir-139 mir-137 mir-136 mir-135 mir-134 mir-133b mir-133a mir-132 mir-129 mir-128 mir-126 mir-125b mir-125a mir-124 mir-122 mir-108 mir-107 mir-105 mir-103 mir October 14, Applied Biosystems % NC % NC
62 mirnas in Other Clinically Relevant Samples Blood LeukoLOCK Fixed Tissues RecoverAll 62 October 14, Applied Biosystems
63 Which mirnas Affect Cell Proliferation? Introduce Anti-miR mirna Inhibitor Block mirna and induce target mrna translation Measure cell number Reducing let-7 Activity Increases Proliferation in A549 Cells 63 October 14, Applied Biosystems
64 Which mirnas Affect Cell Proliferation? Block target mrna translation Introduce Pre-miR mirna Precursor Relative Proliferation 0 Empty mir-191 mir-190 mir-188 mir-187 mir-186 mir-184 mir-183 mir-182 mir-181a mir-155 Empty mir-153 mir-152 mir-151 mir-150 mir-149 mir-148 mir-147 mir-146 mir-145 mir-144 GAPDH mir-143 mir-142 mir-141 mir-140 mir-139 mir-137 mir-136 mir-135 mir-134 mir-133b GAPDH mir-133a mir-132 mir-129 mir-128 mir-126 mir-125b mir-125a mir-124 mir-122 mir-108 NC2 mir-107 mir-105 mir-103 mir-101 mir-100 mir-99a mir-98 mir-92 mir-96 mir-95 NC2 mir-34a mir-32 mir-31 mir-30a-3p mir-29a mir-28 mir-27a mir-26a mir-25 mir-24 NC1 mir-23b mir-23a mir-22 mir-21 mir-20 mir-19a mir-18 mir-17-3p mir-16 mir-15a NC1 mir-10b mir-10a mir-9 mir-7 mir-1 Let-7g Let-7d Let-7c Let-7b Let-7a 64 October 14, Applied Biosystems
65 Legal Statement For Research Use Only. Not for use in diagnostic procedures. TaqMan MicroRNA Assay: NOTICE TO PURCHASER: LIMITED LICENSE A license to perform the 5' nuclease process for research requires the use of a Licensed 5' Nuclease Kit (containing Licensed Probe), or the combination of an Authorized 5' Nuclease Core Kit plus Licensed Probe, or license rights that may be purchased from Applied Biosystems. This product contains Licensed Probe. Its purchase price includes a limited, non-transferable immunity from suit under U.S. Patents Nos. 5,538,848, 5,723,591, 5,876,930, 6,030,787, and 6,258,569, and corresponding patent claims outside the United States, owned by the Applera Corporation, and U.S. Patent No. 5,804,375 (claims 1-12 only) and corresponding patent claims outside the United States, owned by Roche Molecular Systems, Inc. or F. Hoffmann-La Roche Ltd ( Roche ), for using only this amount of product in the practice of the 5 nuclease process solely for the purchaser s own internal research. This product is also a Licensed Probe for use with service sublicenses available from Applied Biosystems. This product conveys no rights under U.S. Patents Nos. 5,210,015 and 5,487,972, or corresponding patent claims outside the United States, which claim 5 nuclease processes, or under U.S. Patents Nos. 5,476,774 and 5,219,727, or corresponding patent claims outside the United States, which claim quantification methodology, expressly, by implication, or by estoppel. No right under any other patent claims (such as apparatus or system claims) and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, is hereby granted expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Dr., Foster City, California 94404, USA. Applied Biosystems and AB (Design) are registered trademarks and Applera and FAM are trademarks of Applera Corporation or its subsidiaries in the US and/or certain other countries. AmpErase, AmpliTaq Gold, and TaqMan are registered trademarks of Roche Molecular Systems, Inc Applied Biosystems. All rights reserved. 65 October 14, Applied Biosystems
Endogenous Controls for Real-Time Quantitation of mirna Using TaqMan MicroRNA Assays.
application note TaqMan MicroRNA Assays Endogenous Controls for Real-Time Quantitation of mirna Using TaqMan MicroRNA Assays. Introduction MicroRNAs (mirnas) are small noncoding RNAs whose function has
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Comprehensive mirna Research Technologies
Comprehensive mirna Research Technologies Sample & Assay Technologies QIAGEN solutions for advancing microrna research In the last few years, the identification of microrna (mirna) and the recognition
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Using TaqMan Endogenous Control Assays to select an endogenous control for experimental studies
APPLICATION NOTE TaqMan Gene Expression Assays Using TaqMan Endogenous Control Assays to select an endogenous control for experimental studies Introduction Quantitative real-time PCR (qpcr) allows for
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Megaplex Pools For microrna Expression Analysis
Megaplex Pools For microrna Expression Analysis Protocol Copyright 2008, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
The AB7900Fast and Principles of Real Time PCR
The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist [email protected] Pathway Focused Research from Sample Prep to Data Analysis! -2-
Factors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number
application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000
Absolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
Reprogramming, Screening and Validation of ipscs and Terminally Differentiated Cells using the qbiomarker PCR Array System
Reprogramming, Screening and Validation of ipscs and Terminally Differentiated Cells using the qbiomarker PCR Array System Outline of Webinar What are induced pluripotent Stem Cells (ips Cells or ipscs)?
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Profiling of microrna in Blood Serum/Plasma. Guidelines for the mircury LNA TM Universal RT microrna PCR System
Profiling of microrna in Blood Serum/Plasma Guidelines for the mircury LNA TM Universal RT microrna PCR System Table of Contents 2 Introduction.....................................................................................
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan
Highly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System
5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing
User Bulletin #2 ABI PRISM 7700 Sequence Detection System
User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 (updated 10/2001) SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be
amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye
amplification tech note 6047 Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye Liz Jordan and Richard Kurtz, Gene Expression Division, io-rad
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Quantification of Hepatitis B Virus. Core Protein Region. 150 tests
Quantification of Hepatitis B Virus Core Protein Region For general laboratory and research use only 150 tests Introduction to Hepatitis B Virus Originally known as serum hepatitis, hepatitis B has only
Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006
Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed
Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes
Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Human Herpes Virus 4 (Epstein Barr)
Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein
MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
miscript mirna PCR Array Handbook
May 2012 miscript mirna PCR Array Handbook miscript II RT Kit miscript SYBR Green PCR Kit miscript mirna PCR Arrays miscript mirna QC PCR Array For SYBR Green-based, real-time PCR profiling of micrornas
Real-Time Quantitative PCR Instruments and Consumables
Index Page Sequence Detection Systems 2 Sequence Detection Systems Accessories and Softwares 3 Sequence Detection PCR Reagent Kits 4 Sequence Detection PCR Reagents 9 Sequence Detection Systems Disposables
TOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
bitter is de pil Linos Vandekerckhove, MD, PhD
4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV
TaqMan MicroRNA Assays
TaqMan MicroRNA Assays Protocol December 23, 2005 11:22 am, mirna_title.fm Copyright 2005-6, Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards
ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
RNAi Shooting the Messenger!
RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: [email protected] RNA interference (RNAi) A mechanism by which
PART 3.3: MicroRNA and Cancer
BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway
Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial
Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds Overview In order for accuracy and precision to be optimal, the assay must be properly evaluated and a few
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Quantification of Propionibacterium acnes. Standard kit 150 tests
Primerdesign TM Ltd Quantification of Propionibacterium acnes Recombinase A (reca) gene For general laboratory and research use only Standard kit 150 tests Introduction to Propionibacterium acnes Propionibacterium
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
HiPerFect Transfection Reagent Handbook
Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent
Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing
TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...
Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07
Techne qpcr test Lyme Disease RecA gene 150 tests For general laboratory and research use only 1 Introduction to Lyme Disease Lyme disease is an infectious disease caused mainly by three species of bacteria
PNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems
Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All
Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit
USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES
C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
TaqMan Mutation Detection Assay
PROTOCOL TaqMan Mutation Detection Assay Competitive Allele-Specific TaqMan PCR Publication Part Number 4467011 Rev. B Revision Date April 2012 For Research Use Only. Not intended for any animal or human
BIO 137: CHAPTER 1 OBJECTIVES
BIO 137: CHAPTER 1 OBJECTIVES 1. Define the terms anatomy and physiology, and explain their relationship using an example of a human structure with its corresponding function. A. ANATOMY = the study of
QuantStudio 12K Flex Real-Time PCR System. The all-in-one qpcr instrument
QuantStudio 12K Flex Real-Time PCR System The all-in-one qpcr instrument Expand the boundaries of your research Life Technologies is taking qpcr to the next level. Designed for maximum throughput, flexibility,
Methods and Application Guide. Introduction to Quantitative PCR
Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304
Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
mirnaselect pegp-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pegp-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-GP-C STORAGE: -80ºC QUANTITY: 100 µl of bacterial glycerol stock Components 1. mirnaselect pegp-mir Cloning
TaqMan Gene Expression Assays
Product Guide TaqMan Gene Expression Assay Products Product Guide TaqMan Gene Expression Assays Applied Biosystems TaqMan Gene Expression Assays Solutions Applied Biosystems offers the largest family of
DyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit
USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September
