pcdh cdna Cloning and Expression Lentivectors
|
|
|
- Melissa Ward
- 9 years ago
- Views:
Transcription
1 pcdh cdna Cloning and Expression Lentivectors Cat. #s CD500 CD700 User Manual Store kit at -20 C on receipt (ver ) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual.
2 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series Contents I. Introduction and Background A. Purpose of this Manual 2 B. Advantages of the Lentivector Expression System 2 C. pcdh cdna Cloning and Expression Lentivectors 3 D. List of Components 7 E. Additional Required Materials 7 F. Safety Guidelines 9 II. Protocol A. cdna Amplification 11 B. Primer Design for T2A Vector Cloning 11 C. Preparation of Digested pcdh Vectors 12 D. Cloning of cdna into pcdh Vectors 13 E. Packaging of pcdh Expression Construct 15 III. Troubleshooting A. Large number of colonies on control plate 16 B. No or low number of colonies on plate with cdna sample 16 C. No correct cdna inserts 17 IV. References 18 V. Appendix A. Maps and Features for pcdh Vectors 19 B. Descriptions of Features in pcdh Vectors 22 C. Properties of copgfp Fluorescent Protein 23 D. Related Products 23 E. Technical Support 24 VI. Licensing and Warranty Statement (Toll Free) (outside US) Page 1
3 System Biosciences (SBI) User Manual I. Introduction and Background A. Purpose of this Manual This manual provides details and information necessary to generate expression constructs of your gene of interest in the pcdh cdna Cloning and Expression Lentivectors. Specifically, it provides critical instructions on amplification and cloning cdna into the pcdh vectors, and verification of the final expression constructs. This manual does not include information on packaging the pcdh expression constructs into pseudotyped viral particles or transducing your target cells of choice with these particles. This information is available in the user manual Lentivector Expression Systems: Guide to Packaging and Transduction of Target Cells which is available on the SBI website ( Before using the reagents and material supplied with this system, please read the entire manual. B. Advantages of the Lentivector Expression System Lentiviral expression vectors are the most effective vehicles for the delivery and expression of a gene of interest to almost any mammalian cell including non-dividing cells and model organisms (C.A. Machida, 2003; M. Federico, 2003; W. C. Heiser, 2004). As with standard plasmid vectors, it is possible to introduce lentivector expression constructs in plasmid form into the cells with low-to-medium efficiency using conventional transfection protocols. However, by packaging the lentivector construct into viral particles, you can obtain highly efficient transduction of expression constructs even with the most difficult to transfect cells, such as primary, stem, and differentiated cells. The expression construct transduced in target cells is integrated into genomic DNA and provides stable, long-term expression of the target gene. SBI offers a third generation of the most popular HIV-1 based lentivector expression system which consists of three main components: (1) The lentiviral expression vector (e.g., pcdh-ef1-mcs-t2a-puro) (2) The lentiviral packaging plasmids (e.g., ppackh1 Packaging Plasmid mix) (3) A pseudoviral particle producer cell line (e.g., 293TN cells) The expression lentivector contains the genetic elements responsible for packaging, transduction, stable integration of the viral expression construct into genomic DNA, and expression of the target gene sequence. The packaging vector provides all the proteins essential for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles. To produce a high titer of viral particles, expression and packaging vectors are transiently co-transfected into producer mammalian cells (e.g., HEK 293 cells). For a detailed description of SBI s Lentivector expression system, please refer to the Lentivector Expression System user manual. C. pcdh Cloning and Expression Lentivectors SBI provides a collection of cdna cloning and expression vectors for various applications (Table 1). A gene of interest can be cloned under a CMV or EF1 promoter with or without another expression cassette for a reporter gene (copgfp or Puro R ). Genes can be either expressed transiently through transfection or stably expressed in a target cell line through transduction with packaged viral particles. Single Promoter Dual Promoter cdna vectors pcdh-ef1-mcs pcdh-ef1-mcs-t2a-puro pcdh-ef1-mcs-t2a-copgfp pcdh-mcs-t2a-puro-mscv pcdh-mcs-t2a-copgfp-mscv pcdh-cmv-mcs pcdh-cmv-mcsr pcdh-cmv-mcs-ef1-puro pcdh-cmv-mcs-ef1-copgfp target gene promoter EF1 EF1 EF1 MSCV MSCV CMV CMV CMV CMV Expression level Medium High High Application robust in most cell types, including primary differentiated cells hematopoietic / stem cell lines commonly used cell lines (e.g. HeLa, HEK293, HT1080, H1299) Page 2 ver
4 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series Table 1. pcdh Vector Applications. Comparison of the expression levels of different promoters and the various applications proposed for each cdna vector. EF1: elongation factor 1α; MCS: multiple cloning sites; T2A: self-cleavable 2A peptide; MSCV: 5 LTR promoter from mouse stem cell virus; CMV: cytomegalovirus promoter. Choice of Promoter The major concern of cdna expression in lentivectors is the efficiency level and stability of expression in target cell lines. The Cytomegalovirus (CMV) promoter is a strong and most commonly used viral promoter that constitutively expresses downstream genes. While the CMV promoter works perfectly in the most common cell lines, it shows poor expression in some stem cell lines and hematopoietic cell lines (R.F. Doll, 1996; E.D. Papadakis, 2004). The housekeeping elongation factor 1α (EF1) promoter has been shown to exceed and outlast CMV-mediated expression in retroviral, lentiviral, and adenoviral vectors, in hematopoietic cell lines (K. Tokushige 1997; H. Nakai, 1998; C. Teschendorf, 2002). EF1 also performs well in most common cell lines. MSCV promoter is the 5 -LTR promoter of murine stem cell virus. When a portion of the U3 region of the 3 HIV LTR was replaced with the U3 region of MSCV LTR, the resulted hybrid HIV/MSCV LTR has dramatically increased the transgene expression level in human CD34+ hematopoietic cells (J.K. Choi, 2001). After integration into genomic DNA, this promoter transcribes a long transcript with an intron in the 5 UTR flanked with splice donor and acceptor sites derived from the lentiviral vector. Further studies found that additional CpG mutations in the MSCV LTR reduced transcriptional silencing in embryonic stem cells (C.S. Swindle, 2004). We constructed cdna expression vectors with the CpG-deficient MSCV incorporated into the 3 HIV LTR. After integration into genomic DNA, 3 MSCV/LTR will replace the 5 LTR and provide a high level of expression of the target gene and reporter gene downstream. 2A Peptide-enabled dual expression system Coexpression of a reporter gene together with a gene of interest is a useful approach for selecting transfected or transduced cells. This is commonly achieved by using two independent internal promoters, such as CMV and EF1 in pcdh-cmv-mcs- EF1-copGFP, or by linking two transgenes with an internal ribosomal entry site (IRES) element in a single bicistronic transcript. Many dual promoter pairs have shown a high level of expression of both transgenes in standard cell lines however, promoter interference often occurs in some cell lines. There are also two main problems that limit the use of IRES: the large size and the imbalanced expression between the first and second cistrons (H. Mizuguchi, 2000; X.Yu, 2003). The self-cleaving 2A peptides have been used successfully to generate multiple proteins from a single promoter in many applications (P. de Felipe, 2004; M.J. Osborn, 2005; P. de Felipe, 2006). The 2A-like sequences exist in several viruses and are used to mediate protein cleavage from a single open reading frame. Through a ribosomal skip mechanism, the 2A peptide prevents normal peptide bond formation between the 2A glycine and the 2B proline without affecting the translation of 2B (M.L. Donnelly, 2001): T2A Peptide 2A 2B GeneA E G R G S L L T C G D V E E N P G P GeneB SBI s cdna expression vectors incorporate the 2A-like sequence (T2A) from the insect virus Thosea asigna to mediate the coexpression of a reporter gene with the target cdna. Reporter genes have been cloned at either the first or second positions, and we achieved high expression levels at both locations (see Figure 1). A. B. pcdh-ef1-puro-t2a-copgfp pcdh-puro-t2a-copgfp-mscv C. D (Toll Free) (outside US) Page 3
5 System Biosciences (SBI) User Manual pcdh-ef1-cg-t2a-puro pcdh-cg-t2a-puro-mscv Fig. 1. Flow cytometry analysis of HT1080 cells transduced with dual reporter constructs. The puromycin-resistance gene (puro) was cloned into pcdh-ef1-mcs-t2a-copgfp (A) and pcdh-mcs-t2a-copgfp-mscv (B); and the copgfp gene (cg) was cloned into pcdh-ef1-mcs-t2a-puro (C) and pcdh-mcs-t2a-puro-mscv (D). The resulting dual reporter constructs were packaged into pseudoviral particles followed by transduction into HT1080 cells. All constructs were also puromycin resistant (data not shown). Page 4 ver
6 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series The HIV-1 derived pcdh vectors contain the following common features: Multiple Cloning Site (MCS) for cloning the gene of interest in the MCS located downstream of the CMV promoter. WPRE element enhances stability and translation of the CMV-driven transcripts. SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts. Hybrid RSV/5LTR promoter provides a high level of expression of the full-length viral transcript in producer 293 cells. Genetic elements (cppt, gag, env, LTRs) necessary for packaging, transducing, and stably integrating the viral expression construct into genomic DNA. SV40 origin for stable propagation of the pcdh plasmid in mammalian cells. puc origin for high copy replication and maintenance of the plasmid in E.coli cells. Ampicillin resistance gene for selection in E.coli cells (Toll Free) (outside US) Page 5
7 System Biosciences (SBI) User Manual D. List of Components Component Conc. Amount pcdh cdna Expression Vector 0.5 g/l 20 g All plasmids are shipped at a concentration of 0.5 g/l and an amount of 20 g. All plasmids are shipped in dry ice or blue ice and should be stored at -20 C upon receipt. Properly stored plasmids are stable for 12 months from the date received. Available pcdh cdna Cloning and Expression Lentivectors: Vectors without reporter Catalog # pcdh-cmv-mcs * CD500B-1 pcdh-cmv-mcsr ** CD501A-1 pcdh-ef1-mcs CD502A-1 Vectors with reporter genes Catalog # pcdh-cmv-mcs-ef1-puro CD510B-1 pcdh-cmv-mcs-ef1-copgfp CD511B-1 pcdh-ef1-mcs-t2a-puro CD520A-1 pcdh-ef1-mcs-t2a-copgfp CD521A-1 pcdh-mcs-t2a-puro-mscv CD522A-1 pcdh-mcs-t2a-copgfp-mscv CD523A-1 * new version of pcdh1-mcs1 (Cat. # CD500A-1) ** originally named pcdh1-mcs2 (Cat. # CD501A-1) new version of pcdh1-mcs1-ef1-puro (Cat. # CD510A-1) new version of pcdh1-mcs1-ef1-copgfp (Cat. # CD511A-1) For MCS sequences for the various vectors, please refer to Appendix. E. Additional Required Materials For Cloning Restriction enzymes for digestion of the vectors and/or inserts (Recommended: New England BioLabs enzymes) High Fidelity Long-distance PCR enzymes T4 DNA Ligase and ligation reaction buffer (Recommended: New England BioLabs T4 DNA Ligase (400 U/l), Cat. # M0202S. Dilute to 40 U/l in 1X ligation buffer with the provided 10X buffer just before use) High efficiency competent E. coli cells (RecA - ) (Recommended: MaxEfficiency Stbl2 competent cells, Life Tech (Cat # ) or One Shot OmniMAX 2 T1R competent cells, Cat. # C854003) Petri plates containing LB Agar media with 50 g/ml Ampicillin For Screening Inserts and Sequencing Taq DNA polymerase, reaction buffer, and dntp mix (Recommended: Clontech Titanium Taq DNA polymerase, Cat. # ) PCR machine 2-3% 1X TAE Agarose gel For Purifying cdna Constructs after Cloning Plasmid purification kit (Recommended: QIAGEN Endofree Plasmid Maxi Kit, Cat. # The following kit combination can be used for Midi scale (up to 200 g of plasmid DNA) preparation of endotoxin-free DNA: QIAfilter Plasmid Midi Kit, Cat. # 12243, and EndoFree Plasmid Buffer Set, Cat. # Please visit the QIAGEN website to download the specialized protocol that is not contained in the current user manual: For Transfection of pcdh Constructs into Target Cells Transfection Reagent (Recommended: Invitrogen Lipofectamine 2000, Cat. # ) Page 6 ver
8 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series For Packaging of pcdh Constructs in Pseudoviral Particles In order to package your pcdh cdna constructs into VSV-G pseudotyped viral particles, you will need to purchase the ppackh1 Lentivector Packaging Kit (Cat. # LV500A-1). The protocol for packaging and transduction of packaged pseudoviral particles is provided in the Lentivector Expression Systems User Manual. 293 Producer Cell Line (Recommended: SBI 293TN Cell Line, Cat. # LV900A-1 or ATCC 293 Cells, Cat. # CRL-11268) Transfection Reagent (Recommended: Invitrogen Lipofectamine, Cat. # and Plus Reagent, Cat # ) (Toll Free) (outside US) Page 7
9 System Biosciences (SBI) User Manual F. Safety Guidelines SBI s expression lentivectors together with the ppack packaging plasmids comprise the third-generation lentiviral expression system. The HIV-based lentivectors are based on the vectors developed for gene therapy applications by Dr. J. G. Sodroski (U.S. patents # 5,665,577 and # 5,981,276). Both FIV-based and HIV-based lentivector systems are designed to maximize their biosafety features, which include: A deletion in the enhancer of the U3 region of 3 LTR ensures self-inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells. The RSV promoter (in HIV-based vectors) and CMV promoter (in FIV-based vectors) upstream of 5 LTR in the lentivector allow efficient Tat-independent production of viral RNA, reducing the number of genes from HIV-1 that are used in this system. Number of lentiviral genes necessary for packaging, replication and transduction is reduced to three (gag, pol, rev), and the corresponding proteins are expressed from different plasmids (for HIV-based packaging plasmids) lacking packaging signals and share no significant homology to any of the expression lentivectors, pvsv-g expression vector, or any other vector, to prevent generation of recombinant replication-competent virus. None of the HIV-1 genes (gag, pol, rev) will be present in the packaged viral genome, as they are expressed from packaging plasmids lacking packaging signal therefore, the lentiviral particles generated are replication-incompetent. Pseudoviral particles will carry only a copy of your expression construct. Despite the above safety features, use of SBI s lentivectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous viral sequences to form self-replicating virus, or the possibility of insertional mutagenesis. For a description of laboratory biosafety level criteria, consult the Centers for Disease Control Office of Health and Safety Web site at It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follow standard microbiological practices, which include: Wear gloves and lab coat all the time when conducting the procedure. Always work with pseudoviral particles in a Class II laminar flow hood. All procedures are performed carefully to minimize the creation of splashes or aerosols. Work surfaces are decontaminated at least once a day and after any spill of viable material. All cultures, stocks, and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving. Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable, leakproof, properly marked (biohazard, infectious waste) container and sealed for transportation from the laboratory. Please keep in mind that pcdh vectors are integrated into genomic DNA and could have a risk of insertional mutagenesis. Page 8 ver
10 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series II. Protocol The following section provides general guidelines for the cloning of cdna, amplified by PCR, into pcdh vectors. A. cdna Amplification Full length cdna fragments can be recloned from another plasmid or amplified by PCR. PCR-based cloning is the most convenient way for full-length cdna cloning in pcdh vectors. The cdna lentivector does not contain an ATG initiation codon. A translation initiation sequence must be incorporated in the insert cdna if the cdna fragment to be cloned does not already have an ATG codon. We also recommend including a Kozak sequence (i.e. GCCACC) before the ATG for optimal translation. For amplification of the target cdna fragment, design a 5 -primer (containing a Kozak sequence and ATG codon) and 3 -primer with unique restriction sites present in the MCS of the pcdh vector but not present in the cdna sequence. Amplify the cdna fragment by high fidelity long-distance PCR using about 200 ng of plasmid template DNA and a minimum number of cycles (usually cycles), purify, digest the amplified product with end-specific restriction enzyme(s) and purify the digested PCR product in a 1.2% agarose gel to prevent contamination with the original plasmid used for amplification. B. Primer Design for Cloning into Vectors with T2A Sequence Since the gene of interest and the reporter gene in cdna expression vectors containing a T2A peptide sequence will form one open-reading frame, extra attention should be paid when designing the 3 primer for amplifying the target sequence. First of all, do not include a stop codon at the 3 end of target sequence this would prevent the expression of the reporter gene; secondly, place the target sequence in-frame with the 2A peptide. For example, if you would like to clone your target sequence between Xba1 and BstB1, you would need to add one more nucleotide at the end of your target sequence in order to make it in-frame with the 2A peptide and reporter gene (Figure 2) (Toll Free) (outside US) Page 9
11 System Biosciences (SBI) User Manual Swa1 BamH1 Not1.tctaga ttcgaatttaaatcggatccgcggccgct T2A sequence tccggg Puro Xba1 BstB1 gag ggc aga gga agt ctt cta aca tgc ggt gac gtg gag gag aat ccc ggc cct Target Sequence (TS) Ligation tctaga TS ntt cga att taa atc gga tcc gcg gcc gct gag ggc ggc cct tcc ggg Puro XbaI BstB1 SwaI BamH1 Not1 T2A Sequence Fig. 2. Sequence arrangement after target sequence is inserted between Xba1 and BstB1 in cdna cloning vector pcdh-ef1-mcs-t2a- Puro. An additional nucleotide (n) is added after the last codon of the target sequence in order to keep it in frame with the T2A sequence. C. Preparation of Digested pcdh Vector Digest the pcdh vector with the corresponding restriction enzymes used in the preparation of the cdna fragments, and then verify complete digestion of the vector by agarose gel electrophoresis. We suggest that you perform only preparative gel purification of the digested vector if more than one restriction enzyme is used. If you use a single restriction enzyme, dephosphorylation as well as gel purification of the vector is necessary to reduce the background in the vector ligation step. Page 10 ver
12 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series D. Cloning of cdna into pcdh Vector The optimal insert-to-vector molar ratio may be different for different inserts. Always try at least two different ratios (e.g., 10:1 and 30:1) for each experiment. Also make sure to include one negative control reaction, which contains only the digested vector. 1. Ligation of cdna to Vector a. Dilute the gel-purified, digested vector to 10 ng/l. b. Set up 10 l ligation reactions for each sample and control as follows: 1.0 l Digested pcdh Vector (10 ng/l) 7.0 l cdna insert (usually ng) or Nuclease-free water 1.0 l 10X T4 DNA Ligase Buffer 1.0 l T4 DNA ligase (40 U/l) 10.0 l Total volume c. Incubate the ligation reactions at 16 C for 1-2 hrs if it is sticky-end ligation. For blunt-end ligation, use an overnight incubation. 2. Transform E. coli with the ligation product Transform competent cells** (with a transformation efficiency of at least 1x10 9 colonies/g puc19) with the whole ligation reaction (10 l) following the protocol provided with the competent cells. Plate the transformed bacteria on LB-Ampicillin agar plates. **Note: We recommend using Stbl2 or OmniMax 2 T1R competent cells for transformation and propagation of the lentivector construct to avoid unwanted lentivector recombination events. 3. Identify Clones with the cdna Insert a. Depending on the ratio of colony numbers for the cdna sample vs. the negative control sample, randomly pick 5 or more well-isolated colonies and grow each clone in 100 l of LB Broth with 75 g/ml ampicillin at 30 C for 2 hours with shaking. b. Use 1 l of each bacterial culture for screening cdna inserts by PCR and continue to grow the culture for another 4 hours. Store the culture at 4 C (Toll Free) (outside US) Page 11
13 System Biosciences (SBI) User Manual c. Prepare a PCR Master Mix with PCR primers flanking the cdna insert: 1 rxn 10 rxn Composition 0.5 l 5 l PCR primer 1 (10 M) 0.5 l 5 l PCR primer 2 (10 M) 0.5 l 5 l 50X dntp mix (10 mm of each) 2.5 l 25 l 10X PCR Reaction Buffer 19.5 l 195 l Nuclease-free water 0.5 l 5 l Taq DNA polymerase (approx. 5 U/l) 24.0 l 240 l Total volume d. Mix the master mix very well and aliquot 24 l into each well of 96-well PCR plate or individual tubes. e. Add 1 l of each bacterial culture from step (b) into each well (or tube). f. Proceed with PCR using the following program: 94 C, 4 min 1 cycle 94 C, 0.5 min, then 68 C, 1 min/1 kb* 25 cycles 68 C, 3 min 1 cycle * depending on the size of final PCR product, use a shorter or longer time. g. Take 5 l of the PCR reaction and run it on a 1.2% agarose/etbr gel in 1X TAE buffer to identify clones with correct insert. Grow a positive clone with the cdna insert in an appropriate amount of LB-Amp Broth, and purify the construct using an endotoxin-free plasmid purification kit (see Section I.E). Confirm identity of the cdna insert by sequence analysis of the construct using the one of the PCR primers. Alternatively, you may use one of the following sequencing primers which are located upstream of the MCS: Vectors with CMV: 5 -CACGCTGTTTTGACCTCCATAGA-3 Vectors with EF1: 5 -CTCCACGCTTTGCCTGACCCTGCTT-3 Vectors with MSCV: 5 -GGGGTACAGTGCAGGGGAAAGAAT-3 Page 12 ver
14 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series E. Packaging of the pcdh Expression Constructs into Pseudoviral Particles If you are planning to create a stably transduced cell line expressing your gene of interest, you first need to package the cdna lentiviral construct into lenti pseudoviral particles. For this purpose, you will need to purchase the ppackh1 Lentivector Packaging Kit from SBI (see Appendix). Figure 3 schematically shows all steps which need to be performed in order to generate pseudoviral packaged cdna expression constructs. Fig. 2. Schematic presentation of the packaging procedure for lentivector expression constructs and making of stable cell lines. The Lentivector Expression System User Manual includes the procedural information for packaging and transducing the expression constructs. This user manual is also available on the SBI web site ( Although you can create stable transfectants with the lentiviral construct using standard transfection and selection protocols, transduction of the lentiviral cdna construct using packaged pseudoviral particles is the most efficient way to deliver cdna constructs in a wide range of cells, including dividing, non-dividing, and hard-to-transfect cells (Toll Free) (outside US) Page 13
15 System Biosciences (SBI) User Manual III. Troubleshooting A. Large number of colonies on negative control plate If you see that the colony number on the negative control plates (with no insert) is equal or more than on the plate with the cdna sample, there is probably undigested plasmid contamination. Check your digestion conditions, and repeat digestion with an increased concentration of restriction enzyme(s) or use a longer reaction time. For best results, gel-purify and dephosphorylate the vector after single enzyme digestion. Also, check the sequences of the PCR primers in order to be sure that the necessary restriction sites are present. B. No or low number of colonies on plate with cdna sample The efficiency of cdna cloning into the pcdh vector depends on many factors, including size, purity, integrity, modification of insert, selection of restriction sites, etc. If your cdna sample ligation resulted in only a few colonies, please continue with PCR screening first. If none of these few colonies has the right insert, or you did not get any colonies at all, it may be caused by: 1. Inappropriate ratio of insert-to-vector Not enough or too much insert could inhibit the ligation reaction. Try a different ratio of insert-to-vector to optimize the ligation reaction. Sometimes, the yield of the ligation reaction may also be improved by increasing both the insert and vector amounts. 2. Low ligation efficiency a. Inactive ligase and /or Test your ligase and reaction ligase reaction buffer buffer for activity using different vector and insert. Replace the reagents if they are proven inactive. b. Ligation inhibitors EDTA and high salt may inhibit the are present ligation reaction. 3. Low transformation efficiency a. Low quality or poor Handle the competent cells gently. handling of competent Many cells do not allow re-freezing cells after thawed. Quality of competent cells may be tested by transforming a circular plasmid to determine cell competency. Use competent cells with a transformation efficiency of at least 1x10 9 colonies/g of puc19 plasmid. b. Wrong antibiotic or too The plates used for cloning should much antibiotic in the contain g/ml ampicillin in media the media. C. No correct cdna inserts If the colony number for the cdna sample is more than for the negative control sample (i.e. vector only), but you failed to amplify cdna insert, it could be that: 1. Inactive Taq polymerase Test the activity of the PCR master mix by amplifying cdna from the original template. Replace the PCR reagents if they are proven inactive. 2. Wrong primer was used Make sure you are using the correct primers for the specific orientation of cdna insert. 3. Not enough clones were screened Pick more colonies for screening. Page 14 ver
16 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series IV. References C.A. Machida (Edit). Viral vectors for gene therapy. Methods and Protocols. (2003), Humana Press. C.S. Swindle, H.G.Kim, and C.A.Klug. Mutation of CpGs in the murine stem cell virus retroviral vector long terminal repeat represses silencing in embryonic stem cells. J.Biol.Chem., (2004) 279: E.D. Papadakis, S.A. Nicklin, A.H. Baker and S.J. White. Promoters and control elements: designing expression cassettes for gene therapy. Current Gene Therapy, (2004) 4: J.K.Choi, N. Hoang, A.M. Vilardi, P.Conrad, S.G.Emerson, and A.M. Gewirtz. Hybrid HIV/MSCV LTR Enhances transgene expression of lentiviral vectors in human CD34+ hematopoietic cells. Stem Cells, (2001) 19: K.Tokushige, D. Moradpour, T. Wakita, M. Geissler, N. Hayash, and J.R. Wands. Comparison between cytomegalovirus promoter and elongation factor-1 alpha promoter-driven constructs in the establishment of cells expression hepatitis C virus core protein. J. Virol Methods. (1997) 64: M. Federico (Edit). Methods in Molecular Biology. Volume 229. Lentivirus gene engineering protocols. (2003), Humana Press. M.J. Osborn, A.P. Mortari, R.T. McElmurry, S.K. Bell et al. A picornaviral 2A-like sequence-based tricistronic vector allowing for high-level therapeutic gene expression coupled to a dual-reporter system. Molecular Therapy. (2005) 12: M.L. Donnelly et al. Analysis of the aphthovirus 2A/2B polyprotein cleavage mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal skip. J. Gen. Virol. (2001) 82: P. de Felip, Skipping the co-expression problem: the new 2A CHYSEL technology. Genetic Vaccines and Therapy. (2004) 2:13 P.de Felip, G.A. Luke, L.E. Hughes, D.Gani, C. Halpin and M.D.Ryan. E unum pluribus: multiple proteins from a self-processing polyprotein. TRENDS in Biotechnology, (2006) 24:68-75 R.F. Doll, J.E.Crandall, C.A.Dyer, J.M.Aucioin, and F.I.Smith. Comparison of promoter strengths on gene delivery into mammalian brain cells using AAV vectors. Gene Therapy, (1996) 3: W. C. Heiser (Edit). Methods in Molecular Biology. Volume 246. Gene delivery to mammalian cells (2004), Humana Press. X.Yu, X. Zhan, J.D Costa, V.M. Tanavde, Z.Ye, T. Peng, M.T. Malehorn, X. Yang, C.I. Civin, and L.Cheng. lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells. Molecular Therapy, (2003) 7: V. Appendix A. Maps and Features for pcdh Vectors 1. pcdh-cmv-mcs (CD500B-1) Features RSV: LTR: Gag: RRE: Env: cppt: CMV: WPRE: LTR: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 2,983 bp 2. pcdh-cmv-mcsr (CD501A-1) (Toll Free) (outside US) Page 15 Features RSV: LTR: Gag: RRE: Env: cppt: CMV: WPRE: LTR: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 2,987 bp
17 System Biosciences (SBI) User Manual 3. pcdh-ef1-mcs (CD502A-1) 4. pcdh-cmv-mcs-ef1-puro (CD510B-1) Features RSV: LTR: Gag: RRE: Env: cppt: EF1: WPRE: LTR: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 3,184 bp Features RSV: LTR: Gag: RRE: Env: cppt: CMV: EF1: PuroR: WPRE: LTR: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 4,132 bp 5. pcdh-cmv-mcs-ef1-copgfp (CD511B-1) Features RSV: LTR: Gag: RRE: Env: cppt: CMV: EF1: copgfp: WPRE: LTR: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 4,300 bp 6. pcdh-ef1-mcs-t2a-puro (CD520A-1) Page 16 ver Features RSV: LTR: Gag: RRE: Env: cppt: EF1: T2A peptide: PuroR: WPRE: LTR:
18 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series 7. pcdh-ef1-mcs-t2a-copgfp (CD521A-1) Features RSV: LTR: Gag: RRE: Env: cppt: EF1: T2A peptide: copgfp: WPRE: LTR: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 4,016 bp 8. pcdh-mcs-t2a-puro-mscv (CD522A-1) Features RSV: LTR: Gag: RRE: Env: cppt: T2A peptide: PuroR: WPRE: LTR: MSCV: SV40 polya: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 3,961 bp 9. pcdh-mcs-t2a-copgfp-mscv (CD523A-1) Features RSV: LTR: Gag: RRE: Env: cppt: T2A peptide: copgfp: WPRE: LTR: MSCV: SV40polyA: SV40 ORI: puc ORI: (c) AmpR: (c) 5 LTR-to-3 LTR: 3,892 bp (Toll Free) (outside US) Page 17
19 System Biosciences (SBI) User Manual B. Descriptions of Features in pcdh Vectors Feature 3' LTR ( U3) Amp R CMV promoter copgfp cppt EF1 promoter env gag MSCV puc ORI Puro R RRE RSV / 5'LTR SV40 ORI SV40 Poly-A T2A Peptide Function Required for viral reverse transcription; selfinactivating 3' LTR with deletion in U3 region prevents formation of replication-competent viral particles after integration into genomic DNA Ampicillin resistant gene for selection of the plasmid in E. coli Constitutive Human cytomegalovirus (CMV) promoter for transcription of reporter and/or cloned cdna insert Copepod green fluorescent protein (similar to regular EGFP, but with brighter color) as a reporter for the transfected/transduced cells Central polypurine tract (includes DNA Flap region) involved in nuclear translocation and integration of transduced viral genome Constitutive Elongation factor 1α promoter for transcription of reporter and/or cloned cdna insert Packaging signal Packaging signal Constitutive LTR enhancer/promoter of murine stem cell virus (MSCV) for transcription of reporter and/or cloned cdna insert Allows for high-copy replication in E. coli Puromycin-resistant marker for selection of the transfected/transduced cells Rev response element binds gag and involved in packaging of viral transcripts Hybrid RSV promoter-r/u5 long terminal repeat; required for viral packaging and transcription Allows for episomal replication of plasmid in eukaryotic cells Transcription termination and polyadenylation The self-cleaving 2A peptide mediates protein cleavage from a single open reading frame to generate multiple proteins from a single promoter Woodchuck hepatitis virus posttranscriptional WPRE regulatory element enhances the stability of the viral transcripts C. Properties of the copgfp Fluorescent Protein The pcdh copgfp Vectors contain the full-length copgfp gene with optimized human codons for high level of expression of the fluorescent protein from the CMV, EF1, or MSCV promoter in mammalian cells. The copgfp marker is a novel natural green monomeric GFP-like protein from copepod (Pontellina sp.). The copgfp protein is a non-toxic, non-aggregating protein with fast protein maturation, high stability at a wide range of ph (ph 4-12), and does not require any additional cofactors or substrates. The copgfp protein has very bright fluorescence that exceeds at least 1.3 times the brightness of EGFP, the widely used Aequorea victoria GFP mutant. The copgfp protein emits green fluorescence with the following characteristics: emission wavelength max 502 nm; excitation wavelength max 482 nm; quantum yield 0.6; extinction coefficient 70,000 M -1 cm -1 Due to its exceptional properties, copgfp is an excellent fluorescent marker which can be used instead of EGFP for monitoring delivery of lentivector constructs into cells. Page 18 ver
20 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series D. Related Products ppackh1 Lentivector Packaging Kit (Cat. # LV500A-1) Unique lentiviral vectors that produce all the necessary HIV viral proteins and the VSV-G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles. 293TN cells (SBI, Cat. # LV900A-1) transiently transfected with the ppackh1 and a pcdh cdna expression construct produce packaged viral particles containing a pcdh cdna construct. FIV-Based pcdf cdna Cloning and Expression Vectors pcdf1-mcs1 (Cat. # CD100A-1) pcdf1-mcs2-ef1-puro (Cat. # CD110B-1) pcdf1-mcs2-ef1-copgfp (Cat. # CD111B-1) RNAi Cloning and Expression Lentivectors These FIV and HIV-based single- and double-promoter shrna and sirna cloning vectors allow you to clone sirna templates and efficiently transduce these sirna constructs in a wide range of cells. For a list of currently available vectors, please visit our website at (Toll Free) (outside US) Page 19
21 System Biosciences (SBI) User Manual MicroRNA Precursor Construct Collection FIV-based microrna Precursor Constructs allow you to express pre-mirna, consisting of the stem loop structure and upstream and downstream flanking genomic sequence. For a list of currently available vectors, please visit our website at PathNet Transcriptional Reporter Lentivectors FIV and HIV-based transcriptional reporter vectors, allow detection of the activation of transcriptional factors (TFs) in a natural environment (nuclei). For a list of currently available vectors, please visit our website at E. Technical Support For more information about SBI products and to download manuals in PDF format, please visit our web site: For additional information or technical assistance, please call or us at: System Biosciences (SBI) 265 North Whisman Rd.. Mountain View, CA Phone: (650) (888) (Toll Free) Fax: (650) General Information: [email protected] Technical Support: [email protected] Ordering Information: [email protected] Page 20 ver
22 pcdh cdna Cloning Lentivectors Cat. # CD500 CD700 series VI. Licensing and Warranty Statement Limited Use License Use of the pcdh cdna Cloning and Expression Vector (i.e., the Product ) is subject to the following terms and conditions. If the terms and conditions are not acceptable, return all components of the Product to System Biosciences (SBI) within 7 calendar days. Purchase and use of any part of the Product constitutes acceptance of the above terms. The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions: The Product shall be used by the purchaser for internal research purposes only. The Product is expressly not designed, intended, or warranted for use in humans or for therapeutic or diagnostic use. The Product may not be resold, modified for resale, or used to manufacture commercial products without prior written consent of SBI. This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research. HIV Vector System This Product or the use of this Product is covered by U.S. Patents Nos. 5,665,577 and 5,981,276 (and foreign equivalents) owned by the Dana-Farber Cancer Institute, Inc., and licensed by SBI. This product is for non-clinical research use only. Use of this Product to produce products for resale or for any diagnostic, therapeutic, clinical, veterinary, or food purpose is prohibited. In order to obtain a license to use this Product for these commercial purposes, contact the Office of Research and Technology Ventures at the Dana-Farber Cancer Institute, Inc. in Boston, Massachusetts, USA. WPRE Technology System Biosciences (SBI) has a license to sell the Product containing WPRE, under the terms described below. Any use of the WPRE outside of SBI s Product or the Products intended use, requires a license as detailed below. Before using the Product containing WPRE, please read the following license agreement. If you do not agree to be bound by its terms, contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit. The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies. SBI grants you a non-exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use. The Product containing WPRE is being transferred to you in furtherance of, and reliance on, such license. Any use of WPRE outside of SBI s Product or the Product s intended use, requires a license from the Salk Institute for Biological Studies. This license agreement is effective until terminated. You may terminate it at any time by destroying all Products containing WPRE in your control. It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement. You shall, upon termination of the license agreement, destroy all Products containing WPRE in you control, and so notify SBI in writing. This License shall be governed in its interpretation and enforcement by the laws of California. Contact for WPRE Licensing: The Salk Institute for Biological Studies, North Torrey Pines Road, La Jolla, CA 92037; Attn: Office for Technology Management; Phone: (858) extension 1275; Fax: (858) CMV Promoter The CMV promoter is covered under U.S. Patents 5,168,062 and 5,385,839 and its use is permitted for research purposes only. Any other use of the CMV promoter requires a license from the University of Iowa Research Foundation, 214 Technology Innovation Center, Iowa City, IA CopGFP Reporter This product contains a proprietary nucleic acid coding for a proprietary fluorescent protein(s) intended to be used for research purposes only. Any use of the proprietary nucleic acids other than for research use is strictly prohibited. USE IN ANY OTHER APPLICATION REQUIRES A LICENSE FROM EVROGEN. To obtain such a license, please contact Evrogen at [email protected]. SBI has pending patent applications on various features and components of the Product. For information concerning licenses for commercial use, contact SBI. Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement. Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned. SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein. Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate. If it is proven to the satisfaction of SBI that the Product fails to meet these specifications, SBI will replace the Product or provide the purchaser with a refund. This limited warranty shall not extend to anyone other than the original purchaser of the Product. Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product. SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price. SBI s liability does not extend to any damages arising from use or improper use of the Product, or losses associated with the use of additional materials or reagents. This limited warranty is the sole and exclusive warranty. SBI does not provide any other warranties of any kind, expressed or implied, including the merchantability or fitness of the Product for a particular purpose. SBI is committed to providing our customers with high-quality products. If you should have any questions or concerns about any SBI products, please contact us at (888) System Biosciences (SBI) (Toll Free) (outside US) Page 21
AAVanced AAV Cloning and Expression Vectors
AAVanced AAV Cloning Catalog # AAV5XXA-1 A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing and Warranty Statement contained
Lentivector-based MicroRNA Precursor Constructs
Lentivector-based MicroRNA Precursor Constructs Cat. # PMIRHxxxPA-1 User Manual Grow bacterial stock on receipt Make plasmid DNA for experiments (ver. 2008-02-28-001) A limited-use label license covers
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Product: Expression Arrest TM egfp control shrna vector
Product: Expression Arrest TM egfp control vector Catalog #: RHS1702 Product Description The laboratory of Dr. Greg Hannon at Cold Spring Harbor Laboratory (CSHL) has created an RNAi Clone Library comprised
10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)
TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
PiggyBac Transposon Vector System
PiggyBac Transposon Vector System Cat. # PBxxx-1 User Manual Store kit at -20 C on receipt A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
STOP. Before using this product, please read the Limited Use License statement below:
STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-rgfap The purchase of the pdrive5lucia-rgfap vector conveys
GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
ptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
TECHNICAL BULLETIN. MISSION! shrna Bacterial Glycerol Stock. Catalog Number SHCLNG Storage Temperature 70 C
MISSION! shrna Bacterial Glycerol Stock Catalog Number SHCLNG Storage Temperature 70 C TECHNICAL BULLETIN Product Description Small interfering RNAs (sirnas) processed from short hairpin RNAs (shrnas)
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
One Shot TOP10 Competent Cells
USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells
page 1 of 8 sirna Test Kit for Cell Lines and Adherent Primary Cells Kit principle Co-transfection of pmaxgfp, encoding the green fluorescent protein (GFP) from Pontellina p. with an sirna directed against
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
NIH Mammalian Gene Collection (MGC)
USER GUIDE NIH Mammalian Gene Collection (MGC) Catalog number FL1002 Revision date 28 November 2011 Publication Part number 25-0610 MAN0000351 For Research Use Only. Not for diagnostic procedures. ii Table
Mouse ES Cell Nucleofector Kit
page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305 The MGC premier Expression-Ready collection has the high quality,
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
MEF Nucleofector Kit 1 and 2
page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Transformation of the bacterium E. coli. using a gene for Green Fluorescent Protein
Transformation of the bacterium E. coli using a gene for Green Fluorescent Protein Background In molecular biology, transformation refers to a form of genetic exchange in which the genetic material carried
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Taqman TCID50 for AAV Vector Infectious Titer Determination
Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
RNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP)
GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP) LAB BAC3 Adapted from "Biotechnology Explorer pglo Bacterial Transformation Kit Instruction Manual". (Catalog No. 166-0003-EDU)
HBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
COMMITTEE FOR MEDICINAL PRODUCTS FOR HUMAN USE (CHMP) GUIDELINE ON DEVELOPMENT AND MANUFACTURE OF LENTIVIRAL VECTORS
European Medicines Agency Evaluation of Medicines for Human Use London, 26 May 2005 CHMP/BWP/2458/03 COMMITTEE FOR MEDICINAL PRODUCTS FOR HUMAN USE (CHMP) GUIDELINE ON DEVELOPMENT AND MANUFACTURE OF LENTIVIRAL
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Before opening this package, please read the Limited Use License statement below:
STOP Before opening this package, please read the Limited Use License statement below: Important Limited Use License information for pcpgfree-ova The purchase of the pcpgfree-ova vector conveys to the
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
RAPAd mirna Adenoviral Expression System Catalog #: VPK-253
DATENBLATT RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18 24 nucleotide RNA molecules that
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
