Holger Willenbring, Amar Deep Sharma, Arndt Vogel, Andrew Y. Lee, Andreas Rothfuss, Zhongya Wang, Milton Finegold, and Markus Grompe
|
|
|
- Lora Norman
- 7 years ago
- Views:
Transcription
1 Cancer Cell, Volume 14 Supplemental Data Article Loss of p21 Permits Carcinogenesis from Chronically Damaged Liver and Kidney Epithelial Cells despite Unchecked Apoptosis Holger Willenbring, Amar Deep Sharma, Arndt Vogel, Andrew Y. Lee, Andreas Rothfuss, Zhongya Wang, Milton Finegold, and Markus Grompe Supplemental Experimental Procedures Cell-Cycle Analysis Single cell-hepatocyte suspensions were stained with 10 µg/ml propidium iodide (Sigma) and analyzed for DNA content by flow cytometry using a FACSCalibur (Becton Dickinson Biosciences Immunocytometry Systems) system. Since mouse hepatocytes initiate physiological polyploidization at 4 weeks of age, which would hamper reliable detection of cells arrested in G2 phase of the cell cycle, mice of younger age were used for these analyses. Quantitative Reverse Transcription-PCR (qrt-pcr) Total RNA was isolated using trizol (Molecular Research Center). RNA was treated with DNase1 (Applied Biosystems) to eliminate contaminating DNA. 1 µg of RNA was used for first strand cdna synthesis with Taqman reverse transcription reagent (Applied Biosystems). All reactions were performed with a 7300 real time PCR system using SYBR green (Applied Biosystems). PCR amplification was carried out at 50 C for 2 min and 95 C for 10 min, followed by 40 cycles at 95 C for 15 s and 60 C for 1 min. For each sample, β-actin was used to normalize the expression level of the target gene. Oligonucleotide sequences were generated with Primer Express software (Applied Biosystems) (Table S1). Table S1. Primers for qrt-pcr Target Gene 5-3 Primer Sequence (Forward/Reverse) p15 TCAGAGACCAGGCTGTAGCAATC/CCCCGGTCTGTGGCAGAA p16 GGGTACGACCGAAAGAGTTCG/CATCTGGAGCAGCATGGAGTC p19 AGTACAGCAGCGGGAGCATGG/GGTCCAGGATTCCGGTGC Afp AACTCTGGCGATGGGTGTTTA/ACACTGATGTCTTTCCACTCCA c-myc TGCATTGACCCCTCAGTGGT/TCCGAGGAAGGAGAGAAGGC Gadd45a CGTAGACCCCGATAACGTGG/CCGCAGGATGTTGATGTCG Rtp801 CAAGGCAAGAGCTGCCATAG/CCGGTACTTAGCGTCAGGG β-actin GACGGCCAGGTCATCACTATTG/AGGAAGGCTGGAAAAGAGCC
2 Figure S1. Effects of Fah Deficiency on Hepatocyte Gene Expression and Cell-Cycle Distribution in Vivo (A) Induced expression of regulators of proliferation and apoptosis in Fah -/- and Fah -/-,p21 -/- mice off NTBC. Three mice were analyzed for global gene expression in each group. The average (AVG), standard deviation (STDDEV) and significance (SIGN) of changes in gene expression are shown. SIGN was determined using the two-tailed Student s t test. (B) p21 inhibits hepatocyte cell-cycle progression at both the G1/S and G2/M boundaries. Flow cytometry for DNA content shows that p21 arrests hepatocytes of Fah -/- mice off NTBC in the G1 (70% versus 83% in mice treated with NTBC) as well as G2 (26% versus 13% in mice treated with NTBC) phase of the cell cycle.
3 Figure S2. Quantification of Ki67-Expressing Hepatocytes in Wild-Type, Fah -/-, and Fah -/-,p21 -/- Mice off NTBC Ki67 protein can be detected during S, G2 and M phase of the cell cycle and thus highlights all proliferating cells.
4 Figure S3. H&E Stainings Corresponding to TUNEL and BrdU Labelings in Figure 3 (A) Spontaneous hepatocyte apoptosis occurs in Fah -/-,p21 -/- mice off NTBC but not in wild-type or Fah -/- mice off NTBC. (B and C) Jo2 injection causes massive hepatocyte apoptosis and hemorrhaging in wild-type and Fah -/-,p21 -/- mice off NTBC but not in Fah -/- mice off NTBC. Scale bars = 100 µm.
5 Figure S4.
6 Figure S4. Molecular Characteristics and Injury Dependence of HCCs Emerging in Fah -/-,p21 -/- Mice (A and B) Molecular analysis of HCCs arising in Fah -/-,p21 -/- mice off NTBC. (A) Continued expression of Mdm2 protein in HCCs of Fah -/-,p21 -/- indicates functional p53. α- actin serves as loading control. (B) Comparison to wild-type livers and non-malignant liver tissue of Fah -/-,p21 -/- mice off NTBC shows that expression of the tumor suppressors p15, p16 and p19 is induced in HCCs emerging in Fah -/-,p21 -/- mice. The oncogenes Afp and c-myc are highly expressed in both Fah -/-,p21 -/- livers off NTBC and HCCs. p53 continues to induce its target genes Gadd45a and Rtp801 in HCCs of Fah -/-,p21 -/- mice. Gene expression levels were determined by qrt-pcr. Wild-type liver gene expression was set to 1. Error bars represent mean ± SD. (C) Hepatocarcinogenesis in Fah -/- and Fah -/-,p21 -/- mice on low-dose and off NTBC. Ten mice were analyzed for each genotype and treatment regimen. HCCs were classified as WHO grade 2-3 independent of genotype or NTBC dose.
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
HP8 herbal formula selectively inhibits prostate cancer cell line proliferation by inducing G2/M cell cycle arrest.
HP8 herbal formula selectively inhibits prostate cancer cell line proliferation by inducing G2/M cell cycle arrest. Flowers A, Banbury L, Leach D and Waterman P. Centre for Phytochemistry and Pharmacology,
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
PrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Using TaqMan Endogenous Control Assays to select an endogenous control for experimental studies
APPLICATION NOTE TaqMan Gene Expression Assays Using TaqMan Endogenous Control Assays to select an endogenous control for experimental studies Introduction Quantitative real-time PCR (qpcr) allows for
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
bitter is de pil Linos Vandekerckhove, MD, PhD
4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Uses of Flow Cytometry
Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
User Bulletin #2 ABI PRISM 7700 Sequence Detection System
User Bulletin #2 ABI PRISM 7700 Sequence Detection System December 11, 1997 (updated 10/2001) SUBJECT: Relative Quantitation of Gene Expression Introduction Amplification of an endogenous control may be
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Cell, Tissue and Tumor Kinetics
Cell, issue and umor Kinetics Proliferation Kinetics: rate of growth of a population, change in total cell number. Adult tissues are in homeostasis. Children (and tumors) grow. I. Quantitative Assessment
Notch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
Lesson 3 Reading Material: Oncogenes and Tumor Suppressor Genes
Lesson 3 Reading Material: Oncogenes and Tumor Suppressor Genes Becoming a cancer cell isn t easy One of the fundamental molecular characteristics of cancer is that it does not develop all at once, but
Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:
Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy
CASE STUDY High Content Image Analysis Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy Dr. Nataša Anastasov leads the Personalized Radiation Therapy Group within the
Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling
Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer
Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine
Supplemental Information. McBrayer et al. Supplemental Data
1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were
REAL TIME PCR SYBR GREEN
REAL TIME PCR SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM QUANTITATION
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
Improving qpcr Reliability: Automated RNA Normalization and Plate Setup on PIPETMAX
Improving qpcr Reliability: Automated RNA Normalization and Plate Setup on PIPETMAX Application Note TRANS915 Normalization of RNA concentrations before reverse transcription reduces error in qpcr experiments
Department of BioScience Technology Chung Yuan Christian University 2015/08/13
Department of BioScience Technology Chung Yuan Christian University 2015/08/13 Cancer Cells Cancer, the 1st leading cause of death, is an example of a disease that arises from abnormalities in cell function
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Reconstituting and Diluting Primers and TaqMan Probes
Reconstituting and Diluting Primers and TaqMan Probes Introduction TaqMan primers are commonly shipped in a lyophilized state. TaqMan probes are sometimes shipped in the lyophilized state, but more often
DyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
Oligonucleotide Stability Study
Oligonucleotide Stability Study IDT is performing a long term study of oligo stability. The study has been ongoing for 2 years and has tested oligo stability under various conditions. An overview of the
The AB7900Fast and Principles of Real Time PCR
The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications
Profiling of microrna in Blood Serum/Plasma. Guidelines for the mircury LNA TM Universal RT microrna PCR System
Profiling of microrna in Blood Serum/Plasma Guidelines for the mircury LNA TM Universal RT microrna PCR System Table of Contents 2 Introduction.....................................................................................
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Quantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
Investigating the role of a Cryptosporidium parum apyrase in infection
Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase
Quando si parla di PCR quantitativa si intende:
Quando si parla di PCR quantitativa si intende: A. Una PCR che produce grandi quantità di DNA B. Una PCR che emette quanti di luce C. Una PCR che quantifica il numero di molecole stampo presenti all inizio
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed
Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Beginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments
DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,
PART 3.3: MicroRNA and Cancer
BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway
Supplemental Material. Methods
Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
Gene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program
WHITE PAPER TaqMan Assays QPCR Guarantee Program Gene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program Real-Time PCR for the Quantification of Gene Expression Real-time
Application Note. Single Cell PCR Preparation
Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Getting Started Guide
Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering
Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi
Cancer SBL101 James Gomes School of Biological Sciences Indian Institute of Technology Delhi All Figures in this Lecture are taken from 1. Molecular biology of the cell / Bruce Alberts et al., 5th ed.
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical
QPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
Absolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems
Technical Manual Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems INSTRUCTIONS FOR USE OF PRODUCTS A4011, A4021, A4031, A4041, A4051 AND
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
Cell Cycle Phase Determination Kit
Cell Cycle Phase Determination Kit Item No. 10009349 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Safety
How To Test For Human Papn
Supplemental Materials Patients Patients gave informed consent and samples were collected from Southend University Hospital approved by the East London & The City Local Research Ethics Committee (Rec Ref.
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
Microarray Technology
Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System
5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex
sirna Duplexes & RNAi Explorer
P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01
Parameter inference of a basic p53 model using ABC
Parameter inference of a basic p53 model using ABC Eszter Lakatos and Michael Barclay Group meeting 29 th October 2014 p53 - ABC II. Eszter 1 / 10 Background Study p53 reaction to cellular stress on single
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards
How To Get A Cell Print
QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH
Appendix C DNA Replication & Mitosis
K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing: