Detrending Moving Average Algorithm: from finance to genom. materials
|
|
- Milo Long
- 8 years ago
- Views:
Transcription
1 Detrending Moving Average Algorithm: from finance to genomics and disordered materials Anna Carbone Physics Department Politecnico di Torino September 27, 2009
2 Publications 1. Second-order moving average and scaling of long-range correlated series E. Alessio, A. Carbone, G. Castelli, and V. Frappietro, Eur. Phys. Jour. B 27, 197 (2002). 2. Scaling of long-range correlated noisy signals: application to financial markets A. Carbone and G. Castelli, Proc. of SPIE, 407, 5114 (2003). 3. Analysis of the clusters formed by the moving average of a long-range correlated stochastic series A. Carbone, G. Castelli and H. E. Stanley, Phys. Rev. E 69, (2004). 4. Time-Dependent Hurst Exponent in Financial Time Series A. Carbone, G. Castelli and H. E. Stanley, Physica A 344, 267 (2004). 5. Directed self-organized critical patterns emerging from fractional Brownian paths A. Carbone and H. E. Stanley, Physica A 340, 544 (2004). 6. Spatio-temporal complexity in the clusters generated by fractional Brownian paths A. Carbone and H.E. Stanley, Proc. of SPIE 5471, 1 (2004). 7. Quantifying signals with power-law correlations L. Xu, P. Ch. Ivanov, C. Zhi, K. Hu, A. Carbone, H. E. Stanley, Phys. Rev. E 71, (2005). 8. Scaling properties and entropy of long range correlated series A. Carbone and H.E. Stanley, Physica A 384, 21 (2007). 9. Tails and Ties A. Carbone, G. Kaniadakis, and A.M. Scarfone, Eur. Phys. J. B 57, (2007). 10. Where do we stand on econophysics? A. Carbone, G. Kaniadakis and A.M. Scarfone, Physica A 382, xi-xiv (2007). 11. Detrending Moving Average (DMA) Algorithm: a closed form approximation of the scaling law S. Arianos and A. Carbone, Physica A 382, 9 (2007). 12. Algorithm to estimate the Hurst exponent of high-dimensional fractals A. Carbone, Phys. Rev. E 76, (2007). 13. Cross-correlation of long-range correlated series S. Arianos and A. Carbone, J. Stat. Mech: Theory and Experiment P03037, (2009).
3 The Efficient Market Hypothesis...and Its Critics A Random Walk Down Wall Street First edition published in the 70 s by Burton Malkiel on the wave of the academic success of the influential survey on the Efficient Market Hypothesis (EMH) by Eugene Fama (1970). A Non-Random Walk Down Wall Street First edition published in 1999 by Andrew Lo and Craig MacKinley
4 A Moving Average Walk... Down Wall Street
5 Surveys on the use of Technical Analysis by Finance Professionals Horizons min % max% intraday 50% 100% 1 week 50% 80% 1 month 40% 70% 3 months 30% 50% 6 months 20% 30% 1 year 2% 25% 1 Charts, Noise and Fundamentals in the London Foreign Exchange Market. H.L. Allen and M.P. Taylor, The Economic Journal, 100, (1990) 2 Technical trading rule profitability and foreign exchange intervention, B. LeBaron, Journal of International Economics 49, 125 (1999) 3 The Obstinate Passion of foreign Exchange Professional: Technical Analysis. Lukas Menkhoff and Mark P. Taylor, Journal of Economic Literature 45, 4 (2007)
6 Fractional Brownian or Levy Walk H > 0.5 positive correlation (persistence) H = 0.5 Random walk H < 0.5 negative correlation (anti-persistence)
7 Detrending Moving Average Algorithm (DMA) 20 ~ y n (i) σ 2 DMA = 1 N N i=n [ ] 2 y(i) ỹ n (i) \L y(i) FOXVWHU ỹ n (i) = 1 n n y(i k) k=0 σ 2 DMA n2h i c (j) L i c (j+1) τ j =i c (j+1)-i c (j) 2680
8 Detrending Moving Average Algorithm (DMA) σ 2 DMA n2h The log-log plot is a straight-line whose slope can be used to calculate the Hurst exponent H of the time series.
9 Detrending Moving Average Algorithm (DMA) Self-similarity of a time series x(t) σdma 2 is generalized variance for nonstationary signals. It can be derived from the auto-correlation function C xx (t, τ), which measures the self-similarity of a signal: σ xx (t, τ) [x(t) x(t)][x (t + τ) x (t + τ)] By taking τ = 0 and x = x(t), x n (i) = 1 n n k=0 x(i k) the autocovariance C xx (t, τ) reduces to the function σdma S. Arianos and A. Carbone Physica A 382, 9 (2007)
10 DAX (Deutscher AktienindeX) Prices (a) P(t) Log Returns (b) r(t) = lnp(t + t ) lnp(t) Volatility σ T (t) 2 = 1 T T 1 t=1 [r(t) r(t) T ] 2 (c) with T = 300min (one half trading day) (d) with T = 660min (one trading day)
11 FIB30 futures: PRICES The FIB30 is a future contract on the MIB30 index, which considers the thirty firms with higher capitalization and trading (the top 30 blue-chip index) of the MIBTEL ( (Since 2004 it is named S&P MIB index).
12 FIB30 futures: VOLATILITIES T=660min (1 trading day) T=6600min (10 trading days) σ DMA Fract. Brown. Motion H= n
13 Cross-Similarity of two stochastic series x(t) and y(t) In many cases, the coupling between two systems (time series) might be of interest. A measure of cross-correlation can be implemented 5 by defining: σ xy (t, τ) [x(t) x(t)][y (t + τ) ỹ (t + τ)] Now it must be τ 0. Moreover x = x(t) and y = y(t) x n (i) = 1 n n k=0 x(i k) and ỹ n(i) = 1 n n k=0 y(i k). 5 S. Arianos and A.Carbone, J. Stat. Mech.: Theory and Experiment P03037, (2009).
14 Cross-Similarity of return and volatility σ 2 DMA nh 1+H 2 The log-log plot is a straight-line. The slope is given by the sum of the Hurst exponents H 1 and H 2 of the two time series. 6 6 S. Arianos and A.Carbone, J. Stat. Mech: Theory and Experiment P03037, (2009).
15 Leverage effect: DAX DMA Cross-correlation as a function of the lag τ for the return and volatility of the DAX series. 7 7 S. Arianos and A.Carbone, J. Stat. Mech: Theory and Experiment P03037, (2009).
16 Scaling law of the moving average clusters 8 9 n=200 n=600 y(t) y(t) n=1000 area n=2000 t duration t Anna Carbone 8 A.Carbone, Physics Department G.Castelli Politecnico anddih.e. TorinoStanley, Detrending Phys. Moving Rev. Average E, 69, Algorithm: from (2004) finance to genom
17 Scaling law of the cluster lengths l 10 5 (a) (a) l 10 2 ψ l H τ H l τ ψ l ψ l = 1
18 Scaling law of the cluster areas s (b) 1.9 (b) s ψ s H H τ H s τ ψs ψ s = 1 + H
19 Scaling law of the pdf of the cluster length and duration H= β=2-h ) P(τ) 10-3 β x x10-5 (a) τ (a) H P(τ, n) τ β F (τ, n) with β = 2 H the fractal dimension of the time series and F (τ, n) defined as: F(τ, n) = e τ/τ.
20 Scaling law of the pdf of the cluster area γ=2/(1+h) P(s) (b) H=0.80 H=0.20 H= s γγγ (b) H with γ = 2/(1 + H) and: P(s, n) s γ F (s, n) F(s, n) = e s/s.
21 Self-organized criticality of the moving average clusters t addition of particles/energy y j t y addition of particles/energy Brownian path fractional Brownian path j+1 Brownian path cluster lifetime j+2 smoothed fractional Brownian path cluster diameter l dissipation of particles/energies dissipation of particles/energy Moving Average Clusters SOC Clusters l τ ψ l ψ l = 1 ψ l = 1 s τ ψ s ψ s = 1 + H ψ s = 3/2 P(l, n) l α α = 2 H α = 3/2 P(τ, n) τ β β = 2 H β = 3/2 P(s, n) s γ γ = 2/(1 + H) γ = 4/3
22 Entropy of long-range correlated time series 10 1 l n n=500 A n=1000 n=2000 n=3000 S(l,n) A' A'' D log l n= l S(l, n) µ(l,n) P(l, n) log P(l, n). S(l, n) = S 0 + D log l + l n. 10 A. Carbone and H.E. Stanley Physica A 385, 21 (2007)
23 Genome Heterogeneity G A T C C T T G A A G C G C C C C C A A G G G C A T C T T C T 1. The sequence of the nucleotide bases ATGC is mapped to a numeric sequence. 2. If the base is a purine (A,G) is mapped to +1, otherwise if the base is a pyrimidine (C,T) is mapped to The sequence of +1 and 1 steps is summed and a random walk y(x) is obtained.
24 Genome Heterogeneity % A, C, G, T % A, C, G, T % A, C, G, T 50 CHR1 40 n=2 A 30 T 20 C 10 G CHR1 n=4 40 A 30 T 20 C 10 G CHR1 40 n=10 A 30 T 20 C 10 G length (bp)
25 Genome Heterogeneity % A, C, G, T % A, C, G, T % A, C, G, T 50 CHR14 A 40 n=2 T C 0 G CHR14 n=4 A T C 0 G CHR14 40 A n=10 T C G length (bp)
26 DMA for high-dimensional fractals (e.g. selfsimilar networks, rough surfaces) 11 Fractal surfaces 0.5 f(i 1,i 2 ) H= f(i 1,i 2 ) H= (b) i i (a) i i A. Carbone Phys. Rev. E 76, (2007)
27 DMA for high-dimensional fractals (e.g. selfsimilar networks, rough surfaces) 12 Moving Average Surface for the fractal surface with H = ~ f(i 1,i 2 ) n 1 x n 2 =15 x ~ f(i 1,i 2 ) n 1 x n 2 = 25 x (a) i i (b) i i A. Carbone Phys. Rev. E 76, (2007)
28 DMA for high-dimensional fractals (e.g. selfsimilar networks, rough surfaces) 13 DMA (c) N 1 x N 2 =4096 x s The plot of σ 2 DMA vs. S = (n n2 2 ) is a straight line. It corresponds to the scaling relation: i.e.: σ 2 DMA [ (n n2 2 ) ] 2H σ 2 DMA S2H 13 A. Carbone Phys. Rev. E 76, (2007)
29 THANK YOU!
How To Calculate A Non Random Walk Down Wall Street
Detrending Moving Average Algorithm: a Non-Random Walk down financial series, genomes, disordered materials... Anna Carbone Politecnico di Torino www.polito.it/noiselab September 13, 2013 The Efficient
More informationEvaluating the Efficient Market Hypothesis by means of isoquantile surfaces and the Hurst exponent
Evaluating the Efficient Market Hypothesis by means of isoquantile surfaces and the Hurst exponent 1 Introduction Kristýna Ivanková 1, Ladislav Krištoufek 2, Miloslav Vošvrda 3 Abstract. This article extends
More informationLOCAL SCALING PROPERTIES AND MARKET TURNING POINTS AT PRAGUE STOCK EXCHANGE
Vol. 41 (2010) ACTA PHYSICA POLONICA B No 6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 LOCAL SCALING PROPERTIES AND MARKET TURNING POINTS AT PRAGUE STOCK EXCHANGE Ladislav Kristoufek Institute
More informationHurst exponents, power laws, and efficiency in the Brazilian foreign exchange market
Hurst exponents, power laws, and efficiency in the Brazilian foreign exchange market Sergio Da Silva 1, Raul Matsushita 2, Iram Gleria 3, Annibal Figueiredo 4 1 Department of Economics, Federal University
More informationTrading activity as driven Poisson process: comparison with empirical data
Trading activity as driven Poisson process: comparison with empirical data V. Gontis, B. Kaulakys, J. Ruseckas Institute of Theoretical Physics and Astronomy of Vilnius University, A. Goštauto 2, LT-008
More informationMARKETS, INFORMATION AND THEIR FRACTAL ANALYSIS. Mária Bohdalová and Michal Greguš Comenius University, Faculty of Management Slovak republic
MARKETS, INFORMATION AND THEIR FRACTAL ANALYSIS Mária Bohdalová and Michal Greguš Comenius University, Faculty of Management Slovak republic Abstract: We will summarize the impact of the conflict between
More informationAn empirical investigation of Australian Stock Exchange Data.
An empirical investigation of Australian Stock Exchange Data. William Bertram School of Mathematics and Statistics University of Sydney January 27, 2004 Abstract We present an empirical study of high frequency
More informationThere is a saying on Wall Street that it takes volume to move
Cross-correlations between volume change and price change Boris Podobnik a,b,c,1, Davor Horvatic d, Alexander M. Petersen a, and H. Eugene Stanley a,1 a Center for Polymer Studies and Department of Physics,
More informationStock price fluctuations and the mimetic behaviors of traders
Physica A 382 (2007) 172 178 www.elsevier.com/locate/physa Stock price fluctuations and the mimetic behaviors of traders Jun-ichi Maskawa Department of Management Information, Fukuyama Heisei University,
More informationarxiv:physics/0607202v2 [physics.comp-ph] 9 Nov 2006
Stock price fluctuations and the mimetic behaviors of traders Jun-ichi Maskawa Department of Management Information, Fukuyama Heisei University, Fukuyama, Hiroshima 720-0001, Japan (Dated: February 2,
More informationarxiv:cond-mat/0402591v2 [cond-mat.other] 4 Mar 2004
arxiv:cond-mat/0402591v2 [cond-mat.other] 4 Mar 2004 Inverse Statistics in the Foreign Exchange Market M.H.Jensen, a A.Johansen, b F.Petroni, c I.Simonsen d a Niels Bohr Institute, Blegdamsvej 17, DK-2100
More informationPhDr. Ladislav KRIŠTOUFEK, Ph.D.: Seznam publikací
PhDr. Ladislav KRIŠTOUFEK, Ph.D.: Seznam publikací A) Vědecké monografie B) Kapitoly v monografiích [1] KRIŠTOUFEK, L., 2010. Efficiency, persistence and predictability of Central European Stock Markets
More informationNONLINEAR TIME SERIES ANALYSIS
NONLINEAR TIME SERIES ANALYSIS HOLGER KANTZ AND THOMAS SCHREIBER Max Planck Institute for the Physics of Complex Sy stems, Dresden I CAMBRIDGE UNIVERSITY PRESS Preface to the first edition pug e xi Preface
More informationMeasurable inhomogeneities in stock trading volume flow
August 2008 EPL, 83 (2008) 30003 doi: 10.1209/0295-5075/83/30003 www.epljournal.org Measurable inhomogeneities in stock trading volume flow A. A. G. Cortines, R. Riera and C. Anteneodo (a) Departamento
More informationarxiv:nlin/0211010v2 [nlin.ao] 7 May 2003
Evolution and anti-evolution in a minimal stock market model arxiv:nlin/0211010v2 [nlin.ao] 7 May 2003 R. Rothenstein 1, K. Pawelzik Institut für Theoretische Physik, Universität Bremen, Otto-Hahn-Allee
More informationComputing the Fractal Dimension of Stock Market Indices
Computing the Fractal Dimension of Stock Market Indices Melina Kompella, COSMOS 2014 Chaos is an ancient idea that only recently was developed into a field of mathematics. Before the development of scientific
More informationScaling in an Agent Based Model of an artificial stock market. Zhenji Lu
Scaling in an Agent Based Model of an artificial stock market Zhenji Lu Erasmus Mundus (M) project report (ECTS) Department of Physics University of Gothenburg Scaling in an Agent Based Model of an artificial
More informationRealized Volatility and Absolute Return Volatility: A Comparison Indicating Market Risk
: A Comparison Indicating Market Risk Zeyu Zheng 1,2 *., Zhi Qiao 2,3 *., Tetsuya Takaishi 4, H. Eugene Stanley 5, Baowen Li 2,3 1 Shenyang Institute of Automation, Chinese Academy of Sciences, Shenyang,
More informationPITFALLS IN TIME SERIES ANALYSIS. Cliff Hurvich Stern School, NYU
PITFALLS IN TIME SERIES ANALYSIS Cliff Hurvich Stern School, NYU The t -Test If x 1,..., x n are independent and identically distributed with mean 0, and n is not too small, then t = x 0 s n has a standard
More informationA Statistical Model of the Sleep-Wake Dynamics of the Cardiac Rhythm
A Statistical Model of the Sleep-Wake Dynamics of the Cardiac Rhythm PE McSharry 1,2, GD Clifford 1 1 Department of Engineering Science, University of Oxford, Oxford, UK 2 Mathematical Institute, University
More informationFinancial Market Efficiency and Its Implications
Financial Market Efficiency: The Efficient Market Hypothesis (EMH) Financial Market Efficiency and Its Implications Financial markets are efficient if current asset prices fully reflect all currently available
More informationMODELING OF STOCK RETURNS AND TRADING VOLUME. Abstract
MODELING OF TOCK ETUN AND TADING OLUME TAIEI KAIZOJI 1 Graduate chool of Arts and ciences, International Christian University, 3-10-2 Osawa, Mitaka, Tokyo 181-8585, Japan Abstract In this study, we investigate
More informationSimple model of a limit order-driven market
Physica A 278 (2000) 571 578 www.elsevier.com/locate/physa Simple model of a limit order-driven market Sergei Maslov Department of Physics, Brookhaven National Laboratory, Upton, NY 11973, USA Received
More informationQuantitative Analysis of Foreign Exchange Rates
Quantitative Analysis of Foreign Exchange Rates Alexander Becker, Ching-Hao Wang Boston University, Department of Physics (Dated: today) In our class project we have explored foreign exchange data. We
More informationTutorial on Markov Chain Monte Carlo
Tutorial on Markov Chain Monte Carlo Kenneth M. Hanson Los Alamos National Laboratory Presented at the 29 th International Workshop on Bayesian Inference and Maximum Entropy Methods in Science and Technology,
More informationMeasuring Line Edge Roughness: Fluctuations in Uncertainty
Tutor6.doc: Version 5/6/08 T h e L i t h o g r a p h y E x p e r t (August 008) Measuring Line Edge Roughness: Fluctuations in Uncertainty Line edge roughness () is the deviation of a feature edge (as
More informationUnivariate and Multivariate Methods PEARSON. Addison Wesley
Time Series Analysis Univariate and Multivariate Methods SECOND EDITION William W. S. Wei Department of Statistics The Fox School of Business and Management Temple University PEARSON Addison Wesley Boston
More informationHow Lead-Lag Correlations Affect the Intraday Pattern of Collective Stock Dynamics
15-15 August 13, 215 How Lead-Lag Correlations Affect the Intraday Pattern of Collective Stock Dynamics Chester Curme Boston University chester.curme@googlemail.com Rosario N. Mantegna University of Palermo,
More informationForex Trading using MetaTrader 4 with the Fractal Market Hypothesis
Forex Trading using MetaTrader 4 with the Fractal Market Hypothesis Jonathan Blackledge School of Electrical Engineering Systems, Dublin Institute of Technology, Kevin Street, Dublin 8, Ireland. Email:
More informationAn Evaluation of Irregularities of Milled Surfaces by the Wavelet Analysis
An Evaluation of Irregularities of Milled Surfaces by the Wavelet Analysis Włodzimierz Makieła Abstract This paper presents an introductory to wavelet analysis and its application in assessing the surface
More informationarxiv:1205.0505v1 [q-fin.st] 2 May 2012
1 Fractal Profit Landscape of the Stock Market Andreas Grönlund 1, Il Gu Yi 2, Beom Jun Kim 2, 1 Dept. of Mathematics, Uppsala University, SE-751 6 Uppsala, Sweden 2 BK21 Physics Research Division and
More informationCROSS-CORRELATION BETWEEN STOCK PRICES IN FINANCIAL MARKETS. 1. Introduction
CROSS-CORRELATION BETWEEN STOCK PRICES IN FINANCIAL MARKETS R. N. MANTEGNA Istituto Nazionale per la Fisica della Materia, Unità di Palermo and Dipartimento di Energetica ed Applicazioni di Fisica, Università
More information4. Simple regression. QBUS6840 Predictive Analytics. https://www.otexts.org/fpp/4
4. Simple regression QBUS6840 Predictive Analytics https://www.otexts.org/fpp/4 Outline The simple linear model Least squares estimation Forecasting with regression Non-linear functional forms Regression
More informationDECENTRALIZED SCALE-FREE NETWORK CONSTRUCTION AND LOAD BALANCING IN MASSIVE MULTIUSER VIRTUAL ENVIRONMENTS
DECENTRALIZED SCALE-FREE NETWORK CONSTRUCTION AND LOAD BALANCING IN MASSIVE MULTIUSER VIRTUAL ENVIRONMENTS Markus Esch, Eric Tobias - University of Luxembourg MOTIVATION HyperVerse project Massive Multiuser
More informationModeling Heterogeneous Network Traffic in Wavelet Domain
634 IEEE/ACM TRANSACTIONS ON NETWORKING, VOL. 9, NO. 5, OCTOBER 2001 Modeling Heterogeneous Network Traffic in Wavelet Domain Sheng Ma, Member, IEEE, Chuanyi Ji Abstract Heterogeneous network traffic possesses
More informationA simple financial market model with chartists and fundamentalists: market entry levels and discontinuities
A simple financial market model with chartists and fundamentalists: market entry levels and discontinuities Fabio Tramontana *, Frank Westerhoff ** and Laura Gardini *** * University of Pavia, Department
More informationSAIF-2011 Report. Rami Reddy, SOA, UW_P
1) Title: Market Efficiency Test of Lean Hog Futures prices using Inter-Day Technical Trading Rules 2) Abstract: We investigated the effectiveness of most popular technical trading rules on the closing
More informationModeling and simulation of a double auction artificial financial market
Modeling and simulation of a double auction artificial financial market Marco Raberto a,1 and Silvano Cincotti a a DIBE, Universit di Genova, Via Opera Pia 11a, 16145 Genova, Italy Abstract We present
More informationDNA Coding Patterns and Biom sequences Coding Biomnis
64 Biophysical Journal Volume 67 July 1994 64-7 Correlation Approach to Identify Coding Regions in DNA Sequences S. M. Ossadnik,* S. V. Buldyrev,* A. L. Goldberger,$ S. HavIin,* R.N. Mantegna,* C.-K. Peng,**
More informationThe non-random walk of stock prices: the long-term correlation between signs and sizes
Eur. Phys. J. B (2008) DOI: 10.1140/epjb/e2008-00244-4 THE EUROPEAN PHYSICAL JOURNAL B The non-random walk of stock prices: the long-term correlation between signs and sizes G. La Spada 1,2,a,J.D.Farmer
More informationGreed, fear and stock market dynamics
Physica A 343 (2004) 635 642 www.elsevier.com/locate/physa Greed, fear and stock market dynamics Frank H. Westerhoff Department of Economics, University of Osnabrueck, Rolandstrasse 8, 49069 Osnabrueck,
More informationDistinguishing Separate Components in High-dimensional Signals by Using the Modified Embedding Method and Forecasting
Annals of Biomedical Engineering (Ó 2009) DOI: 10.1007/s10439-009-9820-0 Distinguishing Separate Components in High-dimensional Signals by Using the Modified Embedding Method and Forecasting KRZYSZTOF
More informationA statistical analysis of product prices in online markets
JSPS Grants-in-Aid for Creative Scientific Research Understanding Inflation Dynamics of the Japanese Economy Working Paper Series No.40 A statistical analysis of product prices in online markets Takayuki
More informationPrice fluctuations, market activity and trading volume
RESEARCH PAPER Q UANTITATIVE F INANCE V OLUME 1 (1) 262 269 quant.iop.org I NSTITUTE OF P HYSICS P UBLISHING Price fluctuations, market activity and trading volume Vasiliki Plerou 1,2, Parameswaran Gopikrishnan
More informationLisa Borland. A multi-timescale statistical feedback model of volatility: Stylized facts and implications for option pricing
Evnine-Vaughan Associates, Inc. A multi-timescale statistical feedback model of volatility: Stylized facts and implications for option pricing Lisa Borland October, 2005 Acknowledgements: Jeremy Evnine
More informationHigh-frequency trading model for a complex trading hierarchy
Quantitative Finance, Vol. 12, No. 4, April 212, 559 566 High-frequency trading model for a complex trading hierarchy BORIS PODOBNIK*yzx{, DUAN WANGy and H. EUGENE STANLEYy Downloaded by [Boston University],
More informationMaximum entropy distribution of stock price fluctuations
Maximum entropy distribution of stock price fluctuations Rosario Bartiromo a Istituto di Struttura della Materia del CNR, via Fosso del Cavaliere 100, 00133 Roma, and Dipartimento di Fisica, Università
More informationFinance Forecasting in Fractal Market Hypothesis
Örebro University Örebro University School of Business Master in Applied Statistics Supervisor: Sune karlsson Examiner: Panagiotis Mantalos June, 2014 Finance Forecasting in Fractal Market Hypothesis Wangke
More informationDynamics ofprice and trading volume in a spin model ofstock markets with heterogeneous agents
Physica A 316 (2002) 441 452 www.elsevier.com/locate/physa Dynamics ofprice and trading volume in a spin model ofstock markets with heterogeneous agents Taisei Kaizoji a;, Stefan Bornholdt b, Yoshi Fujiwara
More informationStock Price Forecasting Using Information from Yahoo Finance and Google Trend
Stock Price Forecasting Using Information from Yahoo Finance and Google Trend Selene Yue Xu (UC Berkeley) Abstract: Stock price forecasting is a popular and important topic in financial and academic studies.
More information12: Analysis of Variance. Introduction
1: Analysis of Variance Introduction EDA Hypothesis Test Introduction In Chapter 8 and again in Chapter 11 we compared means from two independent groups. In this chapter we extend the procedure to consider
More information2. What is the general linear model to be used to model linear trend? (Write out the model) = + + + or
Simple and Multiple Regression Analysis Example: Explore the relationships among Month, Adv.$ and Sales $: 1. Prepare a scatter plot of these data. The scatter plots for Adv.$ versus Sales, and Month versus
More informationHurst analysis of electricity price dynamics
Physica A 283 (2000) 462 468 www.elsevier.com/locate/physa Hurst analysis of electricity price dynamics Rafal Weron ; 1, Beata Przyby lowicz Hugo Steinhaus Center for Stochastic Methods, Wroc law University
More informationExamining the Effects of Traders Overconfidence on Market Behavior
Examining the Effects of Traders Overconfidence on Market Behavior Chia-Hsuan Yeh a,, Chun-Yi Yang b a Department of Information Management, Yuan Ze University, Chungli, Taoyuan 320, Taiwan b Tinbergen
More informationMaster of Mathematical Finance: Course Descriptions
Master of Mathematical Finance: Course Descriptions CS 522 Data Mining Computer Science This course provides continued exploration of data mining algorithms. More sophisticated algorithms such as support
More informationIntroduction to Probability
Introduction to Probability EE 179, Lecture 15, Handout #24 Probability theory gives a mathematical characterization for experiments with random outcomes. coin toss life of lightbulb binary data sequence
More informationTarget zone dynamics where the fundamental follows a SDE with periodic forcing
Target zone dynamics where the fundamental follows a SDE with periodic forcing Ghassan Dibeh Department of Economics Lebanese American University Box 36 Byblos, Lebanon E-mail: gdibeh@lau.edu.lb Tel: 96-9-54754
More informationChapter 9: Univariate Time Series Analysis
Chapter 9: Univariate Time Series Analysis In the last chapter we discussed models with only lags of explanatory variables. These can be misleading if: 1. The dependent variable Y t depends on lags of
More informationOnline Appendix for Demand for Crash Insurance, Intermediary Constraints, and Risk Premia in Financial Markets
Online Appendix for Demand for Crash Insurance, Intermediary Constraints, and Risk Premia in Financial Markets Hui Chen Scott Joslin Sophie Ni August 3, 2015 1 An Extension of the Dynamic Model Our model
More informationAlgorithmic Trading Session 6 Trade Signal Generation IV Momentum Strategies. Oliver Steinki, CFA, FRM
Algorithmic Trading Session 6 Trade Signal Generation IV Momentum Strategies Oliver Steinki, CFA, FRM Outline Introduction What is Momentum? Tests to Discover Momentum Interday Momentum Strategies Intraday
More informationStatistical properties of trading activity in Chinese Stock Market
Physics Procedia 3 (2010) 1699 1706 Physics Procedia 00 (2010) 1 8 Physics Procedia www.elsevier.com/locate/procedia Statistical properties of trading activity in Chinese Stock Market Xiaoqian Sun a, Xueqi
More informationCharacterizing Digital Cameras with the Photon Transfer Curve
Characterizing Digital Cameras with the Photon Transfer Curve By: David Gardner Summit Imaging (All rights reserved) Introduction Purchasing a camera for high performance imaging applications is frequently
More informationThe Long Memory of Order Flow in the Foreign Exchange Spot Market arxiv:1504.04354v2 [q-fin.tr] 22 Oct 2015
The Long Memory of Order Flow in the Foreign Exchange Spot Market arxiv:1504.04354v2 [q-fin.tr] 22 Oct 2015 Martin D. Gould, Mason A. Porter, and Sam D. Howison CFM Imperial Institute of Quantitative Finance,
More informationCONNECTING LESSONS NGSS STANDARD
CONNECTING LESSONS TO NGSS STANDARDS 1 This chart provides an overview of the NGSS Standards that can be met by, or extended to meet, specific STEAM Student Set challenges. Information on how to fulfill
More informationBiom indexes and Gaussian Regmentation
arxiv:cond-mat/9705087v1 [cond-mat.stat-mech] 9 May 1997 LECTURE 14 Scaling in stock market data: stable laws and beyond Rama CONT( 1,2,3 ), Marc POTTERS( 2 ) and Jean-Philippe BOUCHAUD( 1,2 ) ( 1 ) Service
More informationCurrency Trading Using the Fractal Market Hypothesis
Currency Trading Using the Fractal Market Hypothesis Jonathan Blackledge and Kieran Murphy Dublin Institute of Technology Ireland 7 1. Introduction We report on a research and development programme in
More informationarxiv:1108.3155v2 [q-fin.st] 19 Aug 2011
About the non-random Content of Financial Markets Laurent Schoeffel arxiv:8.355v2 [q-fin.st] 9 Aug 2 CEA Saclay, Irfu/SPP, 99 Gif/Yvette Cedex, France Abstract For the pedestrian observer, financial markets
More informationIntraday Trading Invariance. E-Mini S&P 500 Futures Market
in the E-Mini S&P 500 Futures Market University of Illinois at Chicago Joint with Torben G. Andersen, Pete Kyle, and Anna Obizhaeva R/Finance 2015 Conference University of Illinois at Chicago May 29-30,
More informationarxiv:0905.4815v1 [q-fin.tr] 29 May 2009
Trading leads to scale-free self-organization M. Ebert and W. Paul Department of Physics, Johannes-Gutenberg University, 55099 Mainz, Germany (Dated: June 2, 2009) arxiv:0905.4815v1 [q-fin.tr] 29 May 2009
More informationInternet Traffic Variability (Long Range Dependency Effects) Dheeraj Reddy CS8803 Fall 2003
Internet Traffic Variability (Long Range Dependency Effects) Dheeraj Reddy CS8803 Fall 2003 Self-similarity and its evolution in Computer Network Measurements Prior models used Poisson-like models Origins
More informationCorrelations and clustering in the trading of members of the London Stock Exchange
Correlations and clustering in the trading of members of the London Stock Exchange Ilija I. Zovko Center for Nonlinear Dynamics in Economics and Finance, University of Amsterdam, The Netherlands Santa
More informationCharles University, Faculty of Mathematics and Physics, Prague, Czech Republic.
WDS'09 Proceedings of Contributed Papers, Part I, 148 153, 2009. ISBN 978-80-7378-101-9 MATFYZPRESS Volatility Modelling L. Jarešová Charles University, Faculty of Mathematics and Physics, Prague, Czech
More informationThe Power (Law) of Indian Markets: Analysing NSE and BSE Trading Statistics
The Power (Law) of Indian Markets: Analysing NSE and BSE Trading Statistics Sitabhra Sinha and Raj Kumar Pan The Institute of Mathematical Sciences, C. I. T. Campus, Taramani, Chennai - 6 113, India. sitabhra@imsc.res.in
More informationInformation Theory and Stock Market
Information Theory and Stock Market Pongsit Twichpongtorn University of Illinois at Chicago E-mail: ptwich2@uic.edu 1 Abstract This is a short survey paper that talks about the development of important
More informationROBOTICS 01PEEQW. Basilio Bona DAUIN Politecnico di Torino
ROBOTICS 01PEEQW Basilio Bona DAUIN Politecnico di Torino Probabilistic Fundamentals in Robotics Robot Motion Probabilistic models of mobile robots Robot motion Kinematics Velocity motion model Odometry
More informationHU CZ FI PL SI PT IT ES NO NL FR DK SE IE GB AT DE CH LU 0 10 20 30 40 Foreigners' share Source: Eurostat More trust 3 4 5 6 7 PL HU CZ SI PT GR ES DK FI SE
More informationarxiv:1309.1492v1 [q-fin.st] 5 Sep 2013
Commodity futures and market efficiency Ladislav Kristoufek a,b, Miloslav Vosvrda a,b a Institute of Information Theory and Automation, Academy of Sciences of the Czech Republic, Pod Vodarenskou Vezi 4,
More informationExercise 1.12 (Pg. 22-23)
Individuals: The objects that are described by a set of data. They may be people, animals, things, etc. (Also referred to as Cases or Records) Variables: The characteristics recorded about each individual.
More informationCONTENTS. List of Figures List of Tables. List of Abbreviations
List of Figures List of Tables Preface List of Abbreviations xiv xvi xviii xx 1 Introduction to Value at Risk (VaR) 1 1.1 Economics underlying VaR measurement 2 1.1.1 What is VaR? 4 1.1.2 Calculating VaR
More informationScale-free user-network approach to telephone network traffic analysis
Scale-free user-network approach to telephone network traffic analysis Yongxiang Xia,* Chi K. Tse, WaiM.Tam, Francis C. M. Lau, and Michael Small Department of Electronic and Information Engineering, Hong
More information1. What is the critical value for this 95% confidence interval? CV = z.025 = invnorm(0.025) = 1.96
1 Final Review 2 Review 2.1 CI 1-propZint Scenario 1 A TV manufacturer claims in its warranty brochure that in the past not more than 10 percent of its TV sets needed any repair during the first two years
More informationIntroduction to Time Series Analysis. Lecture 1.
Introduction to Time Series Analysis. Lecture 1. Peter Bartlett 1. Organizational issues. 2. Objectives of time series analysis. Examples. 3. Overview of the course. 4. Time series models. 5. Time series
More informationAre the crude oil markets becoming weakly efficient over time? A test for time-varying long-range dependence in prices and volatility
Energy Economics 29 (2007) 28 36 www.elsevier.com/locate/eneco Are the crude oil markets becoming weakly efficient over time? A test for time-varying long-range dependence in prices and volatility Benjamin
More information2. Simple Linear Regression
Research methods - II 3 2. Simple Linear Regression Simple linear regression is a technique in parametric statistics that is commonly used for analyzing mean response of a variable Y which changes according
More informationBackbone and elastic backbone of percolation clusters obtained by the new method of burning
J. Phys. A: Math. Gen. 17 (1984) L261-L266. Printed in Great Britain LE ITER TO THE EDITOR Backbone and elastic backbone of percolation clusters obtained by the new method of burning H J HerrmanntS, D
More informationForex Trading using MetaTrader 4 with the Fractal Market Hypothesis
Dublin Institute of Technology ARROW@DIT Conference papers School of Electrical and Electronic Engineering 2011-01-01 Forex Trading using MetaTrader 4 with the Fractal Market Hypothesis Jonathan Blackledge
More informationSelf similarity of complex networks & hidden metric spaces
Self similarity of complex networks & hidden metric spaces M. ÁNGELES SERRANO Departament de Química Física Universitat de Barcelona TERA-NET: Toward Evolutive Routing Algorithms for scale-free/internet-like
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationBusiness Cycles, Theory and Empirical Applications
Business Cycles, Theory and Empirical Applications Seminar Presentation Country of interest France Jan Krzyzanowski June 9, 2012 Table of Contents Business Cycle Analysis Data Quantitative Analysis Stochastic
More informationQuant DSL Language Guide
Quant DSL Language Guide Appropriate Software Foundation June 24, 2011 Contents 1 Synthesis 2 2 Syntax 3 2.1 Expressions............................ 3 2.2 Markets and Dates........................ 3 2.3
More informationStock Price Dynamics, Dividends and Option Prices with Volatility Feedback
Stock Price Dynamics, Dividends and Option Prices with Volatility Feedback Juho Kanniainen Tampere University of Technology New Thinking in Finance 12 Feb. 2014, London Based on J. Kanniainen and R. Piche,
More informationPattern Recognition and Prediction in Equity Market
Pattern Recognition and Prediction in Equity Market Lang Lang, Kai Wang 1. Introduction In finance, technical analysis is a security analysis discipline used for forecasting the direction of prices through
More informationReal Business Cycle Models
Real Business Cycle Models Lecture 2 Nicola Viegi April 2015 Basic RBC Model Claim: Stochastic General Equlibrium Model Is Enough to Explain The Business cycle Behaviour of the Economy Money is of little
More informationFractal Profit Landscape of the Stock Market
Andreas Grönlund 1,IlGuYi 2, Beom Jun Kim 2 * 1 Department of Mathematics, Uppsala University, Uppsala, Sweden, 2 BK21 Physics Research Division and Department of Physics, Sungkyunkwan University, Suwon,
More informationThe Greatest Common Factor; Factoring by Grouping
296 CHAPTER 5 Factoring and Applications 5.1 The Greatest Common Factor; Factoring by Grouping OBJECTIVES 1 Find the greatest common factor of a list of terms. 2 Factor out the greatest common factor.
More informationChapter 4: Vector Autoregressive Models
Chapter 4: Vector Autoregressive Models 1 Contents: Lehrstuhl für Department Empirische of Wirtschaftsforschung Empirical Research and und Econometrics Ökonometrie IV.1 Vector Autoregressive Models (VAR)...
More informationDichotomic classes, correlations and entropy optimization in coding sequences
Dichotomic classes, correlations and entropy optimization in coding sequences Simone Giannerini 1 1 Università di Bologna, Dipartimento di Scienze Statistiche Joint work with Diego Luis Gonzalez and Rodolfo
More informationIntroduction to Learning & Decision Trees
Artificial Intelligence: Representation and Problem Solving 5-38 April 0, 2007 Introduction to Learning & Decision Trees Learning and Decision Trees to learning What is learning? - more than just memorizing
More informationThe Effective Dimension of Asset-Liability Management Problems in Life Insurance
The Effective Dimension of Asset-Liability Management Problems in Life Insurance Thomas Gerstner, Michael Griebel, Markus Holtz Institute for Numerical Simulation, University of Bonn holtz@ins.uni-bonn.de
More informationp(x,t) = 1 t δ F ( x t δ ),
15 July 2002 Physics Letters A 299 (2002) 565 570 www.elsevier.com/locate/pla Lévy statistics in coding and non-coding nucleotide sequences Nicola Scafetta a,b,, Vito Latora c, Paolo Grigolini b,d,e a
More information