Genetic genealogy (also known as molecular genealogy) Your genes 46 chromosomes, 23 from each parent

Size: px
Start display at page:

Download "Genetic genealogy (also known as molecular genealogy) Your genes 46 chromosomes, 23 from each parent"

Transcription

1 Scottish Genealogy Masterclass Dr Bruce Durie BSc (Hons) PhD OMLJ FSAScot FCollT FIGRS FHEA Shennachie to the Chief of Durie Shennachie to COSCA Genes and Genealogy Surnames and ethnic origin Genetic genealogy (also known as molecular genealogy) Genetic genealogy (also known as molecular genealogy) Traditional genealogy when combined with DNA can lead us deeper into our ancestry than the written records can take us on their own. It is not a replacement for traditional genealogy. So why use it? 1. To get around brick walls 2. To find genetic cousins by matching haplotypes 3. To determine deeper ethnic/genetic ancestry by assigning someone to a haplogroup 4. (Possibly) to indicate geographic origin Bruce Durie Bruce Durie Bruce Durie What DNA testing cannot do 1. pinpoint the exact date and identify the specific ancestor shared by two individuals who have a close match 2. provide a complete answer to your recent ancestry even if two participants have a good paper trail 3. shed much light unless compared with the test results of other individuals 4. replace documentary genealogy Bruce Durie Your genes 46 chromosomes, 23 from each parent 22 pairs autosomes 1 pair sex chromosomes Male = YX Female = XX Bruce Durie Y-DNA: paternal line The Y-Chromosome determines gender As only men inherit the Y-chromosome it follows the direct male line (so women cannot test for it) As it does NOT have a pair it cannot be recombined It is passed down directly and nearly unchanged from father to son It accumulates changes (mutations) very slowly and is a rich source of information going back many generations A woman can use the DNA from her father, paternal uncle, brother, paternal male cousin etc. to reveal information about her paternal lineage Bruce Durie

2 Y-DNA tests 1. The recommended test for genealogical purposes is 37 or 46 markers (67 has advantages) 2. Why 37 markers? 3. How can relationships be worked out? 4. The commercial tests: 37, 46 or 67 markers using STRs (short tandem repeats) 5. A 12 marker test will only tell you a haplogroup (and that you are Western European) - not sufficient for genealogical purposes 6. Use 12 markers as an introduction or to help disprove a connection Types of DNA testing For the purposes of genealogy there are four types, but we only typically use three of them: 1. Y-DNA: This follows the direct paternal line 2. mtdna or mitochondrial DNA: This follows the direct maternal line 3. Autosomal DNA: this uses DNA from all our ancestral lines 4. X-Chromosome not typically used Junk DNA: long stretches of DNA with no known function. These are especially good for genealogical purposes. Genetic genealogy does not tend to look at areas which affect our health (viz. concerns about life insurance). When a cell reproduces a copy error (called a mutation) may occur. Mutations occur very rarely but can be measured very accurately. This is done in different ways depending on the type of DNA analysed. Haplogroups 1. Each branch of the tree where a unique SNP has been identified has been given a letter. 2. These branches are called Haplogroups and define genetically related individuals. 3. There are both mtdna and Y-DNA haplogroups. Bruce Durie Bruce Durie Bruce Durie Haplogroups and sub-clades 1. Major Haplogroups (R, I etc.) define connections within tens of thousands of years. i.e. 10,000-40,000 years Haplotree Note: Defining SNP European migration : out of Africa? 2. These can be broken down by further SNPs into sub-clades. 3. Sub-clades are relevant to genealogical studies as they show relatedness to kin-groups i.e B.C A.D. (define indigenous and incoming groups and can show migration routes taken across Europe and Britain) Do watch this Bruce Durie Bruce Durie Bruce Durie

3 Migrations and Ethnic Groups Example of STR results Y-DNA haplotypes Marker DYS576 DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS389i Markers Name tested HaploGroup Andrew Durie of Durie etc R1b1a2a1a1b4 Sir David Durie etc R1b1a2 Dr. Bruce Durie etc I2b1a DYS392 DYS389ii DYS458 DYS459 DYS455 DYS454 DYS447 DYS437 DYS448 DYS449 DYS464 Haplogroup confirmed by SNP tests Name Markers Paternal Ancestor Country Confirmed Origin Haplogroup Short Hand Andrew Durie of Durie 37 Gilbert de Durie ca 1261 John Durie of Durie ca Scotland Fifa R1b1a2a1a1b4 R-L21 R-S145+ Bruce Durie 2015 Sir David Durie 67? Scotland? R1b1a2 R-M269 Gilbert de Durie ca 1261 John Dr. Bruce Durie 67 Durie of Durie ca Scotland I2b1a I-M284 Fife Robert Wesley Durie 67? Scotland Laudonia R1b1a2 R-M Bruce Durie A collection of STR markers gives you a Haplotype which is your paternal signature Above are the 37 marker haplotypes of four individuals The top haplotype in blue is the modal signature for the group (average value for each marker) Each marker has been given a DYS number, such as position DYS576 Bruce Durie Y-DNA haplotypes Subclades of R R - R-M207/UTY2 * R1b1a2 - R-M269 * R1b1a2a1a1 - L11/S127 * R1b1a2a1a1a3, 439=null - R-L1, 439=null R1b1a2a1a1a4 - R-L48/S162 R1b1a2a1a1b - R-P312 R1b1a2a1a1b3c - R-L2/S1139 R1b1a2a1a2c - R-L21 R1b1a2a1a1b4b - R-M222 R1b1a2a1a1b5 - R-L176.2 R1b1a2a1a1b5a - R-M167/SRY2627 R1b1b2a1a R-U106 R1b1b2a1a1 R-U106 R1b1b2a1a2c - R-M167 R1b1b2a1a2f1- R-M37 R1b1c - R-V88 Grouped Not all tested to same level Kit Number Name Paternal Ancestor Name Markers Haplogroup Even within Groups, there is diversity DYS393 DYS390 DYS19 DYS391 DYS385 DYS426 DYS388 DYS439 DYS389i DYS392 DYS389ii DYS458 DYS459 DYS455 DYS454 DYS447 DYS437 DYS448 DYS449 I Dr. Thomas Franklin Duryea 37 I M I Dr. Bruce Durie Andrew Durie of Durie, ca I L R1b1a Mr. Martin Lee Phillips Samuel Phillips c R M James Robert Durie 25 R M Alistair John Lindsay Durie 67 R M Bruce Duryea Joost DeRieux 37 R M Mr. Phillip Richardson Duryea Joost Duryee or Duryea 67 R M Dr. Robert Wesley Durie 67 R M Mr. John Dunlop Durie 37 R M Sir David Robert Campbell Durie 67 R M Ray Smith Campbell Jr. Joseph Campbell, Sr. (c1734) 111 R M R1b1a1a1a1a4a Mark Kent Duryee Joost Durie, b and d. June 9, R L R1b1a2a1a2c Mr. Roger Alan Holmes (Adopted) Tom Allan / Allen R L Mr. Tristan Beauchamp Russell John Dearie b.1772 and d R L Andrew Durie Andrew Durie of Durie, ca R L R1b1b2a Robert Durie 67 R M R1b1b2a1b Michael Dury Michael Dury, b and died R M DYS464 We can exclude these Dr. Thomas Franklin Duryea 37 I M253 I1 Finno-Scandic Dr. Bruce Durie L126/S165, L137/S166, L369 I2a2a1a1a1 Caledonian (Pict) Andrew Durie R-L21 R1b1a2a1a2c Known to be DEWAR Bruce Durie Bruce Durie Bruce Durie

4 Dury/Duryea/Duryee are different Dr. Thomas Franklin Duryea 37 I M253 I1 Cannot be related to Bruce Duryea 37 R M269 R1b1a Mr. Phillip Richardson Duryea 67 R M269 R1b1a2 Cannot be related to Mark Kent Duryee 67 R L2 R1b1a1a1a1a4a Cannot be related to Michael Dury 67 R M269 R1b1b2a1b We are not necessarily any closer to the Dinosaur Durie, and would encourage everyone to upgrade to 67 markers at least. Bruce Durie Bruce Durie 2015 Three pleas 1. Please upgrade to 67 markers Join the Scottish DNA Project Please send us family trees (to TribalPages) 3. Please document your family trees The Baronial line Robert Durie of that ilk Jonet Durie Henry Kemp David Durie of that ilk Robert Durie of that ilk (Sold Durie in 1614) Bruce Durie b = I2a2a1-M284 but Y comes from Kemp) Finally Henry Durie of Craigluscar The Chiefly line Abbot George Durie Escaped to France 1560 Peter Durie of Rossend Capt. George Durie 5 th of Craigluscar bef Captain, Garde Ecossais ca Eliza Durie of Craigluscar Dr. Andrew Dewar John Durie (Jesuit) George Durie (Jesuit) Andrew Durie Chief R1b1b2a1b5-L21 b (but Y comes from Dewar) Bruce Durie = Went to France Fought in Flanders (and his brothers) STR markers 1. DYS576 is located at a known position on the Y-chromosome 2. The typical range of allele repeats expected for this marker is in the range 11 to An allele changes through mutation but only rarely 4. Two of the men opposite share a value of 18, while the other two have mutated, one up, the other down 5. The average value, the modal is 18 for the four men 6. Markers have been identified as either fast (volatile) or slow mutating. In the chart below the fast markers are in maroon Y-DNA Glossary STR = short tandem repeat markers Marker = position measured on Y-DNA structure DYS marker = a number given to each marker and simply indicates the locus number in sequence of discovery Allele value = the count of the number of base pair tandem repeats Haplotype = a string of numerical values derived from different markers DNA signature = haplotype that belongs to an individual DNA study participant MRCA = Most recent common ancestor Modal = most commonly found value among a range of values SNP = mutation which has occurred only once at a specific position in a particular chromosome in a single individual Y-DNA: What is a match? These two haplotypes show a two marker mismatch on 37 markers This is written as 35/37 match FTDNA TIP Report 37 markers - Generations Percentage The probability that kit no shared a common ancestor with in the last:...8 generations is 57.40% generations is 85.81% generations is 95.88% generations is 98.90% generations is 99.72%. If a generation is 30 years then they share a common ancestor years ago. This may not seem very close, but. Bruce Durie Bruce Durie Bruce Durie

5 Y-DNA: What is a match? 1. If the two men compare 67 markers they only have one further mismatch giving them a 64/67 match 2. They share a surname and both most distant ancestors lived within a mile of each other c This brings the TMRCA down to: years at 50% probability years at a 90% probability 6. Traditional genealogy suggests a TMRCA c Genetic Distance by itself is a simplified measure of the total number of mutational differences between two individuals i.e. 64/67 means there is a genetic distance of 3. Bruce Durie Y-DNA Match A Y-DNA match using STR markers such as 37, 46, 67 etc, can also identify if you share a relationship with a known historical character or people group, but... The specific time (TMRCA) cannot be determined accurately i.e. Somerled or Niall of the Nine Hostages i.e. indigenous (Pict), Frisian (continential), Viking, etc Often an SNP test called a deep clade test is required to confirm that you fall into such a group as STRs do not give enough definition Unless one of your close matches have already undertaken such a test. (Costs abt. 60) Bruce Durie What is not a match 12 or 25 marker matches These can be significant if they are the same surname But tend to either indicate just a common ancient origin or are just chance convergence Ultimately either you, your match or both will need to upgrade to 37 or 67 markers. Bruce Durie Issues to consider if no match Recent mutations in your line Mutations can occur in any generation and at any time i.e. MacNeil 1 st cousins who have 3 mismatches Some of these mutations may be personal mutations in your line and can only be identified when your results are compared to others who share a common ancestor When identified they can narrow the gap to TMRCA NPE in your lineage! Test cousins and other lines You need to be proactive and target individuals Bruce Durie markers is the minimum recommendation, 67 is better 2. Additional STR markers will refine your matches. The level that you choose depends on your goals The amount of testing already completed by others in a group project that you are joining The degree of certainty for a relationship (match) that you desire 3. For genealogical matching, the most important factor is the degree of certainty that your near or exact matches are indeed related to you in recent generations 4. Generally, testing additional STR markers will: Narrow the expected time to a common ancestor with an exact match Increase the degree of certainty for a near or exact match Reduce the number of irrelevant matches 5. Therefore, test what you can afford and need for your task and upgrade when necessary Bruce Durie What DNA testing can do 1. find connections between two individuals with the same surname 2. indicate roughly when two individuals shared a common ancestor 3. prove whether families with the same surname are related 4. eliminate individuals or families with the same surname as being related 5. identify and change of surname, variation in surname and use of alias 6. complement one-name studies - prove that everyone bearing the same surname are/are not related 7. reveal uncertain paternity through illegitimacy or adoption 8. help prove whether family stories and origin histories are true 9. test and corroborate conventional documentary research linking individuals and families 10. enable colonials and the descendants of diasporas to identify their geographical origins 11. track deep ancestral migration Bruce Durie

6 and reveals deeper ancestral connections Traditional genealogy combined with Y-DNA confirms lineage and connection to other same surname families Bruce Durie Y-DNA Haplogroups 1. The most common haplogroup in the British Isles is R1b 2. But new SNP discoveries have created dozens of smaller branches called sub-clades (genetic clans) 3. These can be identified with specific migration and people groups 4. Haplogroup R1 is predominantly Scandinavian in origin 5. Haplogroup I1d James Naughtie = Angle from the continent, but years ago to Scotland 6. Sub-clades are typically known by their SNP identifier i.e. M Letters before a SNP number designates the laboratory where they were first discovered 8. S145 - the classic Scottish indigenous marker 9. M222 spread from North of Ireland to Scotland 10. S21 Frisian > Anglo Saxon / West Germanic 11. L165/S68 Norse Viking West and Northern Highlands Bruce Durie What does Pict DNA look like? Haplogroup I2b1a1 - IslesSc Defined by SNPs M284+ (L126+) Found almost exclusively among the population of Great Britain, suggesting that the sub-clade may have a very long history on that island estimates suggest approximately 3,150 years! Haplotype might look like this: Or this: Bruce Durie L165/S68 Norse Viking Deep Y-line ancestry: subclade of haplogroup R1b paternal kinship shared by MacNeils of Barra, the Buies of Jura, some MacDonalds and the core MacLeod lineage L165Project/default.aspx?section=yresults DNA does not support the MacNeils of Barra being connected in the direct paternal line to Niall of the Nine Hostages. Some MacNeils from the Southern Hebrides and the North of Ireland do match the Niall SNP R-M222 Bruce Durie Y-DNA: Ireland R-M222 Haplogroup Project Northwest Ireland/lowland Scotland first recognized in late 2004 following manual cluster analysis of STRs In late 2005 a research team from Trinity College Dublin published a report that identified this cluster In 2006 it was identified with SNP M222 Bruce Durie Haplogroup R-M222 (Niall expansion into Scotland) Bruce Durie

7 Y-DNA: Haplogroup R1b Example R1b1a2 (M269) Y-DNA: Haplogroup I2b R- M269 Country Sampling sample Wales National Spain Basques Ireland National Spain Catalonia France Ille-et-Vilaine France Haute-Garonne England Cornwall France Loire-Atlantique France Finistère France Basques Check out p_r1b_%28y- DNA%29#R1b1a2_.28R-M and cochran/results?raw=1 Spain East Andalucia Spain Castilla La Mancha France Vendée France Baie de Somme England Leicestershire Bruce Durie Bruce Durie Bruce Durie Somerled R1a1a1h Haplogroup I1 M222 Niall Does Surname and DNA confirm history? Using over 1,300 tests from our database 1.We allocated (blind) surnames to Nations 2.We assessed whether their Y- HGs were typical of these Nations (they were!) 3.We assessed whether each Nation had a predominant HG (they did!) CONCLUSION Surname is a good predictor of ethnic origin, and fits with the historical story. Tracking Surname radiation from the 1881 census Figure 3 radiation of the surname MacDonald from the Western Isles, based on surname incidence in the 1881 census. Figure 4 the origin of the surname Durie is documented as being from Fife ca. 1261, and the surname incidence in the 1881 census confirms this. Figure 5 Elder is interesting, as it is represented by 15 subjects in this study, all from Angus and Fife, but with a number of haplotypes: I2b1 (2); J2 (1); R1b1a2 (11, including one R1b1a2a1a1b) So, we can be confident about Surname origins Bruce Durie Bruce Durie Bruce Durie

8 DNA Resources 1. ISOGG International Society of Genetic Genealogy 2. Check out the IGOGG wiki 3. JOGG Journal of Genetic Genealogy Human evolution, migration and history audio files 5. Learn Genetics Blog Radio - Bruce Durie DNA tools 1. FTDNA TiP Tool 2. SMGF Ysearch Mitosearch Genebase Dean McGee s Y-Utility Jim Cullen s World Haplogroup Predictor - Example: L165Project/default.aspx?section=yresults Bruce Durie DNA literature 1. Family History in the Genes, by Chris Pomery (out of print) The National Archives. Amazon 11 copies available. 2. Trace your Roots with DNA, by Megan Smolenyak Smolenyak & Ann Turner DNA & Genealogy, by Colleen Fitzpatrick & Andrew Yeiser The Scots: A genetic journey, by Alastair Moffat and Jim Wilson The Seven Daughters of Eve, by Bryan Skyes I Have the Results of My Genetic Genealogy Test, Now What?, by Blaine Bettinger. FTDNA website ( Bruce Durie

The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample.

The sample is taken with a simple mouth swab no blood is involved. There will be instructions included on how to take the sample. DNA testing Thanks for your enquiry about DNA testing. I oversee the Scottish DNA Project on behalf of the University of Strathclyde, Glasgow and act as representative for Family Tree DNA who host our

More information

I Have the Results of My Genetic Genealogy Test, Now What?

I Have the Results of My Genetic Genealogy Test, Now What? I Have the Results of My Genetic Genealogy Test, Now What? Version 2.1 1 I Have the Results of My Genetic Genealogy Test, Now What? Chapter 1: What Is (And Isn t) Genetic Genealogy? Chapter 2: How Do I

More information

Y Chromosome Markers

Y Chromosome Markers Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except

More information

What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008)

What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008) What Do I Do With My DNA Results.in 10 Easy Steps By Roberta Estes (copyright 2008) The most common question I receive from people whose DNA results are returned to them is what do I do now? I ve put together

More information

DNA Testing for Genealogy - What Can It Do For You??

DNA Testing for Genealogy - What Can It Do For You?? DNA Testing for Genealogy - What Can It Do For You?? Paper courtesy of Roberta Estes, www.dnaexplain.com, e-mail Roberta at Roberta@dnaexplain.com. Graphics courtesy of Family Tree DNA, www.familytreedna.com.

More information

NORSE VIKING HERITAGE

NORSE VIKING HERITAGE NORSE VIKING HERITAGE My mother's maiden name is WILLIAMSON. Her ancestors in the paternal line came from the Shetland Islands. The Shetland Islands were settled by Norse Vikings beginning before 800 AD.

More information

Geographic Patterns of Haplogroup R1b in the British Isles

Geographic Patterns of Haplogroup R1b in the British Isles Geographic Patterns of Haplogroup R1b in the British Isles Journal of Genetic Genealogy 3:1-13, 2007 Kevin D. Campbell Abstract The recent availability of Y-STR databases has provided the opportunity to

More information

Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft

Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Elsevier Editorial System(tm) for Forensic Science International: Genetics Manuscript Draft Manuscript Number: Title: A comment on the Paper: A comparison of Y-chromosomal lineage dating using either resequencing

More information

Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem

Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem Some ancestors are difficult to trace. Adoptions illegitimacies, name changes and migrations can present brick walls in our research that seem impregnable. In other cases, documentation that would shed

More information

GENETIC GENEALOGY AND DNA TESTING

GENETIC GENEALOGY AND DNA TESTING GENETIC GENEALOGY AND DNA TESTING by Ted Steele This publication may be ordered from: St. Louis Genealogical Society P. O. Box 432010 St. Louis, MO 63143 Copyright 2013 St. Louis Genealogical Society All

More information

Paternity Testing. Chapter 23

Paternity Testing. Chapter 23 Paternity Testing Chapter 23 Kinship and Paternity DNA analysis can also be used for: Kinship testing determining whether individuals are related Paternity testing determining the father of a child Missing

More information

Phillips DNA News. Project News. www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser

Phillips DNA News. Project News. www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser 2011 The Phillips DNA Project Phillips DNA News www.phillipsdnaproject.com April 2013 Volume 5 Issue 4 Editor: Nancy Kiser Please submit news articles or ideas for articles to the editor. Questio ns about

More information

From Africa to Aotearoa Part 1: Out of Africa

From Africa to Aotearoa Part 1: Out of Africa From Africa to Aotearoa Part 1: Out of Africa The spread of modern humans out of Africa started around 65,000 years ago, and ended with the settlement of New Zealand 750 years ago. These PowerPoint presentations

More information

DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method

DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method DNA Genealogy, Mutation Rates, and Some Historical Evidences Written in Y-Chromosome. I. Basic Principles and the Method Anatole A. Klyosov 1 Abstract Origin of peoples in a context of DNA genealogy is

More information

Rethinking Polynesian Origins: Human Settlement of the Pacific

Rethinking Polynesian Origins: Human Settlement of the Pacific LENScience Senior Biology Seminar Series Rethinking Polynesian Origins: Human Settlement of the Pacific Michal Denny, and Lisa Matisoo-Smith Our Polynesian ancestors are renowned as some of the world s

More information

DAUGHERTY / DOUGHERTY NATIVE AMERICAN DNA

DAUGHERTY / DOUGHERTY NATIVE AMERICAN DNA PiquaShawnee Project DAUGHERTY / DOUGHERTY NATIVE AMERICAN DNA Gayland Eugene Daugherty joined this project to seek additional informaton about his Cherokee Native American ancestry. PiquaShawnee was initiated

More information

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans

The Story of Human Evolution Part 1: From ape-like ancestors to modern humans The Story of Human Evolution Part 1: From ape-like ancestors to modern humans Slide 1 The Story of Human Evolution This powerpoint presentation tells the story of who we are and where we came from - how

More information

List of United States Presidents by genealogical

List of United States Presidents by genealogical List of United States Presidents by genealogical relationship From Wikipedia, the free encyclopedia This page discusses some of the genealogical relationships of, and among, Presidents of the United States.

More information

Family Tree FAMILY TREE GUIDE TEACHER S THE HISTORY CHANNEL PRESENTS: A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT.

Family Tree FAMILY TREE GUIDE TEACHER S THE HISTORY CHANNEL PRESENTS: A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT. 1 THE HISTORY CHANNEL CLASSROOM PRESENTS TEACHER S GUIDE THE HISTORY CHANNEL PRESENTS: Family Tree A two hour world premiere airing on September 17, 2001 at 9 pm ET/PT. Birth certificates. Death notices.

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

Written by Roberta Estes, www.dnaexplain.com, Copyright 2007-2012

Written by Roberta Estes, www.dnaexplain.com, Copyright 2007-2012 Proving Your Native American Heritage Written by Roberta Estes, www.dnaexplain.com, Copyright 2007-2012 Many American families carry oral histories of Native American heritage. Most often, we think of

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. 11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for

More information

X Linked Inheritance

X Linked Inheritance X Linked Inheritance Information for Patients and Families 2 X linked Inheritance The following will give you information about what X linked inheritance means and how X linked conditions are inherited.

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Recovering the Romanovs

Recovering the Romanovs Recovering the Romanovs Description of activity Recovering the Romanovs is an excellent opening to any unit on human genetics. To complete the three parts of this module, approximately three 40-minute

More information

Recovering the Romanovs

Recovering the Romanovs Recovering the Romanovs ACTIVITY 1 The Romanov Family: Screen #4 Inheritance of a Sex-linked Trait Key: H=normal allele; h=hemophilia allele; X=X chromosome; Y=Y chromosome 1. Use a Punnett square to show

More information

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other?

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other? Marrying a relative Is there an increased chance that a child will have genetic problems if its parents are related to each other? The simple answer to this question is Yes, there is an increased chance.

More information

Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine.

Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. Genetic Variation and Human Evolution Lynn B. Jorde, Ph.D. Department of Human Genetics University of Utah School of Medicine. The past two decades have witnessed an explosion of human genetic data. Innumerable

More information

Mary Queen of Scots Family Tree

Mary Queen of Scots Family Tree Mary Queen of Scots Family Tree Mary Queen of Scots is a complex historical persona. She has a significant place in Scottish, English and British history and is a required character to study for the Scottish

More information

Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona

Matthew Kaplan and Taylor Edwards. University of Arizona Tucson, Arizona Matthew Kaplan and Taylor Edwards University of Arizona Tucson, Arizona Unresolved paternity Consent for testing Ownership of Samples Uncovering genetic disorders SRY Reversal / Klinefelter s Syndrome

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.

Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today. Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:

More information

Genealogy. Family History Research: an introduction 10 credit points Tahitia McCabe BA MLS PGDip (Geneal Stud), Marie Dougan Bsc PgDip

Genealogy. Family History Research: an introduction 10 credit points Tahitia McCabe BA MLS PGDip (Geneal Stud), Marie Dougan Bsc PgDip < BACK TO CONTENTS > 39 Genealogy The Centre f Lifelong Learning has a unique range of learning opptunities in the field of genealogy and related subjects. Whether you intend to take up genealogy f personal

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Evolution (18%) 11 Items Sample Test Prep Questions

Evolution (18%) 11 Items Sample Test Prep Questions Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science

More information

Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing

Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing Short Communication Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing T.C. Vieira 1,2,3,4, M.A.D. Gigonzac 2,3,4, D.M. Silva

More information

patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015

patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015 patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015 BRCA1 and BRCA2 Mutations Cancer is a complex disease thought to be caused by several different factors. A few types of cancer

More information

On the Common Ancestors of All Living Humans

On the Common Ancestors of All Living Humans On the Common Ancestors of All Living Humans Douglas L. T. Rohde Massachusetts Institute of Technology November 11, 2003 Abstract Questions concerning the common ancestors of all present-day humans have

More information

CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes

CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE. Section B: Sex Chromosomes CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE Section B: Sex Chromosomes 1. The chromosomal basis of sex varies with the organism 2. Sex-linked genes have unique patterns of inheritance 1. The chromosomal

More information

DNA Testing and the Melungeons

DNA Testing and the Melungeons DNA Testing and the Melungeons Roberta Estes, copyright 2006-2008, restes@comcast.net DNA testing has become an integral part of any genealogical endeavor, generally as part of a surname project. However,

More information

Autosomal DNA Testing. Successfully Using Autosomal Testing in Conjunction with Mitochondrial and Y-Line Testing to Address Genealogical Questions

Autosomal DNA Testing. Successfully Using Autosomal Testing in Conjunction with Mitochondrial and Y-Line Testing to Address Genealogical Questions Autosomal DNA Testing Successfully Using Autosomal Testing in Conjunction with Mitochondrial and Y-Line Testing to Address Genealogical Questions Written by Roberta Estes, www.dnaexplain.com, Copyright

More information

What s in a name? Y chromosomes, surnames, and the genetic genealogy. Department of Genetics, University of Leicester, University Road, Leicester

What s in a name? Y chromosomes, surnames, and the genetic genealogy. Department of Genetics, University of Leicester, University Road, Leicester What s in a name? Y chromosomes, surnames, and the genetic genealogy revolution Turi E. King and Mark A. Jobling Department of Genetics, University of Leicester, University Road, Leicester LE1 7RH, UK

More information

PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES

PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES PRACTICE PROBLEMS - PEDIGREES AND PROBABILITIES 1. Margaret has just learned that she has adult polycystic kidney disease. Her mother also has the disease, as did her maternal grandfather and his younger

More information

dna - genealem's genetic genealogy

dna - genealem's genetic genealogy Page 1 of 9 SEARCH BLOG FLAG BLOG Next Blog» Create Blog Sign In dna - genealem's genetic genealogy DNA TESTING - KNOW THE IN'S AND OUT'S OF IT. GENETIC GENEALOGY, A NEW BRANCH OF GENEALOGY COMBINING GENETICS

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female

More information

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

14.3 Studying the Human Genome

14.3 Studying the Human Genome 14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating

More information

CHAPTER 2: UNDERSTANDING CANCER

CHAPTER 2: UNDERSTANDING CANCER CHAPTER 2: UNDERSTANDING CANCER INTRODUCTION We are witnessing an era of great discovery in the field of cancer research. New insights into the causes and development of cancer are emerging. These discoveries

More information

ADAM and JANE (JENKINS) JOHNSTON FAMILY of MALAKOFF

ADAM and JANE (JENKINS) JOHNSTON FAMILY of MALAKOFF ADAM and JANE (JENKINS) JOHNSTON FAMILY of MALAKOFF The surviving land assessment rolls of Marlborough township, Carleton county, Ontario, first listed a Johnston in 1825; rolls for 1823 and 1824 are lost

More information

Practice Questions 1: Evolution

Practice Questions 1: Evolution Practice Questions 1: Evolution 1. Which concept is best illustrated in the flowchart below? A. natural selection B. genetic manipulation C. dynamic equilibrium D. material cycles 2. The diagram below

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Life Insurance. What you need to know about. Mucopolysaccharide and related diseases including Fabry disease

Life Insurance. What you need to know about. Mucopolysaccharide and related diseases including Fabry disease Society for Mucopolysaccharide Diseases MPS House, Repton Place White Lion Road, Amersham Buckinghamshire, HP7 9LP, UK 0345 389 9901 mps@mpssociety.org.uk www.mpssociety.org.uk Mucopolysaccharide and related

More information

CCR Biology - Chapter 7 Practice Test - Summer 2012

CCR Biology - Chapter 7 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 7 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. A person who has a disorder caused

More information

The Campbell Family. Chapter 1 9 th and 8 th generations featuring Adam and son Alexander. Late 1700s and early 1800s

The Campbell Family. Chapter 1 9 th and 8 th generations featuring Adam and son Alexander. Late 1700s and early 1800s The Campbell Family Chapter 1 9 th and 8 th generations featuring Adam and son Alexander Late 1700s and early 1800s 4/4/2012 2:08 PM Many relatives have provided information and photos for the Campbell

More information

Array Comparative Genomic Hybridisation (CGH)

Array Comparative Genomic Hybridisation (CGH) Array Comparative Genomic Hybridisation (CGH) Exceptional healthcare, personally delivered What is array CGH? Array CGH is a new test that is now offered to all patients referred with learning disability

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.

More information

Follow your family using census records

Follow your family using census records Census records are one of the best ways to discover details about your family and how that family changed every 10 years. You ll discover names, addresses, what people did for a living, even which ancestor

More information

7A The Origin of Modern Genetics

7A The Origin of Modern Genetics Life Science Chapter 7 Genetics of Organisms 7A The Origin of Modern Genetics Genetics the study of inheritance (the study of how traits are inherited through the interactions of alleles) Heredity: the

More information

Cosmetic Interventions - Survey of Scottish Population HEALTH AND SOCIAL CARE. social. research

Cosmetic Interventions - Survey of Scottish Population HEALTH AND SOCIAL CARE. social. research Cosmetic Interventions - Survey of Scottish Population HEALTH AND SOCIAL CARE social research Cosmetic Interventions Survey of Scottish Population YouGov Gavin Ellison Laura Piggott Contents Contents...

More information

BOY SCOUTS OF AMERICA MERIT BADGE SERIES GENEALOGY

BOY SCOUTS OF AMERICA MERIT BADGE SERIES GENEALOGY GENEALOGY BOY SCOUTS OF AMERICA MERIT BADGE SERIES GENEALOGY Enhancing our youths competitive edge through merit badges Requirements 1. Explain to your counselor what the words genealogy, ancestor, and

More information

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date

Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by

More information

Functional Skills English Reading Assessment. Level 2

Functional Skills English Reading Assessment. Level 2 Functional Skills English Reading Assessment Level 2 Learner name Learner registration number Learner signature Centre Assessment date NOCN USE ONLY Question Mark 1 2 3 4 5 6 7 8 Total Instructions to

More information

Foreword. End of Cycle Report 2014. Applicants

Foreword. End of Cycle Report 2014. Applicants Foreword The End of Cycle Report is our most comprehensive analysis to date of recruitment to full time undergraduate courses in the UK. It provides a rich picture of demand and outcomes for higher education

More information

Influence of Sex on Genetics. Chapter Six

Influence of Sex on Genetics. Chapter Six Influence of Sex on Genetics Chapter Six Humans 23 Autosomes Chromosomal abnormalities very severe Often fatal All have at least one X Deletion of X chromosome is fatal Males = heterogametic sex XY Females

More information

Population Genetics and Multifactorial Inheritance 2002

Population Genetics and Multifactorial Inheritance 2002 Population Genetics and Multifactorial Inheritance 2002 Consanguinity Genetic drift Founder effect Selection Mutation rate Polymorphism Balanced polymorphism Hardy-Weinberg Equilibrium Hardy-Weinberg Equilibrium

More information

Chromosomal Basis of Inheritance. Ch. 3

Chromosomal Basis of Inheritance. Ch. 3 Chromosomal Basis of Inheritance Ch. 3 THE CHROMOSOME THEORY OF INHERITANCE AND SEX CHROMOSOMES! The chromosome theory of inheritance describes how the transmission of chromosomes account for the Mendelian

More information

About The Causes of Hearing Loss

About The Causes of Hearing Loss About 1 in 500 infants is born with or develops hearing loss during early childhood. Hearing loss has many causes: some are genetic (that is, caused by a baby s genes) or non-genetic (such as certain infections

More information

Basics of Marker Assisted Selection

Basics of Marker Assisted Selection asics of Marker ssisted Selection Chapter 15 asics of Marker ssisted Selection Julius van der Werf, Department of nimal Science rian Kinghorn, Twynam Chair of nimal reeding Technologies University of New

More information

GLOSSARY OF TERMS. A kinship term used when speaking to or addressing a relative. Those relatives connected by one or more marital links.

GLOSSARY OF TERMS. A kinship term used when speaking to or addressing a relative. Those relatives connected by one or more marital links. GLOSSARY OF TERMS ADDRESS, TERM OF: AFFINAL RELATIVES: AGNATES: A kinship term used when speaking to or addressing a relative. Those relatives connected by one or more marital links. Male or female descendants

More information

Who are the Other ethnic groups?

Who are the Other ethnic groups? Article Who are the Other ethnic groups? Social and Welfare David Gardener Helen Connolly October 2005 Crown copyright Office for National Statistics 1 Drummond Gate London SW1V 2QQ Tel: 020 7533 9233

More information

Assignment Discovery Online Curriculum

Assignment Discovery Online Curriculum Assignment Discovery Online Curriculum Lesson title: Nature Versus Nurture Grade level: 9-12, with adaptation for younger students Subject area: Human Body Contemporary Studies Behavioral Science Duration:

More information

Religion and Science

Religion and Science Religion and Science Glossary Cosmology the study of the origins of the universe How did the world come into existence? Theory one Aristotle Taught that the universe has always existed and would always

More information

( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years.

( 1) Most human populations are a product of mixture of genetically distinct groups that intermixed within the last 4,000 years. Frequently asked questions about A Genetic Atlas of Human Admixture History G. Hellenthal, G.B.J. Busby, G. Band, J.F. Wilson, C. Capelli, D. Falush, S. Myers, Science (2014) SUMMARY What is your work

More information

Organizing Your Paper Files Using File Folders Guide

Organizing Your Paper Files Using File Folders Guide EASY Way to Organize Family History Papers Presented by Beth Powell Susquehanna Valley Family History Conference 14 April 2012 Overview of Principles of Organization Presentation of Mary E.V. Hill s Organizing

More information

BRCA1 and BRCA2 for men

BRCA1 and BRCA2 for men Oxford University Hospitals NHS Trust Oxford Regional Genetic Department BRCA1 and BRCA2 for men Information for men from families with a known alteration in the BRCA1/2 gene Introduction BRCA1 and BRCA2

More information

Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland

Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland Am. J. Hum. Genet. 67:697 717, 2000 Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland Agnar Helgason, 1 Sigrún Sigurðardóttir, 3 Jayne Nicholson, 2 Bryan Sykes, 2 Emmeline W.

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Scotland s Class of 99: the early career paths of graduates who studied in Scottish higher education institutions. Summary report

Scotland s Class of 99: the early career paths of graduates who studied in Scottish higher education institutions. Summary report Scotland s Class of 99: the early career paths of graduates who studied in Scottish higher education institutions Summary report Scotland s Class of 99: the early career paths of graduates who studied

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Mutation and its consequences. Notes at: tcd.ie/biology_teaching_centre/local/ junior-freshman/ by1101local

Mutation and its consequences. Notes at: tcd.ie/biology_teaching_centre/local/ junior-freshman/ by1101local Lecture 7 Mutation and its consequences CAMPBELL BIOLOGY Notes at: tcd.ie/biology_teaching_centre/local/ junior-freshman/ by1101local Natural variants and mutants 1. Genetic analysis would not be possible

More information

Got Lactase? The Co-evolution of Genes and Culture

Got Lactase? The Co-evolution of Genes and Culture The Making of the Fittest: Natural The Making Selection of the and Fittest: Adaptation Natural Selection and Adaptation OVERVIEW PEDIGREES AND THE INHERITANCE OF LACTOSE INTOLERANCE This activity serves

More information

The Southern Colonies

The Southern Colonies The Southern Colonies About 100 men and boys sailed to Virginia in 1607. They set up a settlement. They named their new home Jamestown. They did not plant crops. They looked for gold. Just a few of the

More information

Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15

Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population

More information

Mendelian and Non-Mendelian Heredity Grade Ten

Mendelian and Non-Mendelian Heredity Grade Ten Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 6 Explain that a unit of hereditary information is called a gene, and genes

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Genetic modification for cell pedigree labels to aid disease treatment

Genetic modification for cell pedigree labels to aid disease treatment Genetic modification for cell pedigree labels to aid disease treatment Ronald L. Rivest rivest@mit.edu March 10, 2014 Abstract We suggest modifying the human genome in order to aid in the treatment of

More information

Chapter 15 Multiple myeloma

Chapter 15 Multiple myeloma Chapter 15 Multiple myeloma Peter Adamson Summary In the UK and in the 199s, multiple myeloma accounted for around 1 in 8 diagnosed cases of cancer and 1 in 7 deaths from cancer. There was relatively little

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

German Family History Made Eas(ier) Richard Lynn Walker, LL.M, ZG. Research Manager. FamilySearch Frankfurt Germany Office

German Family History Made Eas(ier) Richard Lynn Walker, LL.M, ZG. Research Manager. FamilySearch Frankfurt Germany Office German Family History Made Eas(ier) Richard Lynn Walker, LL.M, ZG Research Manager FamilySearch Frankfurt Germany Office Several studies have shown that Germans comprise the largest ethnic group in the

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction: Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose

More information

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes. 1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome

More information

KEY TIPS FOR CENSUS SUCCESS

KEY TIPS FOR CENSUS SUCCESS KEY TIPS FOR CENSUS SUCCESS We're going to begin with tips that apply whichever census you're searching, and whichever site you're using. * Always allow for mistakes - for example, it's rarely advisable

More information

Creative Industries: Focus on Employment. June 2014

Creative Industries: Focus on Employment. June 2014 : Focus on Employment June 2014 27/06/2014 : Focus on Employment These estimates are Official Statistics and have been produced to the standards set out in the Code of Practice for Official Statistics

More information

BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis

BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis Introduction - Fields of Genetics To answer the following question, review the three traditional subdivisions of

More information

Mendelian inheritance and the

Mendelian inheritance and the Mendelian inheritance and the most common genetic diseases Cornelia Schubert, MD, University of Goettingen, Dept. Human Genetics EUPRIM-Net course Genetics, Immunology and Breeding Mangement German Primate

More information

Jamestown Questions and Answers

Jamestown Questions and Answers Jamestown Questions and Answers Why is Jamestown important? Jamestown was the first permanent English settlement in North America. It is America s birthplace. Who were the first Europeans to explore Virginia?

More information