Chen et al., Human Mutation 1

Transcription

1 Chen et al., Human Mutation 1 A B Supp. Figure S1. Optical coherence tomogram (OCT) of a patient with PHARC. A. a normal control. B. cystic retinal edema in the patient.

2 Chen et al., Human Mutation 2 A B Dele on Breakpoint 20:25,340,670 59,214 bp Dele on Dele on Breakpoint 20:25,399,884 ABHD12 Intron 1 62 bp GINS Intron 1 14 bp unspecific fragment 21 bp GINS Intron 1 GINS Intron 4 97 bp Inser on C Supp. Figure S2. Detection of ABHD12 mutations in a PHARC family. A. Sequence chromatograms for a portion of exon 12 of ABHD12 showing a heterozygous A to T transversion in a patient with PHARC compared to a control with the wild-type nucleotide A at nt Her mother and half-brother do not carry this mutation. B. The sequencing revealed the precise breakpoints of the deletion encompassing a 59Kb region located in ABHD12 intron1 to GINS1 intron 4 that includes exon 1 of ABHD12 and exons 1-4 of GINS1 and both promoters. A 97 bp

3 Chen et al., Human Mutation 3 fragment comprised of 2 small pieces of intron 1 of GINS1 and an unspecific segment of DNA is inserted. C. Sequencing of exon 12 in ABHD12 cdna from the patient who has a nonsense mutation in ABHD12 and a gross deletion in ABHD12 and GINS1 revealed only mutant genotype T at nucleotide Sequencing from her unaffected mother who carries the deletion and her unaffected half-brother without the mutations show the wild-type A at this nucleotide position. This demonstrates that the allele with the nonsense mutation produced stable RNA and also confirmed the absence of RNA from the maternal allele with the deletion. Nucleotide numbering reflects cdna with +1 corresponding to the A of the ATG translation initiation codon in the ABHD12 NM_ , and GINS1 NM_ The mutations nomenclature follows the instruction given in HGVS (

4 Chen et al., Human Mutation 4 Supp. Table S1. Sequences of the primers used in amplification of ABHD12 Forward 5'-3' Reverse 5'-3' PCR-sequencing of ABHD12 a Exon 1 CTGGGCTGGGATGTGAG GACGGCCACTCTGGGAG Exon 2 TGTGTGGCTCTTGTTTAGGG TGGGTGGTAGCTCTACCTATCTATC Exon 3 CGTGTGGATGCATATCTGTG CCTTTAGGAAAGGAAGAGGTG Exon 4 AGTTTTCTACCACCCACCCC AGTGAGCTGAAGCCGCC Exon 5 AGTGTGGGGCTACTTAGGGG CACAAACAGCCCAGCAATAG Exon6 TGCCACTACGTACAAGGCAG TCTTTGTCAGGACCCAGGAC Exon 7 GGTCTGTGGACTCTGGAAGG AGGCTGGTCGGGACTAATG Exons 8-9 ACCCCATGGCTCCTCTG GCAGCTCTGTGGCCAAAAC Exon 10 GTCACCCCTGCTCCCTTAG CCTGTTTGCTAGAGAATGACCC Exon 11 CTGTTTCCCAAAACACACCC CTCCTGAGCCTGACGTGG Exon 12 TGGTTTCTATTGAAGGGGAGG ATCACTGTGACTCTTGGCCC Exon 13 CACAGCCTCTGCTTCCTTAG GATCTGAGGTGCTCTCCAGG Nested PCR-sequencing of ABHD12 deletion fragment b External PCR GACAGAATCTCTCCCCACGA GACAGAATCTCTCCCCACGA Internal PCR TAGCACTTCCTCACCCAACC TTCCGGAGCAATGTTCTTTC Sequencing TGCCATAGCCTCCCAAGTAG PCR-sequencing of exon10-13 of ABHD12 cdna c cdna exon10-13 CGATACTTCCCTGGGTTTGA GCTGCTGACTGGAGGAAAAC Sequencing Same as PCR primers a Amplifications were performed in 60 ng DNA with HotStart Taq polymerase (Qiagen, Venlo, Netherlands), with optimized annealing temperatures of 56 C for exons 3, 8 and 9, and 58 C for the remaining exons. Direct DNA sequencing was performed using BigDye V3.1 Cycle Sequencing Kits (Applied Biosystems, Carlsbad, CA) with the same forward primers as in the PCR amplification, and sequencing products were electrophoresed on an ABI PRISM 3130xl Genetic Analyzer. To confirm the mutation, exon 12 was also sequenced in reverse. b To define the breakpoints of the deletion, nested PCR was performed using two sets primers located outside the estimated deletion ranges given by CGH array. PCR was carried out with TaKaRa Ex Taq polymerase (Millipore, Billerica, MA) in a first round of PCR using an external primer set, followed by a second round of PCR using 1 l of the product from the initial PCR and an internal primer pair set (final concentration 0.4 M each). In both amplifications, annealing temperatures were 60 C. PCR cycle numbers were 30 cycles in the first round and 35 cycles in the second round. The products were directly sequenced using a series of primers to successively approach the breakpoints. Only the final primer that identified the conjunction of breakpoints is given in the table. c PCR amplification of cdna fragment of exons encompassing mutation of c.1129a>t was performed with HotStart Taq (Qiagen) polymerase with the listed primers using annealing temperature at 56 C and 35 cycles. The PCR product was subjected to direct sequencing with the same primers as used in the PCR.

5 Chen et al., Human Mutation 5 Supp. Table S2. TaqMan Copy Number assay of ABHD12 Custom assay intron 1 exon 6 exon 9 exon 12 Forward 5'-3' Reverse 5'-3' Probes 5'-3' GCCGACGCGGGAATGA GCACCTGCGCAAAGTGA ACCGGCCCCCCCCC assay Hs _cn assay Hs _cn assay Hs _cn assay Hs _cn Copy number analysis was carried out in genomic DNA of the patient with PHARC, her mother and two normal controls using the TaqMan Copy Number Assays (Applied Biosystems). In addition, we designed an assay targeting the known region in intron 1 that has only one allele, evidenced by a SNP in this fragment that is not shared by the patient and her mother.

6 Chen et al., Human Mutation 6 Supp. Table S3. qrt-pcr of ABHD12 and GINS1 Forward 5'-3' Reverse 5'-3' Probes 5'-3' ABHD12F71 CACAGGATCAAGGTTTGAATCAC AGACTGCAGGGACGGTGT Roche UPL probe 71 ABHD12F31 GGAAGACGTGACCATTGGAG ACATCTGGTCTTTGCCTTGG Roche UPL probe 31 GINS1F46 TGCCAAATGCATTACGATTTC CCCAGTGACCTCATATAAGTAGCA Roche UPL probe 46 GINS1F52 TCACATGGCTGCTGAAGAAA TCCTGTGTAATGTCCAAACCTTC Roche UPL probe 52 GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC Roche UPL probe 60 HPRT TGACCTTGATTTATTTTGCATACC CGAGCAAGACGTTCAGTCCT Roche UPL probe 73 YWHAZ GATCCCCAATGCTTCACA TGCTTGTTGTGACTGATCGAC Roche UPL probe ng of RNA per subjects in PHARC family and controls was used for one-step TaqMan qrt-pcr reactions with a RNA Master Hydrolysis Probes system (Roche, Basel, Switzerland). Two sets of primers-probe, designed from Universal Probe Library by Roche, were used to amplify fragments of each of ABHD12 and GINS1. The reactions were run on a Stratagene MX3000P qpcr cycler using the following thermal protocol: 1) 62 C x 10min, 2) 95 C x 30s, 3) 95 C x15s, 4) 55 C x15s, 5) 60 C x 20s, read fluorescence, 6) 72 C x 10s, 7) repeat steps times. The conditions were optimized using a 7-point dilution curve. Data were normalized to a geometric mean of three housekeeping genes (GAPDH, HPRT, YWHAZ), and analyzed using a 2- c(t) method. A total of 4-5 replicates were analyzed from each sample.