MRD in ALL (pa,ent specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2011 Marleen Bakkus

Size: px
Start display at page:

Download "MRD in ALL (pa,ent specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2011 Marleen Bakkus"

Transcription

1 MRD in ALL (pa,ent specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2011 Marleen Bakkus

2 Cellular origin of B/T- cell malignancies Myeloid stem cell B-lymphocytes Stem cell precursor cells lymphoid stem cell T-lymphocytes Bone marrow Thymus Blood Lymphnode Bone marrow

3 MRD in ALL genezing

4 Which genes for MRD? Immunoglobulin (Ig) T-cell receptor (TCR)

5 More diversity junc,onal regions VH3-21 DH3-3 JH4-1 Cµ Junctional region VH3-21(germline) insertion DH3-3 (germline) insertion JH4-1(germline) TGTATTACTGTGCGAGA! GTATTACGATTTTTGGAGTGGTTATTATACC! ACTACTTTGACTACT! TGTATTACTGT AGGC CGATTTTTGGAGTGGTTATTATA GTCCA TGACTACT! TGTATTACTGTGCG TATCCGGA TTACGATTTTTGGAGTGGTTATTATAC CGATCG CTTTGACTACT! TGTATTACTGTGC CCGGACTG TTTTGGAGTGGTTATTATACC GGT ACTACTTTGACTACT! TGTATTACTGTGCGAG CTGAGTC TATTACGATTTTTGGAGTGGTTAT CGTAGCGTA TTTGACTACT! TGTATTACTG ACATCGA CGATTTTTGGAGTGGTTATTATA CGTAG ACTTTGACTACT! TGTATTACTGTGCG CGT TACGATTTTTGGAGTGGTTATTAT GGCTAAGG TGACTACT! TGTATTACTGTGC TTTGGAGTGGTTAT CC ACTTTGACTACT! TGTATTACTGTGCGAGA GGCTAG ATTACGATTTTTGGAGTGGTTATACC GTCGA GACTACT! TGTATTACTGTG GTCCAG TATTACGATTTTTGGAGTG CCGTAG CTACTTTGACTACT! TGTATTA CCGGA CGATTTTTGGAGTGGTTATTATA C ACT!

6 Primary repertoire diversity of human Ig and TCR molecules TCRαβ TCRγδ IgH Igκ Igλ TCRα TCRβ TCRγ TCRδ Number of genes - V genes >100 >50 >40 >50 > D genes J genes Combina,on diversity >5x10 6 >5x10 6 >5000 Junc,onal region diversity ++ +/- +/ Es#ma#on of total primary receptor repertoire >10 12 >10 12 >10 12

7 Frequency of TCR and Ig in childhood ALL B- lineage ALL T- lineage ALL IgH >95% 20-25% (~DH- JH) Igκ Igλ ~65% (~Kde) 15-20% TCRβ ~35% ~90% TCRγ ~55% ~95% TCRδ ~40% ~55% Vδ2- Jα29 ~40-45% Ref.: J.J.M. van Dongen en V.H.J. van der Velden: Detection of minimal residual disease in ALL

8 Genomic DNA TCR Gamma V N J TCR delta V N D PCR VH-CDR3 V N-D-N J DIAGNOSIS 125 bp Sequencing of the N-region Clono (N)-specific oligonucleotidic (ASO) probe/primer MRD Allele-specific real-time PCR PCR Genomic DNA <0.1%

9 Target iden,fica,on Diagnosis: Bone marrow sample DNA extrac,on PCR for IGH IGK TCRG TCRD TCRB (only in T- ALL) Sil- Tal (only in T- ALL)

10 Sequence targets PAGE Purify clonal band Sequence with forward and reverse primers

11 Sequence analysis and ASO design ASO-primer 2 IGHV3-64*05 (-6) N1 IGHD2-2*01 (-5, -13) N2 ASO-primer 1 IGHJ1 (-0) hardcopy

12 ASO design OLIGO soeware Tm: C Avoid stretches of more than 3 G s and C s in the last 5 bases Avoid dimer forma,on

13 ASO- primers in RQ- PCR IgH TCRδ VH DH JH V δ 2 D δ 3 n=3 n=6 n=1 n=1 TCRγ Igκ V γ J γ Vκ Kde n=1 n=2 n=1 n=1 ASO junctional region Probe Consensus primer Ref: Verhagen et al., Leukemia 2000, Van der Velden et al. Leukemia 2002

14 Temperature gradient 60 C 63 C 65 C Vg9 Patient 10-2 Healthy controls

15 Temperature gradient 60 C 63 C 65 C IgH VH2

16 Quan,fica,on of FU samples qaso-pcr FU1 FU2 Quantitative range: 10-4 Sensitivity: 10-5 FU3 FU2 FU1 FU1: 0,04% FU2: positive, not-quantifiable FU3: negative

17 Control gene Albumin Standard: commercial DNA

18 Ref: VHJ van der Velden, 2007, Leukemia

19 European Study Group on MRD detec,on in ALL (ESG- MRD- ALL; 32 laboratories in 17 countries) DCLSG Interfant ALL9 99 MRC- ALL 97/99 UKALL-R3 COALL FRALLE 2000 EORTC- CLG BFM- AIEOP ALL-2000 ESG MRD ALL NOPHO ALL-2000 R e l a p s e d A L L A L L - R E Z B F M 2002 adult ALL GMALL 06/99 adult ALL LALA 2000 (pre-)bmt ALL adult ALL UKALL XII adult ALL PETHEMA/ GETH Europe Stockholm Israel Singapore Glasgow Leeds Sheffield Kiel London Amsterdam Hamburg Bristol Lille Paris Rotterdam Brussel Copenhague Hannover Berlin Frankfurt Heidelberg Zurich Prague Vienna Petach Tikwa Australia Singapore Padova Monza Salamanca Sydney

20 EORTC- CLG (France, Belgium) EFS % MRD < MRD > 10-2 VHR Overall Logrank test: p< (years) O N Number of patients at risk : MRD < 10-2 MRD > 10-2 Cavé et al., NEJM 1998

21 EORTC- CLG MRD VLR R Ia-D Ia-P + R Ib no aspa Ib aspa interval IIa 4/8 maintenance If 10-2 vhr AR low R IA D IA P + R IB no aspa IBaspa interval IIA 4/8 R maintenance maintenance + pulse If 10-2 vhr AR high R IA D IA P + R IB no aspa IB aspa interval IIA 4/8 R mt mt+pulse If 10-2 vhr R1 R2 R3 R1 R2 R3 VHR R IA D IB vanda 3xHD MTX maintenance IA P BMT-MSD * W

22 Avoiding AlloSCT 3 y QR: , sensitivity:

23 Earlier predic,on of relapse QR: , sensitivity

24 Why qaso- PCR More sensi,ve than genescan Later,mepoints can be tested Beter predic,on of relapse Preven,on of over treatment Very standardised, possibility to compare with other ALL trials

25 Future Pa,ents will be stra,fied according to their early molecular response to treatment in future clinical protocols. The good responders might be cured using a less aggressive chemotherapeu,c regimen, avoiding side effects and therapy related long term toxici,es. In contrast, poor responders will need more intensive but also more toxic approaches including allogeneic stem cell transplanta,on.

26 Antwerpen, Koningin Paola Kinderziekenhuis (Dr. P. Maes) Brussel, UZ Brussel (Dr. J. Otten, Dr. A. van Damme/Dr. J. van der Werff ten Bosch) Brussel, HUDE Reine Fabiola (Dr. A. Ferster) Brussel, UCL Saint Luc (Dr. C. Vermylen) Gent, UZ Gent (Dr. Y. Benoit) Leuven, Gasthuisberg Leuven (Dr. A. Uyttenbroeck) Luik, Hopital Citadelle Liege (Dr. M-F. Dresse/ Dr. C. Hoyoux) Montegnee, C.H. St. Joseph Esperance (Dr. P.Philippet/ Dr. N. Francotte)

27 Molecular- Hematology lab

Minimal residual disease in childhood ALL (patient specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2013 Marleen Bakkus

Minimal residual disease in childhood ALL (patient specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2013 Marleen Bakkus Minimal residual disease in childhood ALL (patient specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2013 Marleen Bakkus Survival of childhood cancer patients Major challenges Treatments

More information

Genomic Analysis of Mature B-cell Malignancies

Genomic Analysis of Mature B-cell Malignancies Genomic Analysis of Mature B-cell Malignancies Update and Lessons Learned Omar Abdel-Wahab, MD Memorial Sloan Kettering Cancer Center Human Oncology and Pathogenesis Program and Leukemia Service Disclaimer:

More information

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of

More information

Chronic lymphocytic EBMT Slideleukemia. University of Heidelberg, Germany March 22, 2010. The European Group for Blood and Marrow Transplantation

Chronic lymphocytic EBMT Slideleukemia. University of Heidelberg, Germany March 22, 2010. The European Group for Blood and Marrow Transplantation Chronic lymphocytic EBMT Slideleukemia template Peter Barcelona Dreger Chairman, CLL 7 February subcommittee 2008 University of Heidelberg, Germany March 22, 2010 The European Group for Blood and Marrow

More information

JACIE in Belgium. Ivan Van Riet. National Jacie representative Ivan.vanriet@uzbrussel.be

JACIE in Belgium. Ivan Van Riet. National Jacie representative Ivan.vanriet@uzbrussel.be JACIE in Belgium Ivan Van Riet National Jacie representative Ivan.vanriet@uzbrussel.be National JACIE meeting day 24 January 2013 Stem cell transplantation programme Collection Processing Transplantation

More information

FastTest. You ve read the book... ... now test yourself

FastTest. You ve read the book... ... now test yourself FastTest You ve read the book...... now test yourself To ensure you have learned the key points that will improve your patient care, read the authors questions below. Please refer back to relevant sections

More information

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins

specific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins Adaptive Immunity Chapter 17: Adaptive (specific) Immunity Bio 139 Dr. Amy Rogers Host defenses that are specific to a particular infectious agent Can be innate or genetic for humans as a group: most microbes

More information

Pro Cure in Multiple Myeloma. Nicolaus Kröger Dept. of Stem Cell Transplantation University Hospital Hamburg Hamburg, Germany

Pro Cure in Multiple Myeloma. Nicolaus Kröger Dept. of Stem Cell Transplantation University Hospital Hamburg Hamburg, Germany Pro Cure in Multiple Myeloma Nicolaus Kröger Dept. of Stem Cell Transplantation University Hospital Hamburg Hamburg, Germany Pro Cure in Multiple Myeloma Several hematological malignancies can be cured

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Treating Minimal Residual Disease in Acute Leukemias: How low should you go?

Treating Minimal Residual Disease in Acute Leukemias: How low should you go? Treating Minimal Residual Disease in Acute Leukemias: How low should you go? Ramsie Lujan, Pharm.D. PGY1 Pharmacy Practice Resident Methodist Hospital, San Antonio, Texas Pharmacotherapy Education and

More information

UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and

UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and Blood Disorders La Crosse, WI UNDERSTANDING MULTIPLE

More information

BHS COMMITTEES MEETING 30 January 2014

BHS COMMITTEES MEETING 30 January 2014 BHS COMMITTEES MEETING 30 January 2014 Regulatory affairs JACIE Ivan Van Riet Ivan.vanriet@uzbrussel.be Scopes Supporting implementation of JACIE standards in national SCT centres with the aim to obtain

More information

PROGRAMMA / PROGRAM. Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol

PROGRAMMA / PROGRAM. Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol PROGRAMMA / PROGRAM Molecular Biology and Cytometry Course 16 th -17 th May 2013, SCK CEN, Mol MB&C course MOL 2013 programma / program

More information

Why discuss CLL? Common: 40% of US leukaemia. approx 100 pa in SJH / MWHB 3 inpatients in SJH at any time

Why discuss CLL? Common: 40% of US leukaemia. approx 100 pa in SJH / MWHB 3 inpatients in SJH at any time Why discuss CLL? Common: 40% of US leukaemia approx 100 pa in SJH / MWHB 3 inpatients in SJH at any time Median age of dx is 65 (30s. Incurable, survival 2-202 20 years Require ongoing supportive care

More information

Hodgkin Lymphoma Disease Specific Biology and Treatment Options. John Kuruvilla

Hodgkin Lymphoma Disease Specific Biology and Treatment Options. John Kuruvilla Hodgkin Lymphoma Disease Specific Biology and Treatment Options John Kuruvilla My Disclaimer This is where I work Objectives Pathobiology what makes HL different Diagnosis Staging Treatment Philosophy

More information

Belgium Ghent University, Ghent Rigshospitalet, Copenhagen. Denmark. Germany UniversitätKlinikum, Essen Heidelberg University Hospital, Heidelberg

Belgium Ghent University, Ghent Rigshospitalet, Copenhagen. Denmark. Germany UniversitätKlinikum, Essen Heidelberg University Hospital, Heidelberg We are ready to actively participate in the development of innovative therapies that will improve the cure rate and quality of life of children with cancer. Created in 2003, ITCC is a consortium of 49

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

Stem Cell Transplantation for Acute Lymphoblastic Leukemia

Stem Cell Transplantation for Acute Lymphoblastic Leukemia Stem Cell Transplantation for Acute Lymphoblastic Leukemia Mona Shafey MD, FRCPC Bone Marrow Transplant Fellow Alberta Blood and Marrow Transplant Program 1 of 14 Stem Cell Transplantation for Acute Lymphoblastic

More information

LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials

LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational

More information

INSERM/ A. Bernheim. Overcoming clinical relapse in multiple myeloma by understanding and targeting the molecular causes of drug resistance

INSERM/ A. Bernheim. Overcoming clinical relapse in multiple myeloma by understanding and targeting the molecular causes of drug resistance A. Bernheim Overcoming clinical relapse in multiple myeloma by understanding and targeting the molecular causes of drug resistance OVER-MyR is funded by the European Commission within its FP7 specific

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

A Time Line Of Chronic Myeloid Leukemia

A Time Line Of Chronic Myeloid Leukemia Chronic Myeloid Leukemia in 2011 An Update on Treatment and Monitoring Michael Deininger MD PhD Chief, Division of Hematology and Hematologic Malignancies M. M. Wintrobe Professor of Medicine A Time Line

More information

The immune system. Bone marrow. Thymus. Spleen. Bone marrow. NK cell. B-cell. T-cell. Basophil Neutrophil. Eosinophil. Myeloid progenitor

The immune system. Bone marrow. Thymus. Spleen. Bone marrow. NK cell. B-cell. T-cell. Basophil Neutrophil. Eosinophil. Myeloid progenitor The immune system Basophil Neutrophil Bone marrow Eosinophil Myeloid progenitor Dendritic cell Pluripotent Stem cell Lymphoid progenitor Platelets Bone marrow Thymus NK cell T-cell B-cell Spleen Cancer

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

treatments) worked by killing cancerous cells using chemo or radiotherapy. While these techniques can

treatments) worked by killing cancerous cells using chemo or radiotherapy. While these techniques can Shristi Pandey Genomics and Medicine Winter 2011 Prof. Doug Brutlag Chronic Myeloid Leukemia: A look into how genomics is changing the way we treat Cancer. Until the late 1990s, nearly all treatment methods

More information

Interesting Case Review. Renuka Agrawal, MD Dept. of Pathology City of Hope National Medical Center Duarte, CA

Interesting Case Review. Renuka Agrawal, MD Dept. of Pathology City of Hope National Medical Center Duarte, CA Interesting Case Review Renuka Agrawal, MD Dept. of Pathology City of Hope National Medical Center Duarte, CA History 63 y/o male with h/o CLL for 10 years Presents with worsening renal function and hypercalcemia

More information

Pulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic

Pulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic Pulling the Plug on Cancer Cell Communication Stephen M. Ansell, MD, PhD Mayo Clinic Why do Waldenstrom s cells need to communicate? Waldenstrom s cells need activating signals to stay alive. WM cells

More information

Umbilical Cord Blood Transplantation

Umbilical Cord Blood Transplantation Umbilical Cord Blood Transplantation V Rocha MD, PhD Hopital Saint Louis, Paris University 7 CIBMTR Milwaukee Umbilical Cord blood transplantation Background History Clinical results in children and adults

More information

Novità dall EHA >> [ Leucemia linfatica cronica ]

Novità dall EHA >> [ Leucemia linfatica cronica ] Novità dall EHA >> [ Leucemia linfatica cronica ] Relatore: P. GHIA 27-28 ottobre 2008 Borgo S. Luigi Monteriggioni (Siena) Leucemia linfatica cronica - Copyright FSE 1 Number and type of abstracts 2 Number

More information

Pediatric Ph + ALL. Andrea Biondi, MD on behalf of the I-BFM EsPhALL group

Pediatric Ph + ALL. Andrea Biondi, MD on behalf of the I-BFM EsPhALL group The EsPhALL experience for the treatment t t of Pediatric Ph + ALL Andrea Biondi, MD on behalf of the I-BFM EsPhALL group Clinica Pediatrica, Centro M.Tettamanti and Dipartimento di Scienze della Salute,

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Introduction. About 10,500 new cases of acute myelogenous leukemia are diagnosed each

Introduction. About 10,500 new cases of acute myelogenous leukemia are diagnosed each Introduction 1.1 Introduction: About 10,500 new cases of acute myelogenous leukemia are diagnosed each year in the United States (Hope et al., 2003). Acute myelogenous leukemia has several names, including

More information

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development Overview B cell development Transcriptional cascades Amazing aspects of lineage plasticity Conventional (B2) B cell development What happens to an autoreactive B cell? B1 vs B2 cells Key anatomical sites

More information

Cytogenetics for the Rest of Us: A Primer

Cytogenetics for the Rest of Us: A Primer Cytogenetics for the Rest of Us: A Primer James J. Stark, MD, FACP Medical Director Cancer Program Maryview Medical Center Diane Maia, M.D. Pathologist, Bon Secours Hampton Roads Case #1 78 y.o. lady seen

More information

Molecular Biology: Measuring and Reporting BCR-ABL Transcripts Level. Giuseppe Saglio

Molecular Biology: Measuring and Reporting BCR-ABL Transcripts Level. Giuseppe Saglio Molecular Biology: Measuring and Reporting BCR-ABL Transcripts Level Giuseppe Saglio 1 st Question to be addressed Why is it so important to measure BCR- ABL transcript levels in the follow-up of CML patients

More information

Lauren Berger: Why is it so important for patients to get an accurate diagnosis of their blood cancer subtype?

Lauren Berger: Why is it so important for patients to get an accurate diagnosis of their blood cancer subtype? Hello, I m Lauren Berger and I m the Senior Director of Patient Services Programs at The Leukemia & Lymphoma Society. I m pleased to welcome Dr. Rebecca Elstrom. Dr. Elstrom is an Assistant Professor in

More information

TCRG TCRA/D IGH IGK/L

TCRG TCRA/D IGH IGK/L Assays immunoseq Assay The inquiry to insight solution for profiling T- and B-cell s Immunosequencing solutions for multiple species and loci Illuminate the adaptive immune system with bias-controlled

More information

Multiple Myeloma and Colorectal Cancer

Multiple Myeloma and Colorectal Cancer Multiple Myeloma and Colorectal Cancer From Systems Immunology to Single Cells Leo Hansmann Mark M. Davis Lab Department of Microbiology&Immunology Stanford University Multiple Myeloma Monoclonal disease

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

A Cure for Sickle Cell Anemia and Thalassemia

A Cure for Sickle Cell Anemia and Thalassemia IV Simpósio Internacional de Hemoglobinopatias A Cure for Sickle Cell Anemia and Thalassemia Bertram Lubin, MD and Mark Walters, MD 4 September 2007 Topics to be covered Cord blood: Importance and biology

More information

Corporate Medical Policy Genetic Testing for Fanconi Anemia

Corporate Medical Policy Genetic Testing for Fanconi Anemia Corporate Medical Policy Genetic Testing for Fanconi Anemia File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_fanconi_anemia 03/2015 3/2016 3/2017 3/2016 Description

More information

RNAseq / ChipSeq / Methylseq and personalized genomics

RNAseq / ChipSeq / Methylseq and personalized genomics RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School

More information

Sepax. your child s cord blood is in safe hands. World leader in adult stem cell processing

Sepax. your child s cord blood is in safe hands. World leader in adult stem cell processing Sepax your child s cord blood is in safe hands World leader in adult stem cell processing Biosafe Experience Credibility Innovation Dear Customer, Innovation in cell processing is our credo and this is

More information

Outline of thesis and future perspectives.

Outline of thesis and future perspectives. Outline of thesis and future perspectives. This thesis is divided into two different sections. The B- section involves reviews and studies on B- cell non- Hodgkin lymphoma [NHL] and radioimmunotherapy

More information

Shaji Kumar, M.D. Multiple Myeloma: Multiple myeloma (MM) is the second most common hematological

Shaji Kumar, M.D. Multiple Myeloma: Multiple myeloma (MM) is the second most common hematological An update on the management of multiple myeloma and amyloidosis Shaji Kumar, M.D. Multiple Myeloma: Multiple myeloma (MM) is the second most common hematological malignancy in this country affecting nearly

More information

Molecular diagnostics is now used for a wide range of applications, including:

Molecular diagnostics is now used for a wide range of applications, including: Molecular Diagnostics: A Dynamic and Rapidly Broadening Market Molecular diagnostics is now used for a wide range of applications, including: Human clinical molecular diagnostic testing Veterinary molecular

More information

Malignant Lymphomas and Plasma Cell Myeloma

Malignant Lymphomas and Plasma Cell Myeloma Malignant Lymphomas and Plasma Cell Myeloma Dr. Bruce F. Burns Dept. of Pathology and Lab Medicine Overview definitions - lymphoma lymphoproliferative disorder plasma cell myeloma pathogenesis - translocations

More information

CML. cure. A Patient s Guide. Molecular Biology Diagnosis Stem Cell Transplant Monitoring New Drugs Questions to Ask and More

CML. cure. A Patient s Guide. Molecular Biology Diagnosis Stem Cell Transplant Monitoring New Drugs Questions to Ask and More A Patient s Guide to CML Molecular Biology Diagnosis Stem Cell Transplant Monitoring New Drugs Questions to Ask and More cure C a n c e r U p d at e s, R e s e a r c h & E d u c at i o n Based on science,

More information

LYMPHOMA. BACHIR ALOBEID, M.D. HEMATOPATHOLOGY DIVISION PATHOLOGY DEPARTMENT Columbia University/ College of Physicians & Surgeons

LYMPHOMA. BACHIR ALOBEID, M.D. HEMATOPATHOLOGY DIVISION PATHOLOGY DEPARTMENT Columbia University/ College of Physicians & Surgeons LYMPHOMA BACHIR ALOBEID, M.D. HEMATOPATHOLOGY DIVISION PATHOLOGY DEPARTMENT Columbia University/ College of Physicians & Surgeons Normal development of lymphocytes Lymphocyte proliferation and differentiation:

More information

Uses of Flow Cytometry

Uses of Flow Cytometry Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7

More information

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives

Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Dirk.Repsilber@oru.se 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför

More information

亞 東 紀 念 醫 院 Follicular Lymphoma 臨 床 指 引

亞 東 紀 念 醫 院 Follicular Lymphoma 臨 床 指 引 前 言 : 惡 性 淋 巴 瘤 ( 或 簡 稱 淋 巴 癌 ) 乃 由 體 內 淋 巴 系 統 包 括 淋 巴 細 胞 淋 巴 管 淋 巴 腺 及 一 些 淋 巴 器 官 或 組 織 如 脾 臟 胸 腺 及 扁 桃 腺 等 所 長 出 的 惡 性 腫 瘤 依 腫 瘤 病 理 組 織 型 態 的 不 同 可 分 為 何 杰 金 氏 淋 巴 瘤 (Hodgkin s disease) 與 非 何 杰 金

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Cytoreductive Therapy for Autologous Cell Therapy in HIV

Cytoreductive Therapy for Autologous Cell Therapy in HIV Cytoreductive Therapy for Autologous Cell Therapy in HIV Ronald Mitsuyasu, MD Professor of Medicine UCLA Center for Clinical AIDS Research and Education (CARE Center) HSC Transfer from CCR5-delta 32 Donor

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Hematopoietic Stem-Cell Transplantation for CLL and SLL File Name: Origination: Last CAP Review: Next CAP Review: Last Review: hematopoietic_stem-cell_transplantation_for_cll_and_sll

More information

SWOG ONCOLOGY RESEARCH PROFESSIONAL (ORP) MANUAL VOLUME I RESPONSE ASSESSMENT LEUKEMIA CHAPTER 11A REVISED: OCTOBER 2015

SWOG ONCOLOGY RESEARCH PROFESSIONAL (ORP) MANUAL VOLUME I RESPONSE ASSESSMENT LEUKEMIA CHAPTER 11A REVISED: OCTOBER 2015 LEUKEMIA Response in Acute Myeloid Leukemia (AML) Response criteria in Acute Myeloid Leukemia for SWOG protocols is based on the review article Diagnosis and management of acute myeloid leukemia in adults:

More information

Course Curriculum for Master Degree in Medical Laboratory Sciences/Hematology and Blood Banking

Course Curriculum for Master Degree in Medical Laboratory Sciences/Hematology and Blood Banking Course Curriculum for Master Degree in Medical Laboratory Sciences/Hematology and Blood Banking The Master Degree in Medical Laboratory Sciences /Hematology & Blood Banking, is awarded by the Faculty of

More information

PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA PROGNOSIS IN ACUTE MYELOID LEUKEMIA

PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA PROGNOSIS IN ACUTE MYELOID LEUKEMIA PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA UNFAVORABLE Advanced age High leukocyte count at diagnosis Presence of myeloid antigens Late achievement of CR Chromosomal abnormalities: t(9:22)(q34:q11) t(4;11)(q21;q23)

More information

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine

More information

Bone Marrow/Stem Cell Transplant

Bone Marrow/Stem Cell Transplant Blue Distinction Centers for Transplants Program Selection Criteria for 2010 Mid-Point Designations To qualify as a Blue Distinction Center for Transplants (), each facility must satisfy s quality based

More information

What we will discuss today

What we will discuss today Umbilical cord blood banking It s Utility? Dr. Nita Radhakrishnan Pediatric Hematology Oncology Unit, Sir Ganga Ram Hospital, New Delhi What we will discuss today What are stem cells? What are the sources

More information

Disclosures. I have no disclosures.

Disclosures. I have no disclosures. Not Your Own Marrow Jenni Krajewski, MD Clinical Assistant Professor, Rutgers New Jersey Medical School Attending Physician, Pediatric Blood and Marrow Transplantation The Institute for Pediatric Cancer

More information

Chronic Lymphocytic Leukemia. Case Study. AAIM Triennial October 2012 Susan Sokoloski, M.D.

Chronic Lymphocytic Leukemia. Case Study. AAIM Triennial October 2012 Susan Sokoloski, M.D. Chronic Lymphocytic Leukemia AAIM Triennial October 2012 Susan Sokoloski, M.D. Case Study 57 year old male, trial application for $1,000,000 Universal Life coverage Cover letter from sales agent indicates

More information

Acute Lymphoblastic Leukemia (Adult) Including Lymphoblastic lymphoma

Acute Lymphoblastic Leukemia (Adult) Including Lymphoblastic lymphoma Acute Lymphoblastic Leukemia (Adult) Including Lymphoblastic lymphoma Updated April 2008 by Dr. Richard Wells* Updates: Minor changes only Introduction Acute lymphocytic leukemia (ALL) is a relatively

More information

A Career in Pediatric Hematology-Oncology? Think About It...

A Career in Pediatric Hematology-Oncology? Think About It... A Career in Pediatric Hematology-Oncology? Think About It... What does a pediatric hematologist-oncologist do? What kind of training is necessary? Is there a future need for specialists in this area? T

More information

Allogeneic stem cell transplant in HIV-1-infected individuals

Allogeneic stem cell transplant in HIV-1-infected individuals Allogeneic stem cell transplant in HIV-1-infected individuals Javier Martinez-Picado UNIVERSITAT DE VIC Barriers to cure HIV infection Residual Replication Immune activation Inflammation Latent Infection

More information

UC Davis Institute for Regenerative Cures A facility supported by the California Institute for Regenerative Medicine

UC Davis Institute for Regenerative Cures A facility supported by the California Institute for Regenerative Medicine UC Davis Institute for Regenerative Cures A facility supported by the California Institute for Regenerative Medicine Naming Opportunities Opportunity No. Description/Features Gift Amount Institute for

More information

Long Term Low Dose Maintenance Chemotherapy in the Treatment of Acute Myeloid Leukemia

Long Term Low Dose Maintenance Chemotherapy in the Treatment of Acute Myeloid Leukemia Long Term Low Dose Chemotherapy in the Treatment of Acute Myeloid Leukemia Murat TOMBULO LU*, Seçkin ÇA IRGAN* * Department of Hematology, Faculty of Medicine, Ege University, zmir, TURKEY ABSTRACT In

More information

ACUTE MYELOID LEUKEMIA (AML),

ACUTE MYELOID LEUKEMIA (AML), 1 ACUTE MYELOID LEUKEMIA (AML), ALSO KNOWN AS ACUTE MYELOGENOUS LEUKEMIA WHAT IS CANCER? The body is made up of hundreds of millions of living cells. Normal body cells grow, divide, and die in an orderly

More information

Estimated New Cases of Leukemia, Lymphoma, Myeloma 2014

Estimated New Cases of Leukemia, Lymphoma, Myeloma 2014 ABOUT BLOOD CANCERS Leukemia, Hodgkin lymphoma (HL), non-hodgkin lymphoma (NHL), myeloma, myelodysplastic syndromes (MDS) and myeloproliferative neoplasms (MPNs) are types of cancer that can affect the

More information

Types, production of antibodies and Antibody/antigen interaction

Types, production of antibodies and Antibody/antigen interaction Types, production of antibodies and Antibody/antigen interaction Antibodies Secreted by B lymphocytes Great diversity and specificity: >109 different antibodies; can distinguish between very similar molecules

More information

Investigation of B cell malignancies. Dr. Joanna Sheldon Protein Reference Unit St. George s s Hospital

Investigation of B cell malignancies. Dr. Joanna Sheldon Protein Reference Unit St. George s s Hospital Investigation of B cell malignancies Dr. Joanna Sheldon Protein Reference Unit St. George s s Hospital The B cell progression from «Pluripotent stem cell «Lymphoid committed stem cell «B lineage committed

More information

Relative Risk (Sokal & Hasford): Relationship with Treatment Results. Michele Baccarani

Relative Risk (Sokal & Hasford): Relationship with Treatment Results. Michele Baccarani Relative Risk (Sokal & Hasford): Relationship with Treatment Results Michele Baccarani European LeukemiaNet EVOLVING CONCEPTS IN THE MANAGEMENT OF CHRONIC MYELOID LEUKEMIA VENICE 8 9 MAY 2006 Disease risk

More information

Update in Hematology Oncology Targeted Therapies. Mark Holguin

Update in Hematology Oncology Targeted Therapies. Mark Holguin Update in Hematology Oncology Targeted Therapies Mark Holguin 25 years ago Why I chose oncology People How to help people with possibly the most difficult thing they may have to deal with Science Turning

More information

chronic leukemia lymphoma myeloma differentiated 14 September 1999 Pre- Transformed Ig Surface Surface Secreted Myeloma Major malignant counterpart

chronic leukemia lymphoma myeloma differentiated 14 September 1999 Pre- Transformed Ig Surface Surface Secreted Myeloma Major malignant counterpart Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated Pre- B-cell B-cell Transformed B-cell Plasma cell Ig Surface Surface Secreted Major malignant counterpart

More information

Multiple Myeloma Workshop- Tandem 2014

Multiple Myeloma Workshop- Tandem 2014 Multiple Myeloma Workshop- Tandem 2014 1) Review of Plasma Cell Disorders Asymptomatic (smoldering) myeloma M-protein in serum at myeloma levels (>3g/dL); and/or 10% or more clonal plasma cells in bone

More information

CAR T cell therapy for lymphomas

CAR T cell therapy for lymphomas CAR T cell therapy for lymphomas Sattva S. Neelapu, MD Associate Professor and Deputy Chair ad interim Department of Lymphoma and Myeloma UT MD Anderson Cancer Center, Houston, TX CAR T cell therapy What

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Multiple Myeloma Patient s Booklet

Multiple Myeloma Patient s Booklet 1E Kent Ridge Road NUHS Tower Block, Level 7 Singapore 119228 Email : ncis@nuhs.edu.sg Website : www.ncis.com.sg LIKE US ON FACEBOOK www.facebook.com/ nationaluniversitycancerinstitutesingapore Multiple

More information

Clinical Significance of Minimal Residual Disease in Leukemia and Lymphoma I

Clinical Significance of Minimal Residual Disease in Leukemia and Lymphoma I Clinical Significance of Minimal Residual Disease in Leukemia and Lymphoma I Dario Campana Departments of Oncology and Pathology St. Jude Children s Research Hospital Minimal Residual Disease - Rationale

More information

Master of Science in Biomedical Sciences

Master of Science in Biomedical Sciences Master of Science in Biomedical Sciences Faculty of Medicine Good health is our greatest treasure. Understanding the human body, healthy and diseased, is the stepping stone to finding tools to improving

More information

Analysis of Illumina Gene Expression Microarray Data

Analysis of Illumina Gene Expression Microarray Data Analysis of Illumina Gene Expression Microarray Data Asta Laiho, Msc. Tech. Bioinformatics research engineer The Finnish DNA Microarray Centre Turku Centre for Biotechnology, Finland The Finnish DNA Microarray

More information

The use of monoclonal antibodies in the setting of HSCT

The use of monoclonal antibodies in the setting of HSCT The use of monoclonal antibodies in the setting of HSCT S Montoto, Barts Cancer Institute, London, UK Geneva 3/April/2012 www.ebmt.org Some definitions of interest: Ab and Ag Antibody (Ab)=Immunoglobulin

More information

Treatment Recommendations for People Living with CML

Treatment Recommendations for People Living with CML Treatment Recommendations for People Living with CML Foreword by CML Workgroup Chronic myeloid leukaemia (CML) is a disease of the blood and bone marrow that results when there is a cancerous transformation

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

IBGRL, NHSBT, Bristol

IBGRL, NHSBT, Bristol IBGRL, NHSBT, Bristol Valuable to know D type of fetus Fetus D-positive: at risk pregnancy should be managed appropriately Fetus D-negative: not at risk no need for intervention RHD RHCE RHD* D 37 bp

More information

information for payers and referrers

information for payers and referrers a d u lt s t e m c e l l t r a n s p l a n tat i o n p r o g r a m information for payers and referrers Spring 2014 For more information, visit www.dfbwcc.org/bmt. o u r expertise Since its founding in

More information

Chapter 2. S. Hovenga 1, J.Th.M. de Wolf 1, J.E.J. Guikema 4, H. Klip 2, J.W. Smit 3, C.Th. Smit Sibinga 5, N.A. Bos 4, E.

Chapter 2. S. Hovenga 1, J.Th.M. de Wolf 1, J.E.J. Guikema 4, H. Klip 2, J.W. Smit 3, C.Th. Smit Sibinga 5, N.A. Bos 4, E. Chapter 2 Autologous stem cell transplantation in multiple myeloma after VAD and EDAP courses; a high incidence of oligoclonal serum immunoglobulins post transplantation S. Hovenga, J.Th.M. de Wolf, J.E.J.

More information

Technical requirements for MRD analysis in myeloma: past, present and future

Technical requirements for MRD analysis in myeloma: past, present and future Technical requirements for MRD analysis in myeloma: past, present and future Andy C. Rawstron HMDS St. James s Institute for Oncology Leeds Teaching Hospitals NHS Trust Disclosures: Honoria/travel support:

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

About B Cell Lymphomas Groupmeeting Klipp/Spang, December 09 2002 Dennis Kostka Max-Planck-Institute for Molecular Genetics Computational Molecular Biology Berlin 1 Overview Short History of Lymphoma Classification

More information

6th edi(on Highlights from EHA Leucemia acuta linfoblas6ca

6th edi(on Highlights from EHA Leucemia acuta linfoblas6ca 6th edi(on Highlights from EHA Leucemia acuta linfoblas6ca HOT QUESTIONS ü Which Biomarkers in ALL? ü Will NGS be the future standard for MRD? ü Which are the most promising new drugs in ALL? ü What about

More information

Cancer Immunotherapy: Can Your Immune System Cure Cancer? Steve Emerson, MD, PhD Herbert Irving Comprehensive Cancer Center

Cancer Immunotherapy: Can Your Immune System Cure Cancer? Steve Emerson, MD, PhD Herbert Irving Comprehensive Cancer Center Cancer Immunotherapy: Can Your Immune System Cure Cancer? Steve Emerson, MD, PhD Herbert Irving Comprehensive Cancer Center Bodnar s Law Simple Things are Important Very Simple Things are Very Important

More information

Subtypes of AML follow branches of myeloid development, making the FAB classificaoon relaovely simple to understand.

Subtypes of AML follow branches of myeloid development, making the FAB classificaoon relaovely simple to understand. 1 2 3 4 The FAB assigns a cut off of 30% blasts to define AML and relies predominantly on morphology and cytochemical stains (MPO, Sudan Black, and NSE which will be discussed later). Subtypes of AML follow

More information

Response Definition, Evaluation and Monitoring. Michele Baccarani

Response Definition, Evaluation and Monitoring. Michele Baccarani Response Definition, Evaluation and Monitoring Michele Baccarani European LeukemiaNet EVOLVING CONCEPTS IN THE MANAGEMENT OF CHRONIC MYELOID LEUKEMIA VENICE 8 9 MAY 2006 Response definition, evaluation

More information

Emerging New Prognostic Scoring Systems in Myelodysplastic Syndromes 2012

Emerging New Prognostic Scoring Systems in Myelodysplastic Syndromes 2012 Emerging New Prognostic Scoring Systems in Myelodysplastic Syndromes 2012 Arjan A. van de Loosdrecht, MD, PhD Department of Hematology VU University Medical Center VU-Institute of Cancer and Immunology

More information

Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry

Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry The Master Degree in Medical Laboratory Sciences /Clinical Biochemistry, is awarded by the Faculty of Graduate Studies

More information

Circulating clonotypic B-cells in multiple myeloma and monoclonal gammopathy of undetermined significance

Circulating clonotypic B-cells in multiple myeloma and monoclonal gammopathy of undetermined significance Published Ahead of Print on July 19, 2013, as doi:10.3324/haematol.2013.092817. Copyright 2013 Ferrata Storti Foundation. Early Release Paper Circulating clonotypic B-cells in multiple myeloma and monoclonal

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information