MRD in ALL (pa,ent specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2011 Marleen Bakkus
|
|
- Meghan Nash
- 8 years ago
- Views:
Transcription
1 MRD in ALL (pa,ent specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2011 Marleen Bakkus
2 Cellular origin of B/T- cell malignancies Myeloid stem cell B-lymphocytes Stem cell precursor cells lymphoid stem cell T-lymphocytes Bone marrow Thymus Blood Lymphnode Bone marrow
3 MRD in ALL genezing
4 Which genes for MRD? Immunoglobulin (Ig) T-cell receptor (TCR)
5 More diversity junc,onal regions VH3-21 DH3-3 JH4-1 Cµ Junctional region VH3-21(germline) insertion DH3-3 (germline) insertion JH4-1(germline) TGTATTACTGTGCGAGA! GTATTACGATTTTTGGAGTGGTTATTATACC! ACTACTTTGACTACT! TGTATTACTGT AGGC CGATTTTTGGAGTGGTTATTATA GTCCA TGACTACT! TGTATTACTGTGCG TATCCGGA TTACGATTTTTGGAGTGGTTATTATAC CGATCG CTTTGACTACT! TGTATTACTGTGC CCGGACTG TTTTGGAGTGGTTATTATACC GGT ACTACTTTGACTACT! TGTATTACTGTGCGAG CTGAGTC TATTACGATTTTTGGAGTGGTTAT CGTAGCGTA TTTGACTACT! TGTATTACTG ACATCGA CGATTTTTGGAGTGGTTATTATA CGTAG ACTTTGACTACT! TGTATTACTGTGCG CGT TACGATTTTTGGAGTGGTTATTAT GGCTAAGG TGACTACT! TGTATTACTGTGC TTTGGAGTGGTTAT CC ACTTTGACTACT! TGTATTACTGTGCGAGA GGCTAG ATTACGATTTTTGGAGTGGTTATACC GTCGA GACTACT! TGTATTACTGTG GTCCAG TATTACGATTTTTGGAGTG CCGTAG CTACTTTGACTACT! TGTATTA CCGGA CGATTTTTGGAGTGGTTATTATA C ACT!
6 Primary repertoire diversity of human Ig and TCR molecules TCRαβ TCRγδ IgH Igκ Igλ TCRα TCRβ TCRγ TCRδ Number of genes - V genes >100 >50 >40 >50 > D genes J genes Combina,on diversity >5x10 6 >5x10 6 >5000 Junc,onal region diversity ++ +/- +/ Es#ma#on of total primary receptor repertoire >10 12 >10 12 >10 12
7 Frequency of TCR and Ig in childhood ALL B- lineage ALL T- lineage ALL IgH >95% 20-25% (~DH- JH) Igκ Igλ ~65% (~Kde) 15-20% TCRβ ~35% ~90% TCRγ ~55% ~95% TCRδ ~40% ~55% Vδ2- Jα29 ~40-45% Ref.: J.J.M. van Dongen en V.H.J. van der Velden: Detection of minimal residual disease in ALL
8 Genomic DNA TCR Gamma V N J TCR delta V N D PCR VH-CDR3 V N-D-N J DIAGNOSIS 125 bp Sequencing of the N-region Clono (N)-specific oligonucleotidic (ASO) probe/primer MRD Allele-specific real-time PCR PCR Genomic DNA <0.1%
9 Target iden,fica,on Diagnosis: Bone marrow sample DNA extrac,on PCR for IGH IGK TCRG TCRD TCRB (only in T- ALL) Sil- Tal (only in T- ALL)
10 Sequence targets PAGE Purify clonal band Sequence with forward and reverse primers
11 Sequence analysis and ASO design ASO-primer 2 IGHV3-64*05 (-6) N1 IGHD2-2*01 (-5, -13) N2 ASO-primer 1 IGHJ1 (-0) hardcopy
12 ASO design OLIGO soeware Tm: C Avoid stretches of more than 3 G s and C s in the last 5 bases Avoid dimer forma,on
13 ASO- primers in RQ- PCR IgH TCRδ VH DH JH V δ 2 D δ 3 n=3 n=6 n=1 n=1 TCRγ Igκ V γ J γ Vκ Kde n=1 n=2 n=1 n=1 ASO junctional region Probe Consensus primer Ref: Verhagen et al., Leukemia 2000, Van der Velden et al. Leukemia 2002
14 Temperature gradient 60 C 63 C 65 C Vg9 Patient 10-2 Healthy controls
15 Temperature gradient 60 C 63 C 65 C IgH VH2
16 Quan,fica,on of FU samples qaso-pcr FU1 FU2 Quantitative range: 10-4 Sensitivity: 10-5 FU3 FU2 FU1 FU1: 0,04% FU2: positive, not-quantifiable FU3: negative
17 Control gene Albumin Standard: commercial DNA
18 Ref: VHJ van der Velden, 2007, Leukemia
19 European Study Group on MRD detec,on in ALL (ESG- MRD- ALL; 32 laboratories in 17 countries) DCLSG Interfant ALL9 99 MRC- ALL 97/99 UKALL-R3 COALL FRALLE 2000 EORTC- CLG BFM- AIEOP ALL-2000 ESG MRD ALL NOPHO ALL-2000 R e l a p s e d A L L A L L - R E Z B F M 2002 adult ALL GMALL 06/99 adult ALL LALA 2000 (pre-)bmt ALL adult ALL UKALL XII adult ALL PETHEMA/ GETH Europe Stockholm Israel Singapore Glasgow Leeds Sheffield Kiel London Amsterdam Hamburg Bristol Lille Paris Rotterdam Brussel Copenhague Hannover Berlin Frankfurt Heidelberg Zurich Prague Vienna Petach Tikwa Australia Singapore Padova Monza Salamanca Sydney
20 EORTC- CLG (France, Belgium) EFS % MRD < MRD > 10-2 VHR Overall Logrank test: p< (years) O N Number of patients at risk : MRD < 10-2 MRD > 10-2 Cavé et al., NEJM 1998
21 EORTC- CLG MRD VLR R Ia-D Ia-P + R Ib no aspa Ib aspa interval IIa 4/8 maintenance If 10-2 vhr AR low R IA D IA P + R IB no aspa IBaspa interval IIA 4/8 R maintenance maintenance + pulse If 10-2 vhr AR high R IA D IA P + R IB no aspa IB aspa interval IIA 4/8 R mt mt+pulse If 10-2 vhr R1 R2 R3 R1 R2 R3 VHR R IA D IB vanda 3xHD MTX maintenance IA P BMT-MSD * W
22 Avoiding AlloSCT 3 y QR: , sensitivity:
23 Earlier predic,on of relapse QR: , sensitivity
24 Why qaso- PCR More sensi,ve than genescan Later,mepoints can be tested Beter predic,on of relapse Preven,on of over treatment Very standardised, possibility to compare with other ALL trials
25 Future Pa,ents will be stra,fied according to their early molecular response to treatment in future clinical protocols. The good responders might be cured using a less aggressive chemotherapeu,c regimen, avoiding side effects and therapy related long term toxici,es. In contrast, poor responders will need more intensive but also more toxic approaches including allogeneic stem cell transplanta,on.
26 Antwerpen, Koningin Paola Kinderziekenhuis (Dr. P. Maes) Brussel, UZ Brussel (Dr. J. Otten, Dr. A. van Damme/Dr. J. van der Werff ten Bosch) Brussel, HUDE Reine Fabiola (Dr. A. Ferster) Brussel, UCL Saint Luc (Dr. C. Vermylen) Gent, UZ Gent (Dr. Y. Benoit) Leuven, Gasthuisberg Leuven (Dr. A. Uyttenbroeck) Luik, Hopital Citadelle Liege (Dr. M-F. Dresse/ Dr. C. Hoyoux) Montegnee, C.H. St. Joseph Esperance (Dr. P.Philippet/ Dr. N. Francotte)
27 Molecular- Hematology lab
Minimal residual disease in childhood ALL (patient specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2013 Marleen Bakkus
Minimal residual disease in childhood ALL (patient specific Ig/TCR PCR) Molecular Biology and Cytometry Course Mol: 2013 Marleen Bakkus Survival of childhood cancer patients Major challenges Treatments
More informationGenomic Analysis of Mature B-cell Malignancies
Genomic Analysis of Mature B-cell Malignancies Update and Lessons Learned Omar Abdel-Wahab, MD Memorial Sloan Kettering Cancer Center Human Oncology and Pathogenesis Program and Leukemia Service Disclaimer:
More informationSommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of
More informationChronic lymphocytic EBMT Slideleukemia. University of Heidelberg, Germany March 22, 2010. The European Group for Blood and Marrow Transplantation
Chronic lymphocytic EBMT Slideleukemia template Peter Barcelona Dreger Chairman, CLL 7 February subcommittee 2008 University of Heidelberg, Germany March 22, 2010 The European Group for Blood and Marrow
More informationJACIE in Belgium. Ivan Van Riet. National Jacie representative Ivan.vanriet@uzbrussel.be
JACIE in Belgium Ivan Van Riet National Jacie representative Ivan.vanriet@uzbrussel.be National JACIE meeting day 24 January 2013 Stem cell transplantation programme Collection Processing Transplantation
More informationFastTest. You ve read the book... ... now test yourself
FastTest You ve read the book...... now test yourself To ensure you have learned the key points that will improve your patient care, read the authors questions below. Please refer back to relevant sections
More informationspecific B cells Humoral immunity lymphocytes antibodies B cells bone marrow Cell-mediated immunity: T cells antibodies proteins
Adaptive Immunity Chapter 17: Adaptive (specific) Immunity Bio 139 Dr. Amy Rogers Host defenses that are specific to a particular infectious agent Can be innate or genetic for humans as a group: most microbes
More informationPro Cure in Multiple Myeloma. Nicolaus Kröger Dept. of Stem Cell Transplantation University Hospital Hamburg Hamburg, Germany
Pro Cure in Multiple Myeloma Nicolaus Kröger Dept. of Stem Cell Transplantation University Hospital Hamburg Hamburg, Germany Pro Cure in Multiple Myeloma Several hematological malignancies can be cured
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationTreating Minimal Residual Disease in Acute Leukemias: How low should you go?
Treating Minimal Residual Disease in Acute Leukemias: How low should you go? Ramsie Lujan, Pharm.D. PGY1 Pharmacy Practice Resident Methodist Hospital, San Antonio, Texas Pharmacotherapy Education and
More informationUNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and
UNDERSTANDING MULTIPLE MYELOMA AND LABORATORY VALUES Benjamin Parsons, DO bmparson@gundersenhealth.org Gundersen Health System Center for Cancer and Blood Disorders La Crosse, WI UNDERSTANDING MULTIPLE
More informationBHS COMMITTEES MEETING 30 January 2014
BHS COMMITTEES MEETING 30 January 2014 Regulatory affairs JACIE Ivan Van Riet Ivan.vanriet@uzbrussel.be Scopes Supporting implementation of JACIE standards in national SCT centres with the aim to obtain
More informationPROGRAMMA / PROGRAM. Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol
Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol PROGRAMMA / PROGRAM Molecular Biology and Cytometry Course 16 th -17 th May 2013, SCK CEN, Mol MB&C course MOL 2013 programma / program
More informationWhy discuss CLL? Common: 40% of US leukaemia. approx 100 pa in SJH / MWHB 3 inpatients in SJH at any time
Why discuss CLL? Common: 40% of US leukaemia approx 100 pa in SJH / MWHB 3 inpatients in SJH at any time Median age of dx is 65 (30s. Incurable, survival 2-202 20 years Require ongoing supportive care
More informationHodgkin Lymphoma Disease Specific Biology and Treatment Options. John Kuruvilla
Hodgkin Lymphoma Disease Specific Biology and Treatment Options John Kuruvilla My Disclaimer This is where I work Objectives Pathobiology what makes HL different Diagnosis Staging Treatment Philosophy
More informationBelgium Ghent University, Ghent Rigshospitalet, Copenhagen. Denmark. Germany UniversitätKlinikum, Essen Heidelberg University Hospital, Heidelberg
We are ready to actively participate in the development of innovative therapies that will improve the cure rate and quality of life of children with cancer. Created in 2003, ITCC is a consortium of 49
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationStem Cell Transplantation for Acute Lymphoblastic Leukemia
Stem Cell Transplantation for Acute Lymphoblastic Leukemia Mona Shafey MD, FRCPC Bone Marrow Transplant Fellow Alberta Blood and Marrow Transplant Program 1 of 14 Stem Cell Transplantation for Acute Lymphoblastic
More informationLEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials
LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational
More informationINSERM/ A. Bernheim. Overcoming clinical relapse in multiple myeloma by understanding and targeting the molecular causes of drug resistance
A. Bernheim Overcoming clinical relapse in multiple myeloma by understanding and targeting the molecular causes of drug resistance OVER-MyR is funded by the European Commission within its FP7 specific
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationA Time Line Of Chronic Myeloid Leukemia
Chronic Myeloid Leukemia in 2011 An Update on Treatment and Monitoring Michael Deininger MD PhD Chief, Division of Hematology and Hematologic Malignancies M. M. Wintrobe Professor of Medicine A Time Line
More informationThe immune system. Bone marrow. Thymus. Spleen. Bone marrow. NK cell. B-cell. T-cell. Basophil Neutrophil. Eosinophil. Myeloid progenitor
The immune system Basophil Neutrophil Bone marrow Eosinophil Myeloid progenitor Dendritic cell Pluripotent Stem cell Lymphoid progenitor Platelets Bone marrow Thymus NK cell T-cell B-cell Spleen Cancer
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationIMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
More informationtreatments) worked by killing cancerous cells using chemo or radiotherapy. While these techniques can
Shristi Pandey Genomics and Medicine Winter 2011 Prof. Doug Brutlag Chronic Myeloid Leukemia: A look into how genomics is changing the way we treat Cancer. Until the late 1990s, nearly all treatment methods
More informationInteresting Case Review. Renuka Agrawal, MD Dept. of Pathology City of Hope National Medical Center Duarte, CA
Interesting Case Review Renuka Agrawal, MD Dept. of Pathology City of Hope National Medical Center Duarte, CA History 63 y/o male with h/o CLL for 10 years Presents with worsening renal function and hypercalcemia
More informationPulling the Plug on Cancer Cell Communication. Stephen M. Ansell, MD, PhD Mayo Clinic
Pulling the Plug on Cancer Cell Communication Stephen M. Ansell, MD, PhD Mayo Clinic Why do Waldenstrom s cells need to communicate? Waldenstrom s cells need activating signals to stay alive. WM cells
More informationUmbilical Cord Blood Transplantation
Umbilical Cord Blood Transplantation V Rocha MD, PhD Hopital Saint Louis, Paris University 7 CIBMTR Milwaukee Umbilical Cord blood transplantation Background History Clinical results in children and adults
More informationNovità dall EHA >> [ Leucemia linfatica cronica ]
Novità dall EHA >> [ Leucemia linfatica cronica ] Relatore: P. GHIA 27-28 ottobre 2008 Borgo S. Luigi Monteriggioni (Siena) Leucemia linfatica cronica - Copyright FSE 1 Number and type of abstracts 2 Number
More informationPediatric Ph + ALL. Andrea Biondi, MD on behalf of the I-BFM EsPhALL group
The EsPhALL experience for the treatment t t of Pediatric Ph + ALL Andrea Biondi, MD on behalf of the I-BFM EsPhALL group Clinica Pediatrica, Centro M.Tettamanti and Dipartimento di Scienze della Salute,
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationIntroduction. About 10,500 new cases of acute myelogenous leukemia are diagnosed each
Introduction 1.1 Introduction: About 10,500 new cases of acute myelogenous leukemia are diagnosed each year in the United States (Hope et al., 2003). Acute myelogenous leukemia has several names, including
More informationOverview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development
Overview B cell development Transcriptional cascades Amazing aspects of lineage plasticity Conventional (B2) B cell development What happens to an autoreactive B cell? B1 vs B2 cells Key anatomical sites
More informationCytogenetics for the Rest of Us: A Primer
Cytogenetics for the Rest of Us: A Primer James J. Stark, MD, FACP Medical Director Cancer Program Maryview Medical Center Diane Maia, M.D. Pathologist, Bon Secours Hampton Roads Case #1 78 y.o. lady seen
More informationMolecular Biology: Measuring and Reporting BCR-ABL Transcripts Level. Giuseppe Saglio
Molecular Biology: Measuring and Reporting BCR-ABL Transcripts Level Giuseppe Saglio 1 st Question to be addressed Why is it so important to measure BCR- ABL transcript levels in the follow-up of CML patients
More informationLauren Berger: Why is it so important for patients to get an accurate diagnosis of their blood cancer subtype?
Hello, I m Lauren Berger and I m the Senior Director of Patient Services Programs at The Leukemia & Lymphoma Society. I m pleased to welcome Dr. Rebecca Elstrom. Dr. Elstrom is an Assistant Professor in
More informationTCRG TCRA/D IGH IGK/L
Assays immunoseq Assay The inquiry to insight solution for profiling T- and B-cell s Immunosequencing solutions for multiple species and loci Illuminate the adaptive immune system with bias-controlled
More informationMultiple Myeloma and Colorectal Cancer
Multiple Myeloma and Colorectal Cancer From Systems Immunology to Single Cells Leo Hansmann Mark M. Davis Lab Department of Microbiology&Immunology Stanford University Multiple Myeloma Monoclonal disease
More informationMolecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
More informationA Cure for Sickle Cell Anemia and Thalassemia
IV Simpósio Internacional de Hemoglobinopatias A Cure for Sickle Cell Anemia and Thalassemia Bertram Lubin, MD and Mark Walters, MD 4 September 2007 Topics to be covered Cord blood: Importance and biology
More informationCorporate Medical Policy Genetic Testing for Fanconi Anemia
Corporate Medical Policy Genetic Testing for Fanconi Anemia File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_fanconi_anemia 03/2015 3/2016 3/2017 3/2016 Description
More informationRNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
More informationSepax. your child s cord blood is in safe hands. World leader in adult stem cell processing
Sepax your child s cord blood is in safe hands World leader in adult stem cell processing Biosafe Experience Credibility Innovation Dear Customer, Innovation in cell processing is our credo and this is
More informationOutline of thesis and future perspectives.
Outline of thesis and future perspectives. This thesis is divided into two different sections. The B- section involves reviews and studies on B- cell non- Hodgkin lymphoma [NHL] and radioimmunotherapy
More informationShaji Kumar, M.D. Multiple Myeloma: Multiple myeloma (MM) is the second most common hematological
An update on the management of multiple myeloma and amyloidosis Shaji Kumar, M.D. Multiple Myeloma: Multiple myeloma (MM) is the second most common hematological malignancy in this country affecting nearly
More informationMolecular diagnostics is now used for a wide range of applications, including:
Molecular Diagnostics: A Dynamic and Rapidly Broadening Market Molecular diagnostics is now used for a wide range of applications, including: Human clinical molecular diagnostic testing Veterinary molecular
More informationMalignant Lymphomas and Plasma Cell Myeloma
Malignant Lymphomas and Plasma Cell Myeloma Dr. Bruce F. Burns Dept. of Pathology and Lab Medicine Overview definitions - lymphoma lymphoproliferative disorder plasma cell myeloma pathogenesis - translocations
More informationCML. cure. A Patient s Guide. Molecular Biology Diagnosis Stem Cell Transplant Monitoring New Drugs Questions to Ask and More
A Patient s Guide to CML Molecular Biology Diagnosis Stem Cell Transplant Monitoring New Drugs Questions to Ask and More cure C a n c e r U p d at e s, R e s e a r c h & E d u c at i o n Based on science,
More informationLYMPHOMA. BACHIR ALOBEID, M.D. HEMATOPATHOLOGY DIVISION PATHOLOGY DEPARTMENT Columbia University/ College of Physicians & Surgeons
LYMPHOMA BACHIR ALOBEID, M.D. HEMATOPATHOLOGY DIVISION PATHOLOGY DEPARTMENT Columbia University/ College of Physicians & Surgeons Normal development of lymphocytes Lymphocyte proliferation and differentiation:
More informationUses of Flow Cytometry
Uses of Flow Cytometry 1. Multicolour analysis... 2 2. Cell Cycle and Proliferation... 3 a. Analysis of Cellular DNA Content... 4 b. Cell Proliferation Assays... 5 3. Immunology... 6 4. Apoptosis... 7
More informationVad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives
Vad är bioinformatik och varför behöver vi det i vården? a bioinformatician's perspectives Dirk.Repsilber@oru.se 2015-05-21 Functional Bioinformatics, Örebro University Vad är bioinformatik och varför
More information亞 東 紀 念 醫 院 Follicular Lymphoma 臨 床 指 引
前 言 : 惡 性 淋 巴 瘤 ( 或 簡 稱 淋 巴 癌 ) 乃 由 體 內 淋 巴 系 統 包 括 淋 巴 細 胞 淋 巴 管 淋 巴 腺 及 一 些 淋 巴 器 官 或 組 織 如 脾 臟 胸 腺 及 扁 桃 腺 等 所 長 出 的 惡 性 腫 瘤 依 腫 瘤 病 理 組 織 型 態 的 不 同 可 分 為 何 杰 金 氏 淋 巴 瘤 (Hodgkin s disease) 與 非 何 杰 金
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationCytoreductive Therapy for Autologous Cell Therapy in HIV
Cytoreductive Therapy for Autologous Cell Therapy in HIV Ronald Mitsuyasu, MD Professor of Medicine UCLA Center for Clinical AIDS Research and Education (CARE Center) HSC Transfer from CCR5-delta 32 Donor
More informationCorporate Medical Policy
Corporate Medical Policy Hematopoietic Stem-Cell Transplantation for CLL and SLL File Name: Origination: Last CAP Review: Next CAP Review: Last Review: hematopoietic_stem-cell_transplantation_for_cll_and_sll
More informationSWOG ONCOLOGY RESEARCH PROFESSIONAL (ORP) MANUAL VOLUME I RESPONSE ASSESSMENT LEUKEMIA CHAPTER 11A REVISED: OCTOBER 2015
LEUKEMIA Response in Acute Myeloid Leukemia (AML) Response criteria in Acute Myeloid Leukemia for SWOG protocols is based on the review article Diagnosis and management of acute myeloid leukemia in adults:
More informationCourse Curriculum for Master Degree in Medical Laboratory Sciences/Hematology and Blood Banking
Course Curriculum for Master Degree in Medical Laboratory Sciences/Hematology and Blood Banking The Master Degree in Medical Laboratory Sciences /Hematology & Blood Banking, is awarded by the Faculty of
More informationPROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA PROGNOSIS IN ACUTE MYELOID LEUKEMIA
PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA UNFAVORABLE Advanced age High leukocyte count at diagnosis Presence of myeloid antigens Late achievement of CR Chromosomal abnormalities: t(9:22)(q34:q11) t(4;11)(q21;q23)
More informationEffects of Herceptin on circulating tumor cells in HER2 positive early breast cancer
Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine
More informationBone Marrow/Stem Cell Transplant
Blue Distinction Centers for Transplants Program Selection Criteria for 2010 Mid-Point Designations To qualify as a Blue Distinction Center for Transplants (), each facility must satisfy s quality based
More informationWhat we will discuss today
Umbilical cord blood banking It s Utility? Dr. Nita Radhakrishnan Pediatric Hematology Oncology Unit, Sir Ganga Ram Hospital, New Delhi What we will discuss today What are stem cells? What are the sources
More informationDisclosures. I have no disclosures.
Not Your Own Marrow Jenni Krajewski, MD Clinical Assistant Professor, Rutgers New Jersey Medical School Attending Physician, Pediatric Blood and Marrow Transplantation The Institute for Pediatric Cancer
More informationChronic Lymphocytic Leukemia. Case Study. AAIM Triennial October 2012 Susan Sokoloski, M.D.
Chronic Lymphocytic Leukemia AAIM Triennial October 2012 Susan Sokoloski, M.D. Case Study 57 year old male, trial application for $1,000,000 Universal Life coverage Cover letter from sales agent indicates
More informationAcute Lymphoblastic Leukemia (Adult) Including Lymphoblastic lymphoma
Acute Lymphoblastic Leukemia (Adult) Including Lymphoblastic lymphoma Updated April 2008 by Dr. Richard Wells* Updates: Minor changes only Introduction Acute lymphocytic leukemia (ALL) is a relatively
More informationA Career in Pediatric Hematology-Oncology? Think About It...
A Career in Pediatric Hematology-Oncology? Think About It... What does a pediatric hematologist-oncologist do? What kind of training is necessary? Is there a future need for specialists in this area? T
More informationAllogeneic stem cell transplant in HIV-1-infected individuals
Allogeneic stem cell transplant in HIV-1-infected individuals Javier Martinez-Picado UNIVERSITAT DE VIC Barriers to cure HIV infection Residual Replication Immune activation Inflammation Latent Infection
More informationUC Davis Institute for Regenerative Cures A facility supported by the California Institute for Regenerative Medicine
UC Davis Institute for Regenerative Cures A facility supported by the California Institute for Regenerative Medicine Naming Opportunities Opportunity No. Description/Features Gift Amount Institute for
More informationLong Term Low Dose Maintenance Chemotherapy in the Treatment of Acute Myeloid Leukemia
Long Term Low Dose Chemotherapy in the Treatment of Acute Myeloid Leukemia Murat TOMBULO LU*, Seçkin ÇA IRGAN* * Department of Hematology, Faculty of Medicine, Ege University, zmir, TURKEY ABSTRACT In
More informationACUTE MYELOID LEUKEMIA (AML),
1 ACUTE MYELOID LEUKEMIA (AML), ALSO KNOWN AS ACUTE MYELOGENOUS LEUKEMIA WHAT IS CANCER? The body is made up of hundreds of millions of living cells. Normal body cells grow, divide, and die in an orderly
More informationEstimated New Cases of Leukemia, Lymphoma, Myeloma 2014
ABOUT BLOOD CANCERS Leukemia, Hodgkin lymphoma (HL), non-hodgkin lymphoma (NHL), myeloma, myelodysplastic syndromes (MDS) and myeloproliferative neoplasms (MPNs) are types of cancer that can affect the
More informationTypes, production of antibodies and Antibody/antigen interaction
Types, production of antibodies and Antibody/antigen interaction Antibodies Secreted by B lymphocytes Great diversity and specificity: >109 different antibodies; can distinguish between very similar molecules
More informationInvestigation of B cell malignancies. Dr. Joanna Sheldon Protein Reference Unit St. George s s Hospital
Investigation of B cell malignancies Dr. Joanna Sheldon Protein Reference Unit St. George s s Hospital The B cell progression from «Pluripotent stem cell «Lymphoid committed stem cell «B lineage committed
More informationRelative Risk (Sokal & Hasford): Relationship with Treatment Results. Michele Baccarani
Relative Risk (Sokal & Hasford): Relationship with Treatment Results Michele Baccarani European LeukemiaNet EVOLVING CONCEPTS IN THE MANAGEMENT OF CHRONIC MYELOID LEUKEMIA VENICE 8 9 MAY 2006 Disease risk
More informationUpdate in Hematology Oncology Targeted Therapies. Mark Holguin
Update in Hematology Oncology Targeted Therapies Mark Holguin 25 years ago Why I chose oncology People How to help people with possibly the most difficult thing they may have to deal with Science Turning
More informationchronic leukemia lymphoma myeloma differentiated 14 September 1999 Pre- Transformed Ig Surface Surface Secreted Myeloma Major malignant counterpart
Disease Usual phenotype acute leukemia precursor chronic leukemia lymphoma myeloma differentiated Pre- B-cell B-cell Transformed B-cell Plasma cell Ig Surface Surface Secreted Major malignant counterpart
More informationMultiple Myeloma Workshop- Tandem 2014
Multiple Myeloma Workshop- Tandem 2014 1) Review of Plasma Cell Disorders Asymptomatic (smoldering) myeloma M-protein in serum at myeloma levels (>3g/dL); and/or 10% or more clonal plasma cells in bone
More informationCAR T cell therapy for lymphomas
CAR T cell therapy for lymphomas Sattva S. Neelapu, MD Associate Professor and Deputy Chair ad interim Department of Lymphoma and Myeloma UT MD Anderson Cancer Center, Houston, TX CAR T cell therapy What
More informationpcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
More informationMultiple Myeloma Patient s Booklet
1E Kent Ridge Road NUHS Tower Block, Level 7 Singapore 119228 Email : ncis@nuhs.edu.sg Website : www.ncis.com.sg LIKE US ON FACEBOOK www.facebook.com/ nationaluniversitycancerinstitutesingapore Multiple
More informationClinical Significance of Minimal Residual Disease in Leukemia and Lymphoma I
Clinical Significance of Minimal Residual Disease in Leukemia and Lymphoma I Dario Campana Departments of Oncology and Pathology St. Jude Children s Research Hospital Minimal Residual Disease - Rationale
More informationMaster of Science in Biomedical Sciences
Master of Science in Biomedical Sciences Faculty of Medicine Good health is our greatest treasure. Understanding the human body, healthy and diseased, is the stepping stone to finding tools to improving
More informationAnalysis of Illumina Gene Expression Microarray Data
Analysis of Illumina Gene Expression Microarray Data Asta Laiho, Msc. Tech. Bioinformatics research engineer The Finnish DNA Microarray Centre Turku Centre for Biotechnology, Finland The Finnish DNA Microarray
More informationThe use of monoclonal antibodies in the setting of HSCT
The use of monoclonal antibodies in the setting of HSCT S Montoto, Barts Cancer Institute, London, UK Geneva 3/April/2012 www.ebmt.org Some definitions of interest: Ab and Ag Antibody (Ab)=Immunoglobulin
More informationTreatment Recommendations for People Living with CML
Treatment Recommendations for People Living with CML Foreword by CML Workgroup Chronic myeloid leukaemia (CML) is a disease of the blood and bone marrow that results when there is a cancerous transformation
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationIBGRL, NHSBT, Bristol
IBGRL, NHSBT, Bristol Valuable to know D type of fetus Fetus D-positive: at risk pregnancy should be managed appropriately Fetus D-negative: not at risk no need for intervention RHD RHCE RHD* D 37 bp
More informationinformation for payers and referrers
a d u lt s t e m c e l l t r a n s p l a n tat i o n p r o g r a m information for payers and referrers Spring 2014 For more information, visit www.dfbwcc.org/bmt. o u r expertise Since its founding in
More informationChapter 2. S. Hovenga 1, J.Th.M. de Wolf 1, J.E.J. Guikema 4, H. Klip 2, J.W. Smit 3, C.Th. Smit Sibinga 5, N.A. Bos 4, E.
Chapter 2 Autologous stem cell transplantation in multiple myeloma after VAD and EDAP courses; a high incidence of oligoclonal serum immunoglobulins post transplantation S. Hovenga, J.Th.M. de Wolf, J.E.J.
More informationTechnical requirements for MRD analysis in myeloma: past, present and future
Technical requirements for MRD analysis in myeloma: past, present and future Andy C. Rawstron HMDS St. James s Institute for Oncology Leeds Teaching Hospitals NHS Trust Disclosures: Honoria/travel support:
More informationDNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
More informationAbout B Cell Lymphomas Groupmeeting Klipp/Spang, December 09 2002 Dennis Kostka Max-Planck-Institute for Molecular Genetics Computational Molecular Biology Berlin 1 Overview Short History of Lymphoma Classification
More information6th edi(on Highlights from EHA Leucemia acuta linfoblas6ca
6th edi(on Highlights from EHA Leucemia acuta linfoblas6ca HOT QUESTIONS ü Which Biomarkers in ALL? ü Will NGS be the future standard for MRD? ü Which are the most promising new drugs in ALL? ü What about
More informationCancer Immunotherapy: Can Your Immune System Cure Cancer? Steve Emerson, MD, PhD Herbert Irving Comprehensive Cancer Center
Cancer Immunotherapy: Can Your Immune System Cure Cancer? Steve Emerson, MD, PhD Herbert Irving Comprehensive Cancer Center Bodnar s Law Simple Things are Important Very Simple Things are Very Important
More informationSubtypes of AML follow branches of myeloid development, making the FAB classificaoon relaovely simple to understand.
1 2 3 4 The FAB assigns a cut off of 30% blasts to define AML and relies predominantly on morphology and cytochemical stains (MPO, Sudan Black, and NSE which will be discussed later). Subtypes of AML follow
More informationResponse Definition, Evaluation and Monitoring. Michele Baccarani
Response Definition, Evaluation and Monitoring Michele Baccarani European LeukemiaNet EVOLVING CONCEPTS IN THE MANAGEMENT OF CHRONIC MYELOID LEUKEMIA VENICE 8 9 MAY 2006 Response definition, evaluation
More informationEmerging New Prognostic Scoring Systems in Myelodysplastic Syndromes 2012
Emerging New Prognostic Scoring Systems in Myelodysplastic Syndromes 2012 Arjan A. van de Loosdrecht, MD, PhD Department of Hematology VU University Medical Center VU-Institute of Cancer and Immunology
More informationCourse Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Biochemistry The Master Degree in Medical Laboratory Sciences /Clinical Biochemistry, is awarded by the Faculty of Graduate Studies
More informationCirculating clonotypic B-cells in multiple myeloma and monoclonal gammopathy of undetermined significance
Published Ahead of Print on July 19, 2013, as doi:10.3324/haematol.2013.092817. Copyright 2013 Ferrata Storti Foundation. Early Release Paper Circulating clonotypic B-cells in multiple myeloma and monoclonal
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
More information