International Journal of Food Microbiology

Transcription

1 International Journal of Food Microbiology 126 (2008) Contents lists available at ScienceDirect International Journal of Food Microbiology journal homepage: Effect of microbial biocontrol agents on alleviating oxidative damage of peach fruit subjected to fungal pathogen Xiangbin Xu a,b, Guozheng Qin a, Shiping Tian a, a Key Laboratory of Photosynthesis and Environmental Molecular Physiology, Institute of Botany, the Chinese Academy of Sciences, Beijing , China b Graduate School of the Chinese Academy of Sciences, Beijing , China ARTICLE INFO ABSTRACT Article history: Received 16 August 2007 Received in revised form 8 May 2008 Accepted 14 May 2008 Keywords: Antagonistic yeast Postharvest diseases Peach fruits Antioxidant defense Protein carbonylation Biocontrol Levels of protein carbonylation in peach fruits inoculated with four antagonistic yeasts (Pichia membranaefaciens, Cryptococcus laurentii, Candida guilliermondii and Rhodotorula glutinis) were significantly reduced in response to reactive oxygen species (ROS) caused by Monilinia fructicola. In control fruit without yeast treatments, proteins carbonylation obviously increased after inoculation with M. fructicola, ranging from molecular mass 20 to 120 kda. However, in yeast-treated fruits, no proteins carbonylation was detected at 1 d, only a small quantity of carbonylation ranging from 28.5 to 45 kda was found at 2 d. Antagonistic yeasts significantly stimulated the activities of chitinase, β-1,3-glucanase, catalase (CAT), peroxidase (POD) and the expressions of relevant genes during all storage periods. These results suggest that yeast treatments may be related to alleviating proteins carbonylation and mitigating pathogen-induced oxidative damage, which result in decrease of fruit decay and imply that antioxidant defense response may be involved in the mechanisms of microbial biocontrol agents against fungal pathogen Elsevier B.V. All rights reserved. 1. Introduction Plants have evolved elaborate defense mechanisms to protect themselves against attack by pathogens such as fungi, bacteria and viruses. One of the most prominent and earliest defense responses is the generation of reactive oxygen species (ROS) (Doke, 1983; Mittler, 2002), such as hydrogen peroxide (H 2 O 2 ), superoxide anion (O 2 )andhydroxyl radical (OH )(Campo et al., 2004), which can trigger hypersensitive cell death, leading to phytoalexin synthesis, lignification, and pathogenesisrelated (PR) protein gene expression (Sutherland, 1991; VanLoon, 1997; Pothika et al., 1999). This defense response is called hypersensitive response (HR) and is considered to be a major element of plant disease resistance. When produced in a rapid and controlled manner, ROS are cellular requirement, because they are involved in signalling pathways and in the defence defense against stress (Levine et al., 1994a; Lamb and Dixon,1997; Foyer and Noctor, 2000). On the contrary, ROS may also be a source of oxidative stress when plant encounters ionic toxicity, osmotic stress, drought (Cavalcanti et al., 2004) and compatible plant pathogen interactions (Gayoso et al., 2004; Kwon and Anderson, 2001; Levine et al., 1994b). Uncontrolled overproduction of ROS can seriously disrupt normal metabolism by oxidizing nucleic acids, proteins, lipids, or carbohydrates, affecting the integrity of cell membranes and inactivating key cellular functions (Halliwell and Gutteridge, 1999). Therefore, Corresponding author. Tel.: ; fax: address: tsp@ibcas.ac.cn (S. Tian). antioxidant strategies are compulsory for maintenance of cell redox homeostasis. Several studies have shown that signal molecules such as salicylic acid (Borsani et al., 2001), methyl jasmonic acid (Jung, 2004) and nitric oxide (Beligni et al., 2002) play important roles in provoking plant resistance to various biotic or abiotic stresses. Plant growthpromoting rhizobacteria (PGPR) also showed the capability in activating antioxidants including superoxide dismutase (SOD) and peroxidase (POD), which are associated with PGPR-mediated induced systemic resistance (ISR) and providing protection against diverse pathogens (Silva et al., 2004; Jetiyanon, 2007). In recent years, a number of microbial biocontrol agents were reported to be effective in inhibiting postharvest decay of fruits (Ippolito et al., 2000; Janisiewicz and Korsten, 2002). The mechanisms of antagonists against fungal pathogens include secretion of antibiotics, competition for space and nutrients, production of lytic enzymes, and induction of host resistance (Wisniewski et al., 1991; Chan and Tian, 2005). In particular, induced resistance (IR) is recognized as an important mode of biocontrol in vegetative tissues (Sequeira, 1983). In our previous studies, Pichia membranaefaciens and Candida guilliermondii were found to be effective in inducing activities of chitinase and β-1,3-glucanase in nectarine (Fan and Tian, 2000) and peach fruit(fan et al., 2000). Cryptococcus laurentii was proved to induce the activity of β-1,3-glucanase and expression of Glu-1 gene in jujube fruit, resulting in the decrease of decay caused by Alternaria alternata (Tian et al., 2006) and Penicillium expansum (Tian et al., 2007). However, up to now, most studies of yeast-mediated decay control focused on the induction of defense-related enzyme against fungal pathogens. Little evidence has been demonstrated for antioxidant proteins in plants induced by yeast against pathogen-induced oxidative stress, especially in /$ see front matter 2008 Elsevier B.V. All rights reserved. doi: /j.ijfoodmicro

2 154 X. Xu et al. / International Journal of Food Microbiology 126 (2008) postharvest disease control. Recently, our study showed that yeast P. membranaefaciens obviously induced 5 antioxidant and 3 PR proteins in peach fruit based on proteomic approach (Chan et al., 2007). Therefore, we hypothesized that the increased antioxidant enzymes induced by antagonistic yeast may act as a scavenger to reduce the pathogen-induced oxidative stress. Immunodetection of carbonylated proteins is a good indicator of protein damage due to oxidative stress and has been widely used in studies on human diseases, such as Alzheimer's disease, chronic lung disease, chronic renal failure, diabetes and sepsis (Conrad et al., 2000; Isabella et al., 2003). As an effective strategy for oxidative damage analysis, the identification of carbonylated proteins could act as diagnostic biomarkers and yield basic information to aid the establishment of efficacious antioxidant therapy (Conrad et al., 2000). In postharvest disease control, it may be a potential method for studying the effects of antagonists on pathogen-induced oxidative stress. Therefore, the objective of this study was mainly to investigate the effect of proteins carbonylation in defense response of peach fruits treated by four antagonistic yeasts, P. membranaefaciens, C. laurentii, C. guilliermondii and Rhodotorula glutinis, to determine whether these yeasts were functional in alleviating the pathogen-generated oxidative stress, and to further elucidate the mechanisms by which antagonistic yeast effectively control diseases of fruit. 2. Materials and methods 2.1. Plant material Peach (Prunus persica L. Batsch) fruits were harvested at commercial maturity from an orchard in the Haidian district, Beijing and were transported to laboratory immediately where they were sorted based on size without physical injuries or infections. Selected fruits were surface-disinfected with 2% (v/v) sodium hypochlorite for 2 min, washed with tap water, and air-dried prior to use Antagonists and pathogen Antagonistic yeasts, R. glutinis and C. laurentii were isolated from the surface of apple fruit, and P. membranaefaciens was isolated from the surface of peach fruit in our previous experiments (Fan and Tian, 2000; Tian et al., 2004). The three yeasts were identified by the International Centre for Agriculture and Bioscience (CABI) Bioscience Identification Services (International Mycological Institute, UK). C. guilliermondii was obtained from the Institute of Microbiology, the Chinese Academy of Sciences, Beijing. All yeasts were cultured in nutrient yeast dextrose broth (NYDB) at 28 C for 48 h, and then adjusted to a concentration of cells ml 1 with a hemocytometer. Monilinia fructicola was isolated from decaying peach fruit and cultured on potato dextrose agar (PDA) at 25 C for 7 d. Spores of the fungal pathogen were obtained by flooding the cultures with sterile distilled water containing 0.05% (v/v) Tween-80, then filtered through four layers of sterilized cheesecloth, and adjusted the suspensions to a concentration of pores ml 1 with a hemocytometer Biocontrol assay Peach fruits were wounded at the equator of each fruit with a sterile nail. Wounds were inoculated with 20 μl of cell suspension of each yeast at cells ml 1 or sterile distilled water (as the control). After 12 h, all wounds were challenge-inoculated with 20 μl of conidial suspension of M. fructicola at spores ml 1, respectively. All fruits were put in plastic trays to maintain a relative high humidity (about 95%), and stored at 20 C. Disease incidence and lesion diameter were measured 3 d after treatments. Each treatment contained three replicates of 15 fruits and the entire experiment was performed twice Preparation of total proteins and SDS-PAGE Extraction of total proteins was performed according to the method of Chan et al. (2007). SDS-PAGE was carried out on minigels (15% resolving gels, 5% stacking gel) according to Laemmli (Laemmli, 1970). Thirty microgram of protein was loaded on each lane, and a molecular weight marker solution was loaded at either end of the gel. Electrophoresis was performed at 120 V per gel. Protein content was measured according to the method of Bradford (1976), using bovine serum albumin (BSA) as the standard protein Proteins carbonyl determination The content of carbonylated proteins of peach fruit was detected using the chemical and immunological reagents of the OxyBlot Protein Oxidation Detection kit (Chemicon International, Temecula, CA, USA) (Qin et al., 2007). Briefly, protein sample (30 μg) was mixed with 12% sodium dodecyl sulphate (SDS) (5 μl). 10 mmol/l 2,4- dinitrophenylhydrazine (DNPH) (10 μl) dissolved in 10% trifluoroacetic acid (v/v) was added to the sample. The reaction mixture was vortexed and incubated for 15 min at room temperature. The solution was neutralized by addition of 2 mol/l Tris (10 μl) and centrifuged for 5 min at 2500 g. Proteins were separated by 15% SDS-PAGE and transferred to Immobilon-P polyvinylidene diflouride membrane (Millipore, Bedford, MA, USA) using an electroblotting apparatus (Bio-Rad, Hercules, CA, USA). The oxidatively modified proteins were detected with anti-dnp antibodies and the chemiluminescence blotting substrate SuperECL plus (Applygen Technologies Inc., Beijing, China) Enzyme assays CAT activity was assayed spectrophotometrically at 240 nm in a Shimadzu UV-160 spectrophotometer (Shimadzu Corporation, Kyoto, Japan) (Wang et al., 2004). Activities of POD and β-1,3-glucanase were determined following the method described by Yao and Tian (2005). Chitinase was measured according to the method of Wirth and Wolf (1990). Protein content was measured according to the method of Bradford (1976), using BSA as the standard protein cdna cloning Total RNA was extracted from peach fruit 24 h after treated with yeasts. First-strand cdna was synthesized with first-strand cdna synthesis kit and used for polymerase chain reaction (PCR). The highly conserved domains of peach catalase (CAT), peroxidase (POD), chitinase (CHI) and β-1, 3-glucanase (GLU) cdna clones were obtained by PCR. All primers used were listed in Table 1. The PCR products were cloned into pgem-t vector and sequenced. Table 1 Primers used in the cloning conserved domains of CAT, POD, CHI and GLU cdna in peach fruit cdna amplified Forward primer Reverse primer Temp. C Genebank accession Catalase atggatccttacaagcaccgc tcaaatgcttggcctcacatt 55 AJ496418, AJ Proxidase cggtttggtgtactttgcgatcg tcatttattcatacagagctggc 60 DW353011, DW350829, DW Chitinase aaaaccctggatcttattgtgc accttagcgttccagcccttac 55 AF β-1, 3-glucanase gtatgtaatggaatggttggcg tctcaagagcagcataaacacc 60 AF435088, AF435089, U49454

3 X. Xu et al. / International Journal of Food Microbiology 126 (2008) Isolation of total RNA and northern blot analysis About 10 g frozen flesh tissue (about 2 mm away from the infection site or wound) from 15 fruits was ground in liquid nitrogen. Total RNA was extracted by the method hot-phenol isolation protocol (Chan et al., 2007) and stored at 80 С. RNA (20 μg) was denatured in formamide and formaldehyde at 65 С and electrophoresised in a 1% agarose gel containing formaldehyde (6%, v/v). After electrophoresis, RNA was capillary transferred overnight onto a Hybond-N + membrane (Amersham International, Amersham, Bucks, UK) and hybridized with [ 32 P] dctp-labelled cdna probe. Pre-hybridization and hybridization were carried out at 65 С. Blots were hybridized for 16 h and then washed once for 20 min in 2 SSC, 0.1% SDS at 65 С and twice for 10 min in 0.1 SSC, 0.1% SDS at 65 С. RNA bands were visualized by autoradiography. Equal loading of samples of total RNA was identified by visualization of rrna that had been stained with ethidium bromide. Autoradiographs were digitally scanned and band densities quantified using Scion Image Software (Scion Corporation, Frederick, MD, USA). The 100% was assigned to the maximum optical density value achieved in each northern and the rest were normalized to the maximum value and expressed as percentage of relative intensity Data analysis All data were analysed analyzed by one-way analysis of variance (ANOVA). Mean separations were performed by Duncan's multiple range test. Differences at P 0.05 were considered as significant. 3. Results 3.1. Biocontrol agents reduce brown rot in peach fruits Decayed peach fruits first showed watery spots, and then the typical symptom of brown rot developed gradually from the inoculation site (Fig. 1A). All yeasts significantly reduced disease incidence and limited lesion diameter of brown rot caused by M. fructicola. At 3 d of storage in 20 C, all control fruits decayed, but P. membranaefaciens-, C. laurentii-, C. guilliermondii- and R. glutinistreated fruits had a decay incidence of 70 80%, 60 69%, 6 9% and 81 90%, respectively (Fig. 1B) Biocontrol agents alleviate proteins carbonylation The assessment of oxidative damage of carbonylated proteins in peach fruits was undertaken by immunoassay with anti-dnp antibodies. It was clear that proteins carbonylation occurred in control fruits at 1 and 2 d after inoculation with M. fructicola, ranging in size of apparent molecular masses from about 20 to 120 kda. However, in P. membranaefaciens-, C. laurentii- and R. glutinis-treated fruits, no proteins carbonylation were detected at 1 d. Only a small quantity of carbonylation was observed at 2 d, ranging from 28.5 to 45 kda. Moreover, proteins carbonylation did not occur in C. guilliermondiitreated fruit at 1 and 2 d (Fig. 3B). After 3 and 4 d of inoculation with M. fructicola, although carbonylated proteins were found in all fruits (Fig. 3D), but the levels in yeast-treated fruits were significantly lower compared to the control Biocontrol agents stimulate activities of antioxidant and hydrolytic enzymes CAT activities in the control fruit gradually decreased with prolonging storage time, and remained at lower level throughout the whole storage period (Fig. 3). CAT activities in yeast-treated fruits reached the highest level at 1 d after inoculation with M. fructicola, and were higher than that in the control. POD activities were stimulated by yeast treatments, and showed higher levels compared to the control particularly at the beginning of storage. In addition, the activities of chitinase and β-1,3-glucanase were significantly increased and showed higher levels in yeast-treated fruits than that in the control fruit during the storage time (Fig. 5) Biocontrol agents induce expression of relevant resistant genes In this experiment, catalase, peroxidase, chitinase and β-1,3- glucanase genes were cloned from peach fruit by RT-PCR, and designated as CAT, POD, CHI and GLU. Expression of CAT, POD, CHI Fig. 1. Development of brown rot in peach fruit after treatment with different yeasts. (A) Symptoms of brown rot in peach fruit 3 d after inoculation; (B) Disease incidence and lesion diameter of brown rot in peach fruit. Bars represent standard deviations of the means. Treatments with different letters are significantly different (P 0.05) according to the least significant difference test.

4 156 X. Xu et al. / International Journal of Food Microbiology 126 (2008) and GLU genes in peach fruit was analyzed using northern blotting. There was a significant difference in the level of CAT transcripts between yeast treatments and control (Fig. 4). The transcripts of CAT in the control fruit decreased and remained a lower level throughout the whole storage period. In yeast-treated fruits, the expression of CAT transcripts obviously increased at 1 d, and then decreased with prolonging storage time. However, the expression of CAT transcripts in yeast-treated fruits was significantly higher than that in the control, especially in the P. membranaefaciens-treated fruit. The expression of POD gene transiently increased at the first day of storage, then gradually decreased (Fig. 4). POD transcripts were significantly higher in yeast-treated fruits compared to the control, especially in P. membranaefaciens- and C. laurentii-treated fruits. In yeast-treated fruits, the expression of CHI gene was significantly increased 2 d after inoculation with M. fructicola, especially in P. membranaefaciens- and C. laurentii-treated fruits (Fig. 6). However, in the control fruit, after a transiently increase at the first day, expression of CHI gene gradually decreased. Similarly, the expression of GLU gene in the control fruit showed a significant increase after inoculation with M. fructicola at 2 d, then decreased. There was no obvious difference among different yeast treatments, but the expression of GLU gene in yeast-treated fruits was significantly higher compared to the control in all storage periods. 4. Discussion Fig. 2. Effects of yeast treatments on oxidative damage caused by M. fructicola in peach fruit. (A) Coomassie Brilliant Blue staining of proteins of peach fruit stored at 20 C after 1 and 2 d; (B) Immunodetection of carbonylated proteins of peach fruit stored at 20 C after 1 and 2 d; (C) Coomassie Brilliant Blue staining of proteins of peach fruit stored at 20 C after 3 and 4 d; (D) Immunodetection of carbonylated proteins of peach fruit stored at 20 C after 3 and 4 d. ROS are often detected in plant pathogen interactions and are associated with symptom development. In this experiment, we found that the four yeasts were effective at controlling brown rot caused by M. fructicola in peach fruits (Fig. 1). In order to further verify whether biocontrol yeasts influenced pathogen-induced oxidative damage in peach fruits, the contents of proteins carbonylation were analyzed using anti-dnp antibody. The results showed that carbonylated proteins in yeast-treated fruits was were significantly decreased during storage periods as compared to control fruit (Fig. 2), implying that the antagonistic yeasts had potent efficacy in alleviating pathogen-induced oxidative damage in peach fruit. The mechanism by which antagonistic yeasts mitigated proteins carbonylation or pathogen-induced oxidative stress is complicated. Generally, an appropriate intracellular balance between ROS generation and scavenging exists in all cells. This redox homeostasis requires the efficient coordination of reactions in different cell compartments and is governed by complex signal transduction pathways. Plants possess an array of antioxidants that can protect cells from oxidative damage by scavenging ROS. The scavengers include ascorbate, glutathione, and hydrophobic molecules (tocopherols, carotenoids, and xanthophylls) and detoxifying enzymes that operate in the different cellular organelles (Noctor and Foyer, 1998). These enzymes include SOD, CAT and POD, which work together with other enzymes of the ascorbate glutathione cycle to promote the scavenging of ROS (Hernandez et al., 2001). SOD catalyzes the dismutation of O 2 to H 2 O 2 and O 2. CAT is present in the peroxisomes of nearly all aerobic cells (Dionisio-Sese and Tobita, 1998). It can protect the cell from H 2 O 2 by catalyzing its decomposition into O 2 and H 2 O (Foyer and Noctor, 2000). POD is widely distributed in all higher plants and protects cells against the destructive influence of H 2 O 2 by catalyzing its decomposition through the oxidation of phenolic and enodiolic cosubstrates (Asada, 1992; Borsani et al., 2001). In this study, P. membranaefaciens and C. laurentii significantly stimulated the activities of antioxidant enzymes CAT and POD (Fig. 3), and the expressions of CAT and POD genes in yeast-treated fruits were also increased compared to the control (Fig. 4). Moreover, C. guilliermondii and R. glutinis could induce the activities of CAT and POD (Figs. 3 and 4). These results supported our previous findings, namely, P. membranaefaciens and C. laurentii could stimulate antioxidant activities, such as SOD, methionine sulfoxide reductase (MSR), glutathione peroxidase (GPX), and polyphenol oxidase (PPO) in peach fruit (Wang et al., 2004; Chan et al., 2007). These results indicated that the high levels of CAT and POD elicited by the microbial biocontrol agents played important roles in reducing damage caused by pathogen, which partially account for the

5 X. Xu et al. / International Journal of Food Microbiology 126 (2008) Fig. 3. Effects of yeast treatments on CAT and POD activities in peach fruit stored at 20 C. Bars represent standard deviations of the means. Fig. 5. Effects of yeast treatments on chitinase and β-1,3-glucanase activities in peach fruit stored at 20 C. Bars represent standard deviations of the means. observed delay in symptom development in yeast-treated peach fruits. Thus, we considered that the mechanisms by which biocontrol agents inhibit decay development may be related to the mitigation of proteins carbonylation and alleviation of pathogen-induced ROS. Besides the induction of antioxidants, the expression of PR proteins gene is also associated with the generation of ROS in plant defense responses. The present study showed that yeast treatments significantly stimulated the activities of chitinase and β-1,3-glucanase and the expressions of corresponding genes in peach fruit (Figs. 5 and 6). Chitinase and β-1,3-glucanase are the most fully characterized PR proteins, which are capable of hydrolyzing polymers of fungal cell walls, and were suggested to be involving in plant defense against fungal infection (Bartnicki-Garcia, 1968). The accumulation of chitinase and β-1,3-glucanase is important in retarding fungal growth and decreasing spoilage of fruits caused by fungal pathogens. Taken together, the novel findings of this study included: (i) The microbial biocontrol agents could reduce the level of proteins carbonylation in response to ROS caused by fungal pathogen; Fig. 4. Effects of yeast treatments on CAT and POD mrna expression in peach fruit stored at 20 C. Twenty micrograms of total RNA from peach fruit were was fractionated by gel electrophoresis, blotted and hybridized with probes. The intensity of the bands was quantified by scanning densitometry of the autoradiographs. Optical densities values were normalized to the maximum value and expressed as percentage of relative intensity. Equal loading of samples of total RNA was identified by visualization of rrna that had been stained with ethidium bromide. Fig. 6. Effects of yeast treatments on CHI and GLU mrna expression in peach fruit stored at 20 C. Twenty micrograms of total RNA from peach fruit were was fractionated by gel electrophoresis, blotted and hybridized with probes. The intensity of the bands was quantified by scanning densitometry of the autoradiographs. Optical densities values were normalized to the maximum value and expressed as percentage of relative intensity. Equal loading of samples of total RNA was identified by visualization of rrna that had been stained with ethidium bromide.

6 158 X. Xu et al. / International Journal of Food Microbiology 126 (2008) (ii) Antioxidant defense response is involved in the mechanisms of antagonistic yeast against fungal pathogen and plays an important role in mitigating pathogen-induced oxidative stress to peach fruits, which add new information for the pathway of induced resistance by antagonistic yeast. Acknowledgements This study was supported by the Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-YW-N-007) and the National Natural Science Foundation of China ( ; ). References Asada, K., Ascorbate peroxidase: a hydrogen peroxide-scavenging enzyme in plants. Plant Physiology 85, Bartnicki-Garcia, S., Cell wall chemistry, morphogenesis taxonomy of fungi. Annual Reviews of Microbiology 22, Beligni, M.V., Fath, A., Bethke, P.C., Lamattina, L., Jones, R.L., Nitric oxide acts as an antioxidant and delays programmed cell death in barley aleurone layers. Plant Physiology 129, Borsani, O., Valpuesta, V., Botella, M.A., Evidence for a role of salicylic acid in the oxidative damage generated by NaCl and osmotic stress in Arabidopsis seedlings. Plant Physiology 126, Bradford, M.M., A Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, Campo, S., Carrascal, M., Coca, M., Abian, J., Segundo, B.S., The defense response of germinating maize embryos against fungal infection: a proteomics approach. Proteomics 4, Cavalcanti, F.R., Oliveira, J.T.A., Martins-Miranda, A.S., Gas, R.A.V., Silveira, J.A.G., Superoxide dismutase, catalase and peroxidase activities do not confer protection against oxidative damage in saltstressed cowpea leaves. New Phytologist 163, Chan, Z.L., Tian, S.P., Interaction of antagonistic yeasts against postharvest pathogens of apple fruit and possible mode of action. Postharvest Biology and Technology 36, Chan, Z.L., Qin, G.Z., Xu, X.B., Li, B.Q., Tian, S.P., Proteome approach to characterize proteins induced by antagonist yeast and salicylic acid in peach fruit. Journal of Proteome Research 6, Conrad, C.C., Marshall, P.L., Talent, J.M., Malakowsky, C.A., Choi, J., Gracy, R.W., Oxidized proteins in Alzheimer's plasma. Biochemical and Biophysical Research Communications 275, Doke, N., Generation of superoxide anion by potato-tuber protoplasts during the hypersensitive response to hyphal wall components of Phytophthora infestans and specific-inhibition of the reaction by suppressors of hypersensitivity. Physiol. Plant Pathol. 23, Dionisio-Sese, M.L., Tobita, S., Antioxidant responses of rice seedlings to salinity stress. Plant Science 135, 1 9. Fan, Q., Tian, S.P., Postharvest biological control of Rhizopus rot on nectarine fruit by Pichia membranaefaciens Hansen. Plant Disease 84, Fan, Q., Tian, S.P., Xu, Y., Wang, Y., Jiang, A.L., Biological control of Rhizopus rot of peach fruits by Candida guilliermondii. Acta Botanic Sinica 42, Foyer, C.H., Noctor, G., Oxygen processing in photosynthesis: regulation and signalling. New Phytologist 146, Gayoso, C., Pomar, F., Merino, F., Bernal, M.A., Oxidative metabolism and phenolic compounds in Capsicum annuum L. var. annuum infected by Phytophthora capsici Leon. Scientia Horticulturae 102, Halliwell, B., Gut, teridge, J.M.C., Free Radicals in Biology and Medicine, 3rd ed. Oxford University Press, London. Hernandez, J.A., Ferrer, M.A., Jimenez, A., Barcelo, A.R., Sevilla, F., Antioxidant systems and O 2 /H 2 O 2 production in the apoplast of pea leaves. Its relation with saltinduced necrotic lesions in minor veins. Plant Physiology 127, Ippolito, A., Ghaouth, A.E., Wilson, C.L., Wisniewski, M., Control of postharvest decay of apple fruit by Aureobasidium pullulans and induction of defense responses. Postharvest Biology and Technology 19, Isabella, D.D., Daniela, G., Roberto, C., Ranieri, R., Aldo, M., Protein carbonylation in human diseases TRENDS in Molecular Medicine 9. Janisiewicz, W.J., Korsten, L., Biological control of postharvest disease of fruits. Annual Reviews of Phytopathology 40, Jetiyanon, K., Defensive-related enzyme response in plants treated with a mixture of Bacillus strains (IN937a and IN937b) against different pathogens. Biological Control 42, Jung, S., Effect of chlorophyll reduction in Arabidopsis thaliana by methyl jasmonate or norflurazon on antioxidant systems. Plant Physiology and Biochemistry 42, Kwon, S.I., Anderson, A.J., Differential production of superoxide dismutase and catalase isozymes during infection of wheat by a Fusarium proliferatum-like fungal isolate. Physiology Molecular Plant Pathology 58, Laemmli, U.K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, Lamb, C., Dixon, R.A., The oxidative burst in plant disease resistance. Annual Review of Plant Physiology and Plant Molecular Biology 48, Levine, A., Tenhaken, R., Dixon, R., Lamb, C., 1994a. H 2 O 2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, Levine, R.L., Williams, J.A., Stadtman, E.R., Shacter, E., 1994b. Carbonyl assays for determination of oxidatively modified proteins. Methods Enzymol. 233, Mittler, R., Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7, Noctor, G., Foyer, C.H., Ascorbate and glutathione: keeping active oxygen under control. Annual Review of Plant Physiology and Plant Molecular Biology 49, Pothika, T.S., Collins, C.C., Johnson, D.I., Delmer, D.P., Levine, A., The involvement of hydrogen peroxide in the differentiation of secondary walls in cotton fibers. Plant Physiology 119, Qin, G.Z., Tian, S.P., Chan, Z.L., Li, B.Q., Crucial role of antioxidant proteins and hydrolytic enzymes in pathogenicity of Penicillium Expansum. Molecular and Cellular Proteomics 6, Sequeira, L., Mechanisms of induced resistance in plants. Annu. Rev. Microbiol. 37, Silva, H.S.A., Romeiro, R.d.S., Macagnan, D., Halfeld-Vieira, B.d.A., Pereira, M.C.B., Mounteer, A., Rhizobacterial induction of systemic resistance in tomato plants non-specific protection and increase in enzyme activities. Biological Control 29, Sutherland, M.W., The generation of oxygen radicals during host plant responses to infection. Physiology Molecular Plant Pathology 39, Tian, S.P., Qin, G.Z., Xu, Y., Survival of antagonistic yeasts under field conditions and their biocontrol ability against postharvest diseases of sweet cherry. Postharvest Biology and Technology 33, Tian, S.P., Wan, Y.K., Qin, G.Z., Xu, Y., Induction of defense responses against Alternaria rot by different elicitors in harvested pear fruit. Appl Microbiol Biotechnol. 70, Tian, S.P., Yao, H.J., Deng, X., Xu, X.B., Qin, G.Z., Chan, Z.L., Characterization and expression of β-1, 3-glucanase genes in jujube fruit induced by the biocontrol microbial agent Pichia membranaefaciens. Phytopathology 97, VanLoon, L.C., Induced resistance in plants and the role of pathogenesis-related proteins. Eur J Plant Pathol. 103, Wang, Y.S., Tian, S.P., Xu, Y., Qin, G.Z., Yao, H.J., Changes in the activities of pro- and anti-oxidant enzymes in peach fruit inoculated with Cryptococcus laurentii or Penicillium expansum at 0 or 20 C. Postharvest Biology and Technology 34, Wirth, S.J., Wolf, G.A., Dye-labelled substrates for the assay and detection of chitinase and lysozyme activity. journal of Microbiological Methods 12, Wisniewski, M., Biles, C., Droby, S., McLaughlin, R., Wilson, C., Chalutz, E., Mode of action of the postharvest biocontrol yeast Pichia guilliermondii: characterization of attachment to Botrytis cinerea. Physiology Molecular Plant Pathology 39, Yao, H.J., Tian, S.P., Effect of pre- and post-harvest application of salicylic acid or methyl jasmonate on inducing disease resistance of sweet cherry fruit in storage. Postharvest Biology and Technology 35,