Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage"

Transcription

1 Developmental Cell Supplemental Information Mitotic Membrane Turnover Coordinates Differential Induction of the Heart Progenitor Lineage Christina D. Cota and Brad Davidson

2 Supplemental Figures S1-S7 S1. FGF signaling is necessary for unequal cell division but is not required for polarized FGFR trafficking. Related to Figure 1. (A) Diagram of Fox>RFP induction assay as described in Materials & Methods. (B-C) Representative micrographs showing heart progenitor induction (FoxF>RFP, arrowheads) in control (B) and Mesp>FGFR:Venus transgenic embryos (C). Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Targeted expression of FGFR>Venus had no discernable impact on induction (5 trials, n>19/trial, P=0.805 (n.s.). (D-F) Representative micrographs of staged Mesp>FGFRDN:Venus founder cells, stained as indicated. Dashed lines in lateral sections (DE) indicate founder cell membranes (red) or epidermal border (white, Epi). Membrane associated FGFR:Venus foci (arrows) and intracellular vesicles (arrowheads) in mitotic founder cells. Solid lines in lateral projection (F) indicate dorsally (orange) and ventrally (white) positioned founder cell daughters. (G) Box-and-whisker plot of dorsal/ventral volume ratios derived from founder cell daughters (2 trials, n>12, GFP Control mean = 2.35±0.295 s.e.m, FGFRDN:Venus mean = 1.47±0.359 s.e.m, *P= ). HP= heart progenitor, ATM= anterior tail muscle cell. Error bars represent the s.e.m. Scale bars are indicated in µm. Embryos are oriented anterior to the left.

3 S2. Selective rescue of heart progenitor induction is mediated by Intβ2 distal NPxF motif. Related to Figure 3. (A-F ) Representative micrographs showing single channel and merged images representative of heart progenitor induction (FoxF>RFP, arrowheads) in embryos co-transfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

4 S3. Adhesion-dependent retention of Caveolin:GFP and Caveolin-dependent retention of FGFR:Venus in mitotic founder cells. Related to Figure 4. (A-D ) Representative micrographs showing heart progenitor induction (FoxF>RFP, arrowheads) in embryos cotransfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). (E-G) Lateral sections and graph (C-G) depicting comparative analysis of Caveolin:GFP enrichment along founder cell membranes in control (LacZ, E) and RapS17N (F) transgenic founder cells. Ventral/Dorsal (V/D) Ratio for cell cortex is shown. (VInt/DInt=2.62±0.10 for Caveolin:GFP) For calculation of Ventral/Dorsal (V/D) Ratios see Supplemental Materials & Methods. Error bars represent the s.e.m in (G). *P=0.040 for LacZ versus RapS17N. Significance was determined using two-tailed unpaired t-test. (H-K ) Lateral sections of FGFR:Venus and Caveolin:RFP distribution in pre-mitotic (H, J ) and mitotic (I, K ) founder cells transfected with either Caveolin:RFP or CaveolinP189L:RFP as indicated to the left. FGFR:Venus and Caveolin:RFP foci along the epidermal boundary indicated by arrows in H-J. Dashed lines (red) outline transgenic founder cells. D=dorsal, V=ventral, Epi=ventral epidermis (dashed line, white). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

5 S4. Caveolin is required for heart progenitor induction. Related to Figure 5. (A-B ) Lateral sections and corresponding diagrams of FGFR:Venus distribution in pre-mitotic transgenic founder cells co-transfected as indicated. Dashed lines (red) outline founder cell membranes. Epi=ventral epidermis (dashed line, white). (C-F' ) Single channel and merged images showing representative heart progenitor induction phenotypes (FoxF>RFP, arrowheads) in embryos co-transfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

6 S5. Caveolin-mediated rescue of heart progenitor induction in RapS17N transgenic embryos. Related to Figure 6. (A-C ) Single channel and merged images showing representative heart progenitor induction phenotypes (FoxF>RFP, arrowheads) in embryos co-transfected as indicated. Arrows indicate un-induced cardiac founder lineage cells (Mesp>GFP). Scale bars are indicated in µm. Embryos are oriented anterior to the left.

7 S6. Proposed model for anchorage dependent asymmetric cell fate determination. Related to Figure 7. (A) Diagrams illustrating how anchored mitosis may bias the turnover and redistribution of adherent membrane compartments (in red) to promote asymmetric fate specification. (A ) Prior to cytokinesis, a decreased rate of endocytic recycling drives a reduction in cell surface area and volume associated with mitotic rounding (Boucrot and Kirchhausen, 2007). (A ) In cells that remain anchored during rounding, persistent adhesion may maintain premitotic recycling rates or suppress internalization leading to asymmetric enrichment of adherent membrane compartments. (A ) Upon entry into cytokinesis, internalized vesicles enriched with Caveolin and associated proteins are re-distributed (Boucrot et al., 2011). Recycling pathways re-distribute Integrin receptors to the cytokinetic ring (Pellinen et al., 2008) establishing a central domain of adherent membrane where Caveolin may also be retained (Boucrot and Kirchhausen, 2007). (A ) Persistent, asymmetric adhesion during anchored division may bias the re-distribution of Caveolin and associated integral membrane proteins, including receptors.

8 Supplemental Tables S1-S2 Table S1. Caveolin CRISPR primers Related to Figure 5. Name grna(20-mer) a PAM CavA.39gRNA ACAACACGAAGCTGCAACCC CGG CavA.39gRNAmm1 ACAACcCGAAGCTGCAACCC CGG CavA.39gRNAmm2 ACAACACGAAGCTGCcACCC CGG CavA.219gRNA GGACAATGTGGAACTTGATT CGG CavA.219gRNAmm1 GGACAcTGTGGAACTTGATT CGG CavA.219gRNAmm2 GGACAATGTGGcACTTGATT CGG a For inverse PCR cloning: forward primers: 5 -(grna)tttaagagctatgctggaaacagcatagc-3 ; Reverse primer: 5 - TGAGACCCTCTCTCGGTCTCTATCTATACCA-3 Table S2. Primers Related to Figures 3 & 5. Name Primer sequence (5-3 ) Intβ1 Y694F forward TCTACCTTTAAAAATCCAATGTTTTCTGGTGGGAAAACTGCTGGA Intβ1 Y694F reverse TCCAGCAGTTTTCCCACCAGAAAACATTGGATTTTTAAAGGTAG A Intβ2 F801Y forward ACGAGGTTCGAAAACCCAACCTACCACGGAACGTAGACATCACG C Intβ2 F801Y reverse GCGTGATGTCTACGTTCCGTGGTAGGTTGGGTTTTCGAACCTCGT Caveolin(CavA) forward ACTGCGGCCGCAATGGCAGAAAACGGAGAA Caveolin(CavA) reverse ACTGGATCCTGCGCGTCTCTCCTCAGTGACA Caveolin P189L forward CATTTGGTGGATCATGCTATGTATTAGATGCCTCG Caveolin P189L reverse CGAGGCATCTAATACATAGCATGATCCACCAAATG Caveolin exon1 forward TGGCAGAAAACGGAGAACAG Caveolin exon1 reverse GGCATGATCCACCAAATGC

9 Supplemental Methods Equatorial cell volume measurements. For measurements of equatorial cell volume, confocal stacks of postmitotic cardiac founder lineage cells were analyzed using ImageJ. Equatorial cell volumes were approximated as rectangular cell volumes. Consistent positioning for cell measurements was achieved by identifying the section within a stack where the nuclear diameter was the largest. To avoid concerns about changes in division orientation, equatorial cell volume ratios were calculated as the ratio of the larger two cardiac founder lineage cells in a cluster versus the smaller two cells. FGFR:Venus measurements. For measurements of ventral/dorsal staining ratios, 1uM confocal stacks were analyzed using ImageJ. Only ventral views were analyzed. For each founder cell analyzed a lateral optical section was obtained. Consistent positioning for measurements was defined by finding the center of the DRAQ5-stained chromatin with the founder cell being analyzed. For exterior cell volume measurements, a ROI was set at the perimeter of each founder cell. Interior cell volume measurements were determined by setting a second ROI within the exterior cell ROI. ROIs were positioned such that subtraction of measurements obtained for the interior ROI from the exterior ROI represents values for a 2.5µm region of the founder cell cortex. Ventral and dorsal regions for each founder cell were set in relation to the axis of cell division (red rectangle; Fig. 1C -C ). Generation and use of the ROI and background subtraction tools achieved consistent outlining and detection of GFP-stained regions. The corrected total fluorescence (CTCF) was calculated as integrated density (area of selected cell mean fluorescence of background reading) and determined for the dorsal and ventral, interior and exterior founder cell volumes. To approximate the plasma membrane-associated fluorescence from these measurements for both the dorsal and ventral regions of each founder cell; plasma membrane-associated fluorescence was defined by exclusion such that for each dorsal and ventral region, the interior CTCF was subtracted from the exterior CTCF. From these values ratios were calculated comparing the ventral plasma membrane-associated fluorescence to the dorsal plasma membrane-associated fluorescence (V/D for cell cortex) or comparing the ventral intracellular fluorescence to the dorsal intracellular fluorescence (V Int /D Int for cell cortex). For measurements of the percent of FGFR-associated membrane (Fig. 2H) a lateral optical section was obtained each founder cell analyzed. In each section the circumference of the cell as well as the distance along that circumference associated with FGFR staining was measured. Results are expressed as a percentage equal to the distance along that circumference associated with FGFR staining/ the circumference of the cell. We also attempted to directly examine FGF receptor distribution using an Ciona FGFR antibody. FGFR mabs were prepared via custom antibody services (Abmart). Specificity was determined by western blot analysis of protein lysates prepared from Stage 14 C.intestinalis embryos. Antibodies obtained from immunization with either NGSKYDPVSK or PLLNPQPDAN epitopes detected a single band consistent with Ci-FGFR (predicted molecular weight: 76kD). Specificity was confirmed by colocalization of anti- FGFR signal and Venus fluorescence in Mesp>FGFR:Venus embryos. However, our FGFR antibody was not sufficiently sensitive to monitor in vivo localization (data not shown).

10 Statistical analysis. In all graphs, error bars represent standard error of mean (SEM). Significance was determined using Student s t-tests with two-tailed distributions in Microsoft Excel. Data expressed as a percentage or ratio was transformed prior to statistical analysis.

11 Supplemental References Boucrot, E., and Kirchhausen, T. (2007). Endosomal recycling controls plasma membrane area during mitosis. Proceedings of the National Academy of Sciences of the United States of America 104, Boucrot, E., Howes, M.T., Kirchhausen, T., and Parton, R.G. (2011). Redistribution of caveolae during mitosis. Journal of Cell Science 124, Pellinen, T., Tuomi, S., Arjonen, A., Wolf, M., Edgren, H., Meyer, H., Grosse, R., Kitzing, T., Rantala, J.K., and Kallioniemi, O. (2008). Integrin Trafficking Regulated by Rab21 Is Necessary for Cytokinesis. Developmental Cell 15,

Fig. S1. The tail of KHC is important for Gurken localization. (A-C) Gurken in st9 khc 27 mutant oocytes (GLC) containing KHCGFP transgenes.

Fig. S1. The tail of KHC is important for Gurken localization. (A-C) Gurken in st9 khc 27 mutant oocytes (GLC) containing KHCGFP transgenes. Fig. S1. The tail of KHC is important for Gurken localization. (A-C) Gurken in st9 khc 27 mutant oocytes (GLC) containing KHCGFP transgenes. A) KHC1-975 rescues Gurken localization, to a crescent at the

More information

Supplemental Information. McBrayer et al. Supplemental Data

Supplemental Information. McBrayer et al. Supplemental Data 1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were

More information

Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study.

Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. 1 Supplemental data Supplemental Fig. S1. The schematic diagrams of the expression constructs used in this study. Supplemental Fig. S2. Ingenuity Pathway Analysis (IPA) of the 56 putative caspase substrates

More information

SUPPLEMENTARY DATA 1

SUPPLEMENTARY DATA 1 SUPPLEMENTARY DATA 1 Supplementary Figure S1. Overexpression of untagged Ago2 inhibits the nuclear transport of the dotted foci of GFP-signal of myc-gfp-tnrc6a-nes-mut. (A C) HeLa cells expressing myc-gfp-tnrc6a-nes-mut

More information

Interphase (A) and mitotic (B) D16 cells were plated on concanavalin A and processed for

Interphase (A) and mitotic (B) D16 cells were plated on concanavalin A and processed for E07-10-1069 Rogers SUPPLEMENTARY DATA Supplemental Figure 1. Interphase day-7 control and γ-tubulin23c RNAi-treated S2 cells stained for MTs (green), γ-tubulin (red), and DNA (blue). Scale, 5μm. Supplemental

More information

Fig. S1. Identification of CRMs with activity in Ci-Tbx2/3 expression domains outside the notochord. B-F

Fig. S1. Identification of CRMs with activity in Ci-Tbx2/3 expression domains outside the notochord. B-F Fig. S1. Identification of CRMs with activity in Ci-Tbx2/3 expression domains outside the notochord. (A) Top: map of the Ci- Tbx2/3 locus. Teal rectangles and lines denote exons and introns, respectively.

More information

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material

J. Cell Sci. 128: doi:10.1242/jcs.164566: Supplementary Material Figure S1. Microtubule and microfilament drug treatments severely interfere with mitotic spindle morphology, length and positioning. (A) GFP-fused lamin-a/c, LAP2 or BAF1 localizes to the spindle and all

More information

Chapter 7. Physical interaction between Jamb and Jamc is necessary for myoblast fusion. Summary

Chapter 7. Physical interaction between Jamb and Jamc is necessary for myoblast fusion. Summary Chapter 7 Physical interaction between Jamb and Jamc is necessary for myoblast fusion Summary In this chapter I describe a series of transplant experiments designed to further elucidate the function and

More information

Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average

Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average Supplementary Figure 1 Characterization of 5xFAD derived hippocampal cultures. A-B) Average total numbers of cells per hippocampus as well as average total numbers of cells per field of view were similar

More information

!!!!!!!!!!!!!!!!!!!!!!!!!!

!!!!!!!!!!!!!!!!!!!!!!!!!! Figure S7 cdl-1 3'UTR gld-1 binding site (4..10) let-7 binding site (326..346) Figure Legends Figure S1. gld-1 genetically interacts with nhl-2 and vig-1 during germline development. (A) nhl-2(ok818) enhances

More information

I. What is the structure of the plasma membrane and what functions does it make possible?

I. What is the structure of the plasma membrane and what functions does it make possible? Subquestions: I. What is the structure of the plasma membrane and what functions does it make possible? A. What is the structure of the membrane? B. What are the following terms, how does the membrane

More information

The Cell Membrane Lecture Outline Introduction The Fluid Mosaic Model of the Cell Membrane

The Cell Membrane Lecture Outline Introduction The Fluid Mosaic Model of the Cell Membrane The Cell Membrane Lecture Outline Introduction The Fluid Mosaic Model of the Cell Membrane Structure of Phospholipids - The Amphipathic Nature of Phospholipids Asymmetry of Lipid Bilayer Micelles: An Alternative

More information

Cell Biology Questions and Learning Objectives

Cell Biology Questions and Learning Objectives Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate

More information

Supplemental Figure Legends and References

Supplemental Figure Legends and References Targeting novel Integrative Nuclear FGFR1 Signaling by nanoparticle-mediated gene transfer stimulates neurogenesis in adult brain Ewa K. Stachowiak, Indrajit Roy, Yu-Wei Lee, Mariolina Capacchietti, John

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/339/ra80/dc1 Supplementary Materials for Manipulation of receptor oligomerization as a strategy to inhibit signaling by TNF superfamily members Julia T. Warren,

More information

FGF-1 as Cosmetic Supplement

FGF-1 as Cosmetic Supplement FGF-1 as Cosmetic Supplement Ing-Ming Chiu, Ph.D. Professor, Internal Medicine and Molecular and Cellular Biochemistry The Ohio State University Columbus, Ohio, U.S.A. GENTEON USA Fibroblast Growth Factor

More information

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small

The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small The immune response Antibodies Antigens Epitopes (antigenic determinants) the part of a protein antigen recognized by an antibody Haptens small molecules that can elicit an immune response when linked

More information

3.3 Cell Membrane (p. 81)

3.3 Cell Membrane (p. 81) Name Bio PreAP/GT 3.3 Cell Membrane (p. 81) Cell Membranes are composed of two phospholipid layers. The cell membrane, or the membrane, forms a boundary between a cell and the outside environment and controls

More information

How to construct transgenic mice

How to construct transgenic mice How to construct transgenic mice Sandra Beer-Hammer Autumn School 2010 Bad Schandau Methods additional genetic information transgenic mouse line gene inactivation gene-deficient knockout mouse line Jak2

More information

Supplemental Figure legends Supplemental Figure 1. Smc3 depleted cells enter mitosis despite unrepaired DNA DSBs. HeLa cells were synchronised by double thymidine arrest and were transfected with sirnas

More information

Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons

Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons Neuron, Volume 70 Supplemental Information Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons Sung E. Kwon and Edwin R. Chapman Supplemental Figure Legends Figure

More information

Investigating the role of a Cryptosporidium parum apyrase in infection

Investigating the role of a Cryptosporidium parum apyrase in infection Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase

More information

Zebrafish Chemical Screens

Zebrafish Chemical Screens Zebrafish Chemical Screens 1 Historical look at zebrafish chemical screens 2 The effects of AAF on embryonic development in relation to its carcinogenic role 3 First generation Screens HISAOKA, K. K. (1958).

More information

The Cell: Organelle Diagrams

The Cell: Organelle Diagrams The Cell: Organelle Diagrams Fig 7-4. A prokaryotic cell. Lacking a true nucleus and the other membrane-enclosed organelles of the eukaryotic cell, the prokaryotic cell is much simpler in structure. Only

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry CD3/TCR stimulation and surface detection Stimulation of HPB-ALL cells with the anti-cd3 monoclonal antibody OKT3 was performed as described 3. In brief, antibody-coated plates were prepared by incubating

More information

Image Processing with. ImageJ. Biology. Imaging

Image Processing with. ImageJ. Biology. Imaging Image Processing with ImageJ 1. Spatial filters Outlines background correction image denoising edges detection 2. Fourier domain filtering correction of periodic artefacts 3. Binary operations masks morphological

More information

The Journal of Experimental Medicine

The Journal of Experimental Medicine [ID]FIGS1[/ID] [ID]FIGS2[/ID] [ID]FIGS3[/ID] [ID]FIGS4[/ID] [ID]FIGS5[/ID] [ID]FIGS6[/ID] [ID]TBLS1[/ID] [ID]TBLS2[/ID] SUPPLEMENTAL MATERIAL Wolf et al., http://www.jem.org/cgi/content/full/jem.20101470/dc1

More information

Expression and characterization of protocadherin LKC in mammalian cells

Expression and characterization of protocadherin LKC in mammalian cells Aus dem Institut für Physiologische Chemie der Tierärztlichen Hochschule Hannover Expression and characterization of protocadherin LKC in mammalian cells INAUGURAL-DISSERTATION zur Erlangung des Grades

More information

growth and tissue repair in multicellular organisms (mitosis)

growth and tissue repair in multicellular organisms (mitosis) Cell division: mitosis and meiosis I. Cell division -- introduction - roles for cell division: reproduction -- unicellular organisms (mitosis) growth and tissue repair in multicellular organisms (mitosis)

More information

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng

More information

EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN

EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN DATA SUPPLEMENT EXPRESSION OF TUMOR-DERIVED VASCULAR ENDOTHELIAL GROWTH FACTOR AND ITS RECEPTORS IS ASSOCIATED WITH OUTCOME IN EARLY SQUAMOUS CELL CARCINOMA OF THE LUNG María J. Pajares et al. PATIENTS

More information

Single cell cloning of suspension cells with Calcein-AM and the Cellavista System

Single cell cloning of suspension cells with Calcein-AM and the Cellavista System Single cell cloning of suspension cells with Calcein-AM and the Cellavista System Introduction Single cell cloning (SCC) represents a critical step in cell line development for the production of biopharmaceuticals.

More information

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes Outlines Brief introduction of OriGene s mission on gene-centric product solution. TrueMAB monoclonal antibody

More information

Innate Immunity. Insects rely solely on an innate immune system for defense against infection

Innate Immunity. Insects rely solely on an innate immune system for defense against infection Innate Immunity Insects rely solely on an innate immune system for defense against infection The importance of mammalian innate immunity has only recently become appreciated The innate immune response

More information

BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT

BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY BMLS II / B Pharm II / BDS II VJ Temple

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

The Lipid Bilayer Is a Two-Dimensional Fluid

The Lipid Bilayer Is a Two-Dimensional Fluid The Lipid Bilayer Is a Two-Dimensional Fluid The aqueous environment inside and outside a cell prevents membrane lipids from escaping from bilayer, but nothing stops these molecules from moving about and

More information

C. elegans Vulval Development:

C. elegans Vulval Development: C. elegans Vulval Development: Induction at single cell resolution The worm is born with 12 ectodermal P cells along the ventral midline of the body. Anterior Posterior 1 2 3 4 5 6 7 8 9 10 11 12 C. elegans

More information

2. Discrete units of hereditary information consisting of duplicated DNA are called.

2. Discrete units of hereditary information consisting of duplicated DNA are called. LAB TOPIC 7 BSC 2010L (Principles of Biology 1 Laboratory, Professor Chiappone) MITOSIS AND MEIOSIS (Investigating Biology, 7 th edition) PRACTICE QUIZ QUESTIONS 1. DNA is found in structures called. (a)

More information

Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms

Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms Antigenic variation in Plasmodium falciparum : Erythrocyte invasion and immune escape mechanisms Introduction Why does immunity to malaria take so long to develop? The parasite s survival depends on its

More information

(From the Department of Anatomy, Harvard Medical School, Boston)

(From the Department of Anatomy, Harvard Medical School, Boston) THE FINE STRUCTURE OF THE ELECTRIC ORGAN OF THE ELECTRIC EEL AND TORPEDO RAY* PRELIMINARY COMMUNICATION BY JOHN H. LUFT, M.D. (From the Department of Anatomy, Harvard Medical School, Boston) PLATE 76 Electric

More information

Online Microscope Images Toolkit

Online Microscope Images Toolkit Online Microscope Images Toolkit Larry Johnson, PhD Partnership for Environmental Education and Rural Health (PEER) peer.tamu.edu YouTube: VIBS Histology Veterinary Integrative Biosciences Texas A & M

More information

Unit 2: Cells, Membranes and Signaling CELL MEMBRANE. Chapter 5 Hillis Textbook

Unit 2: Cells, Membranes and Signaling CELL MEMBRANE. Chapter 5 Hillis Textbook Unit 2: Cells, Membranes and Signaling CELL MEMBRANE Chapter 5 Hillis Textbook HOW DOES THE LAB RELATE TO THE NEXT CHAPTER? SURFACE AREA: the entire outer covering of a cell that enables materials pass.

More information

THIS IS A NEW SPECIFICATION MODIFIED LANGUAGE

THIS IS A NEW SPECIFICATION MODIFIED LANGUAGE THIS IS A NEW SPECIFICATION ADVANCED SUBSIDIARY GCE BIOLOGY Cells, Exchange and Transport F211 * OCE / 1 0512* Candidates answer on the question paper OCR Supplied Materials: Insert (Inserted) Other Materials

More information

Recognition of T cell epitopes (Abbas Chapter 6)

Recognition of T cell epitopes (Abbas Chapter 6) Recognition of T cell epitopes (Abbas Chapter 6) Functions of different APCs (Abbas Chapter 6)!!! Directon Routes of antigen entry (Abbas Chapter 6) Flow of Information Barrier APCs LNs Sequence of Events

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Lecture 2 The plasma membrane

Lecture 2 The plasma membrane Lecture 2 The plasma membrane Plasma membranes: 1. Lipid composition of cell membranes 2. Singer and Nicolson fluid mosaic model 3. Proteins associated with the plasma membrane can be integral or peripheral

More information

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development

Overview. Transcriptional cascades. Amazing aspects of lineage plasticity. Conventional (B2) B cell development Overview B cell development Transcriptional cascades Amazing aspects of lineage plasticity Conventional (B2) B cell development What happens to an autoreactive B cell? B1 vs B2 cells Key anatomical sites

More information

1.1.2. thebiotutor. AS Biology OCR. Unit F211: Cells, Exchange & Transport. Module 1.2 Cell Membranes. Notes & Questions.

1.1.2. thebiotutor. AS Biology OCR. Unit F211: Cells, Exchange & Transport. Module 1.2 Cell Membranes. Notes & Questions. thebiotutor AS Biology OCR Unit F211: Cells, Exchange & Transport Module 1.2 Cell Membranes Notes & Questions Andy Todd 1 Outline the roles of membranes within cells and at the surface of cells. The main

More information

Basic Intensity Quantification with ImageJ

Basic Intensity Quantification with ImageJ Basic Intensity Quantification with ImageJ Pretty pictures are nice, but many times we need to turn our images into quantifiable data. ImageJ is useful for getting information from images, including pixel

More information

Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation

Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation Identification of rheumatoid arthritis and osterthritis patients by transcriptome-based rule set generation Bering Limited Report generated on September 19, 2014 Contents 1 Dataset summary 2 1.1 Project

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Prism 6 Step-by-Step Example Linear Standard Curves Interpolating from a standard curve is a common way of quantifying the concentration of a sample.

Prism 6 Step-by-Step Example Linear Standard Curves Interpolating from a standard curve is a common way of quantifying the concentration of a sample. Prism 6 Step-by-Step Example Linear Standard Curves Interpolating from a standard curve is a common way of quantifying the concentration of a sample. Step 1 is to construct a standard curve that defines

More information

Recognise phagocytes and lymphocytes under the light microscope;

Recognise phagocytes and lymphocytes under the light microscope; Immunity The immune system Vaccination Learning Objective Recognise phagocytes and lymphocytes under the light microscope; The following micrographs show as to how different types of phagocytes and lymphocytes

More information

Using Digital Photography to Supplement Learning of Biotechnology. Methods

Using Digital Photography to Supplement Learning of Biotechnology. Methods RESEARCH ON LEARNING Using Digital Photography to Supplement Learning of Biotechnology Fran n orf l u s AbstrAct The author used digital photography to supplement learning of biotechnology by students

More information

Cell Division Mitosis and the Cell Cycle

Cell Division Mitosis and the Cell Cycle Cell Division Mitosis and the Cell Cycle A Chromosome and Sister Chromatids Key Points About Chromosome Structure A chromosome consists of DNA that is wrapped around proteins (histones) and condensed Each

More information

BSC2085L What you need to know sheet Unit #1 (Manual exercises #1, 4, 8, 6A, & 7) BSC2085L Website:

BSC2085L What you need to know sheet Unit #1 (Manual exercises #1, 4, 8, 6A, & 7) BSC2085L Website: BSC2085L What you need to know sheet Unit #1 (Manual exercises #1, 4, 8, 6A, & 7) BSC2085L Website: http://faculty.tcc.fl.edu/scma/aplab/index.htm Manual Exer. # & Lab Manual Reference Pages Relevant Lab

More information

REGENERATIVE BIOLOGY AND MEDICINE: RESEARCH OPPORTUNITIES FOR PHYSICISTS, ENGINEERS, MATHEMATICIANS

REGENERATIVE BIOLOGY AND MEDICINE: RESEARCH OPPORTUNITIES FOR PHYSICISTS, ENGINEERS, MATHEMATICIANS REGENERATIVE BIOLOGY AND MEDICINE: RESEARCH OPPORTUNITIES FOR PHYSICISTS, ENGINEERS, MATHEMATICIANS David L. Stocum Department of Biology And Center for Regenerative Biology and Medicine Indiana University-Purdue

More information

Grade 9 Mathematics Unit 3: Shape and Space Sub Unit #1: Surface Area. Determine the area of various shapes Circumference

Grade 9 Mathematics Unit 3: Shape and Space Sub Unit #1: Surface Area. Determine the area of various shapes Circumference 1 P a g e Grade 9 Mathematics Unit 3: Shape and Space Sub Unit #1: Surface Area Lesson Topic I Can 1 Area, Perimeter, and Determine the area of various shapes Circumference Determine the perimeter of various

More information

An Overview of Cells and Cell Research

An Overview of Cells and Cell Research An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism

More information

Key Topics What will ALL students learn? What will the most able students learn?

Key Topics What will ALL students learn? What will the most able students learn? 2013 2014 Scheme of Work Subject MATHS Year 9 Course/ Year Term 1 Key Topics What will ALL students learn? What will the most able students learn? Number Written methods of calculations Decimals Rounding

More information

Principles of Flowcytometry

Principles of Flowcytometry Objectives Introduction to Cell Markers: Principles of Flowcytometry Michelle Petrasich NZIMLS Scientific Meeting August 24, 2010, Paihia What are cell markers How do we detect them Production of Monoclonal

More information

1.1.1 Cell Structure. Relevant Past Paper Questions. Condensed Notes By Specification Point. 2013 January 5 e f i j. 2012 June 2 e f g i

1.1.1 Cell Structure. Relevant Past Paper Questions. Condensed Notes By Specification Point. 2013 January 5 e f i j. 2012 June 2 e f g i 1.1.1 Cell Structure Relevant Past Paper Questions Paper Question Specification point(s) tested 2013 January 5 e f i j 2012 June 2 e f g i 2012 January 4 a b d f 2011 June 1 part a only f 2011 January

More information

Cell Growth and Reproduction Module B, Anchor 1

Cell Growth and Reproduction Module B, Anchor 1 Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients

More information

+ - bcma_03. Materiale per uso didattico 1. Kinesin light chain Kinesin heavy chain Kinesin heavy chain Kinesin light chain. tetratricopeptide repeat

+ - bcma_03. Materiale per uso didattico 1. Kinesin light chain Kinesin heavy chain Kinesin heavy chain Kinesin light chain. tetratricopeptide repeat p.959-970 Kinesin light chain Kinesin heavy chain Kinesin heavy chain Kinesin light chain + - tetratricopeptide repeat Zona di possibile interazione con cargo Materiale per uso didattico 1 JIP-1 COOH-term

More information

The Nucleus: DNA, Chromatin And Chromosomes

The Nucleus: DNA, Chromatin And Chromosomes The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural

More information

Basic Characteristics of Cells. Cell Structure and Function. Each Cell Has Three Primary Regions. Basic Characteristics of Cells. The Plasma Membrane

Basic Characteristics of Cells. Cell Structure and Function. Each Cell Has Three Primary Regions. Basic Characteristics of Cells. The Plasma Membrane Basic Characteristics of Cells Cell Structure and Function Chapter 3 Smallest living subdivision of the human body Diverse in structure and function Small Basic Characteristics of Cells Each Cell Has Three

More information

Anatomy PHL 212. By Dr Tajdar Husain Khan

Anatomy PHL 212. By Dr Tajdar Husain Khan Anatomy PHL 212 By Dr Tajdar Husain Khan Overview of Anatomy Anatomy(from the Greek word anatome,"dissection") is a branch of natural science dealing with the structural organization of living things The

More information

Making the switch to a safer CAR-T cell therapy

Making the switch to a safer CAR-T cell therapy Making the switch to a safer CAR-T cell therapy HaemaLogiX 2015 Technical Journal Club May 24 th 2016 Christina Müller - chimeric antigen receptor = CAR - CAR T cells are generated by lentiviral transduction

More information

Physiology of Animal Cells. Department of Animal Science National Chung-Hsing University Pin-Chi Tang

Physiology of Animal Cells. Department of Animal Science National Chung-Hsing University Pin-Chi Tang Physiology of Animal Cells Department of Animal Science National Chung-Hsing University Pin-Chi Tang 1 Reference Textbooks Cell Biology 2002 by Thomas D. Pollard and William C. Earnshaw Molecular Biology

More information

Cell Cycle and Mitosis

Cell Cycle and Mitosis Cell Cycle and Mitosis THE CELL CYCLE The cell cycle, or cell-division cycle, is the series of events that take place in a eukaryotic cell between its formation and the moment it replicates itself. These

More information

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION GEOMETRY. Wednesday, June 19, :15 a.m. to 12:15 p.m., only.

The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION GEOMETRY. Wednesday, June 19, :15 a.m. to 12:15 p.m., only. GEOMETRY The University of the State of New York REGENTS HIGH SCHOOL EXAMINATION GEOMETRY Wednesday, June 19, 2013 9:15 a.m. to 12:15 p.m., only Student Name: School Name: The possession or use of any

More information

Prostaglandin E2 Enhances Human Cord Blood Stem. Cell Xenotransplants and Shows Long-Term Safety. in Preclinical Nonhuman Primate Transplant Models

Prostaglandin E2 Enhances Human Cord Blood Stem. Cell Xenotransplants and Shows Long-Term Safety. in Preclinical Nonhuman Primate Transplant Models Cell Stem Cell, Volume 8 Supplemental Information Prostaglandin E2 Enhances Human Cord Blood Stem Cell Xenotransplants and Shows Long-Term Safety in Preclinical Nonhuman Primate Transplant Models Wolfram

More information

How do changes in dimensions of similar geometric figures affect the perimeters and the areas of the figures? ACTIVITY: Creating Similar Figures

How do changes in dimensions of similar geometric figures affect the perimeters and the areas of the figures? ACTIVITY: Creating Similar Figures .6 Perimeters and Areas of Similar Figures How do changes in dimensions of similar geometric figures affect the perimeters and the areas of the figures? ACTIVITY: Creating Similar Figures Work with a partner.

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Chapter 12: The Cell Cycle

Chapter 12: The Cell Cycle Name Period Chapter 12: The Cell Cycle Overview: 1. What are the three key roles of cell division? State each role, and give an example. Key Role Reproduction Growth and development Tissue removal Example

More information

Cellular Reproduction

Cellular Reproduction 9 Cellular Reproduction section 1 Cellular Growth Before You Read Think about the life cycle of a human. On the lines below, write some of the stages that occur in the life cycle of a human. In this section,

More information

What makes cells different from each other? How do cells respond to information from environment?

What makes cells different from each other? How do cells respond to information from environment? What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

Cell Cycle and Mitosis Review

Cell Cycle and Mitosis Review Cell Cycle and Mitosis Review This spot that holds the 2 chromatid copies together is called a The phase of the cell cycle in which cells stop dividing all together. Cell division in bacteria cells is

More information

CAMI Education linked to CAPS: Mathematics

CAMI Education linked to CAPS: Mathematics - 1 - TOPIC 1.1 Whole numbers _CAPS curriculum TERM 1 CONTENT Mental calculations Revise: Multiplication of whole numbers to at least 12 12 Ordering and comparing whole numbers Revise prime numbers to

More information

Notch 1 -dependent regulation of cell fate in colorectal cancer

Notch 1 -dependent regulation of cell fate in colorectal cancer Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1

More information

4.1 3T12 and 312 are immortalized cell lines with transforming potential:

4.1 3T12 and 312 are immortalized cell lines with transforming potential: DISCUSSION CHAPTER 4 4.1 3T12 and 312 are immortalized cell lines with transforming potential: Transformation of a normal cell with finite number of divisions into a tumorigenic cell of potentially infinite

More information

THE JOURNAL OF CELL BIOLOGY

THE JOURNAL OF CELL BIOLOGY Supplemental Material Goldoni et al., http://www.jcb.org/cgi/content/full/jcb.200901129/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Specific high affinity interaction between decorin and Met-Fc. (A) Ligand-binding

More information

1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells

1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells Cell Growth and Reproduction 1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells A. is half of that of the parent cell. B. remains the same as in the

More information

Chapter 47: Animal Development

Chapter 47: Animal Development Name Period Overview 1. An organism s development is controlled by the genome of the zygote as well as by molecules from the mother that are in the cytoplasm of the egg. What are these proteins and RNAs

More information

Cell cycle & Mitosis. Cellular Organization of the Genetic Material 2016-06- 13

Cell cycle & Mitosis. Cellular Organization of the Genetic Material 2016-06- 13 Cell cycle & Mitosis Review In unicellular organisms, division of one cell reproduces the entire organism Multicellular organisms depend on cell division for Development from a fertilized cell Growth Repair

More information

If and when cancer cells stop dividing, they do so at random points, not at the normal checkpoints in the cell cycle.

If and when cancer cells stop dividing, they do so at random points, not at the normal checkpoints in the cell cycle. Cancer cells have escaped from cell cycle controls Cancer cells divide excessively and invade other tissues because they are free of the body s control mechanisms. Cancer cells do not stop dividing when

More information

Whole Numbers and Integers (44 topics, no due date)

Whole Numbers and Integers (44 topics, no due date) Course Name: PreAlgebra into Algebra Summer Hwk Course Code: GHMKU-KPMR9 ALEKS Course: Pre-Algebra Instructor: Ms. Rhame Course Dates: Begin: 05/30/2015 End: 12/31/2015 Course Content: 302 topics Whole

More information

A membrane s structure and functions are determined by its constituents: lipids, proteins, and carbohydrates.

A membrane s structure and functions are determined by its constituents: lipids, proteins, and carbohydrates. A membrane s structure and functions are determined by its constituents: lipids, proteins, and carbohydrates. The general design of membranes is known as the fluid mosaic model. Phospholipids form a continuous

More information

Cell Cycle and Mitosis

Cell Cycle and Mitosis Cell Cycle and Mitosis THE CELL CYCLE The cell cycle, or cell-division cycle, is the series of events that take place in a eukaryotic cell between its formation and the moment it replicates itself. These

More information

1 Cornea 6 Macula 2 Lens 7 Vitreous humor 3 Iris 8 Optic disc 4 Conjunctiva 9 Ciliary muscles 5 Sclera 10 Choroid

1 Cornea 6 Macula 2 Lens 7 Vitreous humor 3 Iris 8 Optic disc 4 Conjunctiva 9 Ciliary muscles 5 Sclera 10 Choroid Anatomy and Physiology Quiz 1 Sample Question Answers Use the following table to answer Questions 1 2. 1 Cornea 6 Macula 2 Lens 7 Vitreous humor 3 Iris 8 Optic disc 4 Conjunctiva 9 Ciliary muscles 5 Sclera

More information

Modelling cell motion: From microscopic to macroscopic scale. Luigi Preziosi Luigi.preziosi@polito.it calvino.polito.it/~preziosi

Modelling cell motion: From microscopic to macroscopic scale. Luigi Preziosi Luigi.preziosi@polito.it calvino.polito.it/~preziosi Modelling cell motion: From microscopic to macroscopic scale Luigi Preziosi Luigi.preziosi@polito.it calvino.polito.it/~preziosi Modelling cell-ecm interaction: An opportunity to present different modelling

More information

Adaptive signals and axon guidance. Chapter Five

Adaptive signals and axon guidance. Chapter Five Adaptive signals and axon guidance Chapter Five Controlling direction of growth Four types of molecular cues: 1. Contact adhesion Regulated by CAMs on growth cone surface 2. Contact repulsion Growth cones

More information

Protein Analysis. -Detection and quantification. Toby M Holmes

Protein Analysis. -Detection and quantification. Toby M Holmes Protein Analysis -Detection and quantification Toby M Holmes Clinical Research Unit UCD school of Medicine and Medical Sciences Mater Misericordiae University Hospital Dublin Protein structure General

More information

Measuring from SEM Micrographs. By Tom Fink

Measuring from SEM Micrographs. By Tom Fink Measuring from SEM Micrographs By Tom Fink A Micrograph is essentially an accumulation of data, for example: Cell diameter Insect Head Width Sensory Hair Length To Measure Structures Off Photographs we

More information

HER2 Testing in Breast Cancer

HER2 Testing in Breast Cancer HER2 Testing in Breast Cancer GAIL H. VANCE, M.D. AGT MEETING JUNE 13, 2014 LOUISVILLE, KENTUCKY No Conflict of Interest to Report Human Epidermal Growth Factor Receptor 2-HER2 Human epidermal growth factor

More information