Scientific Argumentation and Software Significance
|
|
|
- Frederick Clarke
- 5 years ago
- Views:
Transcription
1 Scientific argumentation and software design VJ Carey, Channing Lab, Harvard Medical School BioC 2009 Three case studies in cancer transcriptomics Containers Software reliability Scientific argumentation; Bioconductor s role/gaps 1
2 Possible take-home messages Bioc growth in software packages not matched by growth in experimental data packages the concept is severely underappreciated Formally packaging data (for private development use) early on has various practical benefits A publication generated using a data package will satisfy many key reproducibility and maintainability requirements Packaging discipline can and should be adopted early in the analysis process also EBImage allows you to take published figures and extract underlying numerical data, to reanalyze data that are numerically unavailable 2
3 Case study 1: Dressman JCO
4 4
5 5
6 Irreproducibility following Baggerly et al. (letter, 7(!) vignettes) Much guesswork required to recompute based on supplemental data on Duke web site Sanity check near reproduction of Src activation effect among platinum nonresponders 6
7 7
8 Total non-reproducibility of asserted E2F3 effect Computations as with Src activation signature 8
9 Scientific interchange First inning: Dressman et al: N=83 training, N=36 test samples, 12 cell lines, 1,727-gene predictive model, 2 heatmaps, 4 KM curves, 8 regressions, JCO paper, web site Baggerly et al: 7 vignettes, over 100 supporting files and scripts, JCO letter (.6pp) with 7 major challenges to data and interpretation, web site Second inning: Dressman et al: protest to the officials While it is certainly important to present all information as accurately as possible, and we do regret the errors that were introduced when we generated several of the tables containing supplementary information, these errors do not affect the conclusions of 9
10 the study. A focus on these errors as presented by Baggerly et al is misleading since it suggests they are a contributing factor in the supposed lack of reproducibility, which is not the case. Most importantly, the claim that they cannot reproduce the results of the study, when in fact they did not even try to do so, is an egregious flaw in their commentary. To reproduce means to repeat, using the same methods of analysis as reported. It does not mean to attempt to achieve the same goal of the study but with different methods. Bottom of the second inning: Texas bull-pen exhausted after seven vignettes; Duke pinch-hitters writing ARRA grants rain delay 10
11 Summary of first case study Transcriptome-wide studies are complex this is well-known Supplementary data are symbolically used to emulate wet lab open protocols in this case there were/are errors making the data literally useless for reproducibility (unless forensic methods were adopted) workflow leading to published artifacts (KM curves, heatmaps, regressions) not explicitly available The authors introduce an important obligation on primary authors to facilitate reproducibility: To reproduce means to repeat, using the same methods of analysis as reported. If you purport to do reproducible research, you must facilitate independent repetition To satisfy this condition you must publish the data, the software, and the conditions of use and report extraction 11
12 Case study 2: Michiels random validation method 12
13 Strong impact Findings Estimated signatures (test/train) are unstable For a given dataset, estimated misclassification rates vary according to training set size Five of seven major studies do not classify patients better than chance Michiels paper has, as of April , been cited 270 times (ISI Web of Science), with citations repeating concerns about well-documented signature instability, divergent results, and, in one case, indicating that microarraybased findings are not robust to the mildest of perturbations (Ramasamy and Mondry, 2008). 13
14 Two confirmations and a disconfirmation black my estimates of MC(T) 14
15 Summary on Michiels no explicit effort to foster reproducibility (no datasets, software, scripts) to explore the work we must solve problems of data acquisition algorithm implementation (fewer than 20 lines of reasonably generic R) results juxtaposition (EBImage capture of TIFF extract of statistical graphics) What went wrong with Pomeroy? No clue. 15
16 Case study 3: Ben-Porath and stemness of aggressive breast cancer tumors 16
17 Data acquisition and translation Six studies: NEJM, JNCI, PNAS, Cancer Cell, Lancet, Clinical Cancer Research Some overlapping cases identified and removed; harmonize phenotypic labeling Translate reporters in use to Entrez Gene ids Form knowledge-based gene sets 17
18 Observation: Specific clinical classes associated with high relative expression of ES and allied gene sets 18
19 Metaanalytic p < for ES+ effect on survival 19
20 Reproducibility considerations All processed expression data and clinical annotations are on line Genomica settings? Inheritance of nonreproducibility from foundational studies? Cost to make one of the survival figures independently reproducible? Probably low, but yet to be attempted... What are the benefits? More restful sleep, easier extension by other researchers, introduction of versioning 20
21 Summary of case studies Commitments to concrete reproducibility of computational analysis of microarrays are generally weak or nonexistent Data-sharing obligations may be symbolically met without verification Strong positive and negative claims move into literature and medicine regardless of demonstrable unreliability Incentives for supporting independent repetition of analyses are weak can be difficult maybe no one will ever use it 21
22 Containers main families Metadata: databases, tables, tracks; annotation networks Data: tables, objects, packages Software: functions, methods under OOP discipline, packages Workflows culminating in arguments/manuscripts container concept not well-adapted to these? Web services: assume good container designs for all the constituents above Bioconductor premise: support meaningful work on commodity hardware without assuming WWW connectivity compact computational environment, counter to apparently prevailing view that a web site can suffice for supporting reproducibility 22
23 Containers main properties self-describing, self-documenting contents have guaranteed structure/datatypes API formal specs on feasible interrogations and range of replies can be programmatically validated 23
24 Containers examples in Bioconductor metadata: AnnDbBimap (used for org.hs.eg.db, GO.db), GeneSet (GSEABase), data.frame (SNPlocs.Hsapiens), PDInfoPkgSeed (pd.genomewidesnp.6) and the associated packages themselves data: eset, ExpressionSet, excghset, snp.matrix, smlset, methylumiset, graph software: packages, task views workflow culminating in argument: Sweave vignette 24
25 methylumi container examples GoldenGate > mldat Object Information: MethyLumiSet (storagemode: environment) assaydata: 1536 features, 10 samples element names: Avg_NBEADS, BEAD_STDERR, betas, methylated, pvals, phenodata samplenames: M_1, M_2,..., F_10 (10 total) varlabels and varmetadata description: sampleid: sampleid SampleLabel: SampleLabel Sample: Sample Gender: Gender featuredata featurenames: AATK_E63_R, AATK_P519_R,..., ZP3_P220_F (1536 tota fvarlabels and fvarmetadata description: TargetID: NA ProbeID: NA 25
26 ...:... PRODUCT: NA (17 total) experimentdata: use 'experimentdata(object)' Annotation: Major Operation History: submitted finished :33: :33:30 1 methylumir(filename = system.file("extdata/exampledata.samples.txt 26
27 > fdata(mldat)[100:101, ] TargetID ProbeID SEARCH_KEY PROBE_ID GID BCL2L2_E172_F BCL2L2_E172_F 5384 BCL2L2 BCL2L2_E172_F BCL2L2_P280_F BCL2L2_P280_F 4235 BCL2L2 BCL2L2_P280_F ACCESSION SYMBOL GENE_ID CHROMOSOME REFSEQ CPG_COORDINATE BCL2L2_E172_F NM_ BCL2L BCL2L2_P280_F NM_ BCL2L DIST_TO_TSS CPG_ISLAND BCL2L2_E172_F 172 N BCL2L2_P280_F -280 N INPUT_SEQUENCE BCL2L2_E172_F TTGGGCTGCACTAGGGGGAACCGGGAATAGAGATGGTGTCGG BCL2L2_P280_F CTGGAAAAGTTCAACAAGTGCATGGAACATCGGAAACCTCCTGAAAATGCTAAATT SYNONYM BCL2L2_E172_F BCLW, BCL-W, KIAA0271 BCL2L2_P280_F BCLW, BCL-W, KIAA0271 BCL2L2_E172_F apoptosis regulator BCL-W; go_component: membrane; go_component: BCL2L2_P280_F apoptosis regulator BCL-W; go_component: membrane; go_component: PRODUCT BCL2L2_E172_F BCL2-like 2 protein 27
28 BCL2L2_P280_F BCL2-like 2 protein 28
29 Containers and sanity checks do Illumina s input CPG addresses agree with hg18? > c14 = Hsapiens$chr14 > matchpattern(as.character(fdata(mldat)["bcl2l2_e172_f", "INPUT_SEQUENCE"]), c14) Views on a letter DNAString subject subject: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN views: start end width [1] [TTGGGCTGCACTAGGGGGAACCGGGAATAGAGATGGTGTCGG] > matchpattern(as.character(fdata(mldat)["bcl2l2_p280_f", "INPUT_SEQUENCE"]), c14) Views on a letter DNAString subject subject: NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN...NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN views: start end width [1] [CTGGAAAAGTTCAACAAGTGCATG...AAACCTCCTGAAAATGCTAAATT > GGpdict = PDict(substr(as.character(fData(mldat)[,"INPUT_SEQUENCE"]),1,41)) > GGpdict 29
30 TB_PDict object of length 1536 and width 41 (preprocessing algo="actree2") > sum(countpdict(ggpdict, c14)) [1] 37 > sum(fdata(mldat)[,"chromosome"]==14) [1] 37 30
31 > getvalidity(getclass(class(mldat))) function (object) { msg <- Biobase:::validMsg(NULL, Biobase:::isValidVersion(object, "eset")) msg <- Biobase:::validMsg(msg, assaydatavalidmembers(assaydata(object), c("betas"))) if (is.null(msg)) TRUE else msg } <environment: namespace:methylumi> 31
32 Foils to the container discipline Common student request after learning about Expression- Sets: These are very nice but how do I get the data out to disk so I can run my perl programs on them? MLInterfaces: explicitly addresses holistic use of containers but ignored by colleagues in favor of matrix exports to functions formulae: y ~ f(x1, x2,...) g(z1, z2,...) powerful idiom, can bind gene, gene sets, SNPs, addresses, sequences, graphs to elements as desired not often used; instead, take data out of the container as vectors and put into ordinary formulae interface contracts: e.g., predict(), resid() should be im- 32
33 plemented wherever suitable 33
34 Software reliability and reliability of scientific argument software reliability measures face validity (usually not realistic) unit testing results (important, biased) recovery of truth in applications where truth is known (good, rare in bioinformatics) interoperability, success of integrated applications (good, self-consistent behavior established, truth very rarely known) Disconnect: reliable software and reliable scientific argument Case study 1: each analytic module may have been sound, but processes similar to the admitted mislabeling of records seem to have wrecked the reproducibility of the research Case study 2: computations are simple, but an important application seems to be mistaken; 270+ citations, no audit Case study 3: curves/p-value implications; integrative analysis may inherit errors in previous work of others 34
35 The established vulnerabilities are not in the killer (methodological) applications those get reasonable testing 35
36 What would a solution look like? Every step of the workflow needs to be amenable to testing and verification A compendium in the sense of Gentleman and Temple Lang (SAGMB 2005) combines all needed data and software a general protocol with emphasis on dynamic content, entity that can be interrogated for provenance of any data reference, and modified to alter any computation An R package with functions and scripts specifying computational basis for every data reference in the manuscript an equivalent construction based on some other language 36
37 37
38 38
39 Conclusions Independent reproducibility is a basic requirement Reproducing errors is of no interest, but errors will occur; ergo versioning is essential (R) Packaging discipline is an aid to reproducibility Package construction/maintenance should begin early in the analysis cycle preferably at data capture/qa activities Versioning, self-describing character, portability secured by any package that is reasonably faithful to WRE guidelines Interoperability can be used to avoid challenges due to data volume (SQLite, web service access, caching of intermediate data) Each investigator needs to commit to the discipline for their own sake benefits arguably exceed costs every step of the way bioc should take the lead by publicizing exemplars in the hardest areas (data packages with vignettes that recover/disconfirm accepted findings) 39
Package GEOquery. August 18, 2015
Type Package Package GEOquery August 18, 2015 Title Get data from NCBI Gene Expression Omnibus (GEO) Version 2.34.0 Date 2014-09-28 Author Maintainer BugReports
Interacting with local and remote data repositories using the stashr package
Computational Statistics DOI 10.1007/s00180-008-0124-x ORIGINAL PAPER Interacting with local and remote data repositories using the stashr package Sandrah P. Eckel Roger D. Peng Received: 14 March 2007
Normalization of RNA-Seq
Normalization of RNA-Seq Davide Risso Modified: April 27, 2012. Compiled: April 27, 2012 1 Retrieving the data Usually, an RNA-Seq data analysis from scratch starts with a set of FASTQ files (see e.g.
Analysis of Bead-summary Data using beadarray
Analysis of Bead-summary Data using beadarray Mark Dunning October 13, 2015 Contents 1 Introduction 2 2 feature and pheno data 3 3 Subsetting the data 4 4 Exploratory analysis using boxplots 7 4.1 A note
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
Introduction to Pattern Recognition
Introduction to Pattern Recognition Selim Aksoy Department of Computer Engineering Bilkent University [email protected] CS 551, Spring 2009 CS 551, Spring 2009 c 2009, Selim Aksoy (Bilkent University)
Package cgdsr. August 27, 2015
Type Package Package cgdsr August 27, 2015 Title R-Based API for Accessing the MSKCC Cancer Genomics Data Server (CGDS) Version 1.2.5 Date 2015-08-25 Author Anders Jacobsen Maintainer Augustin Luna
AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
Statistics and the Search for Scientific Truth
Statistics and the Search for Scientific Truth Martin Hazelton 1 Institute of Fundamental Sciences Massey University 11 November 2015 1 Presenter: [email protected] U3A, November 2015 1 / 30 Science
Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences
Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences WP11 Data Storage and Analysis Task 11.1 Coordination Deliverable 11.2 Community Needs of
Scottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Creating a New Annotation Package using SQLForge
Creating a New Annotation Package using SQLForge Marc Carlson, Herve Pages, Nianhua Li February 4, 2016 1 Introduction The AnnotationForge package provides a series of functions that can be used to build
Gene set and data preparation
Gene set and data preparation Weijun Luo (luo weijun AT yahoo.com) April 16, 2015 1 Introduction In this short tutorial, we cover a few practical issues we frequently come cross in GAGE (Luo et al., 2009)
The Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring
The Scheduled MRM Algorithm Enables Intelligent Use of Retention Time During Multiple Reaction Monitoring Delivering up to 2500 MRM Transitions per LC Run Christie Hunter 1, Brigitte Simons 2 1 AB SCIEX,
Cancer Genomics: What Does It Mean for You?
Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this
Mathematical Models of Supervised Learning and their Application to Medical Diagnosis
Genomic, Proteomic and Transcriptomic Lab High Performance Computing and Networking Institute National Research Council, Italy Mathematical Models of Supervised Learning and their Application to Medical
Software and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University
Software and Methods for the Analysis of Affymetrix GeneChip Data Rafael A Irizarry Department of Biostatistics Johns Hopkins University Outline Overview Bioconductor Project Examples 1: Gene Annotation
Bacterial Transformation Post lab Questions:
Bacterial Transformation Post lab Questions: 1. This graph represents typical bacteria growth and death on any culture plate. This trend occurs in both Luria Broth/ agarose and Luria broth/ Agarose/ Ampicillin/Arabinose
Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data
CMPE 59H Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data Term Project Report Fatma Güney, Kübra Kalkan 1/15/2013 Keywords: Non-linear
ProteinQuest user guide
ProteinQuest user guide 1. Introduction... 3 1.1 With ProteinQuest you can... 3 1.2 ProteinQuest basic version 4 1.3 ProteinQuest extended version... 5 2. ProteinQuest dictionaries... 6 3. Directions for
Information Architecture Planning Template for Health, Safety, and Environmental Organizations
Environmental Conference September 18-20, 2005 The Fairmont Hotel Information Architecture Planning Template for Health, Safety, and Environmental Organizations Presented By: Alan MacGregor ENVIRON International
PPInterFinder A Web Server for Mining Human Protein Protein Interaction
PPInterFinder A Web Server for Mining Human Protein Protein Interaction Kalpana Raja, Suresh Subramani, Jeyakumar Natarajan Data Mining and Text Mining Laboratory, Department of Bioinformatics, Bharathiar
Best Practices in Model Development and Maintenance Adam Rose ([email protected]), Product Manager, XP Solutions
Best Practices in Model Development and Maintenance Adam Rose ([email protected]), Product Manager, XP Solutions adopted from Best practices for software development projects Mike Perks ([email protected]),
A Data Warehouse Case Study
Automated Data Warehouse A Data Warehouse Case Study Abstract Maximizing Decision-making Through Communications, Command and Control of Data from Capture to Presentation of Results. The essential concept
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
R Language Fundamentals
R Language Fundamentals Data Types and Basic Maniuplation Steven Buechler Department of Mathematics 276B Hurley Hall; 1-6233 Fall, 2007 Outline Where did R come from? Overview Atomic Vectors Subsetting
Using Databases in R
Using Databases in R Marc Carlson Fred Hutchinson Cancer Research Center May 20, 2010 Introduction Example Databases: The GenomicFeatures Package Basic SQL Using SQL from within R Outline Introduction
CFSD 21 ST CENTURY SKILL RUBRIC CRITICAL & CREATIVE THINKING
Critical and creative thinking (higher order thinking) refer to a set of cognitive skills or strategies that increases the probability of a desired outcome. In an information- rich society, the quality
msmseda LC-MS/MS Exploratory Data Analysis
msmseda LC-MS/MS Exploratory Data Analysis Josep Gregori, Alex Sanchez, and Josep Villanueva Vall Hebron Institute of Oncology & Statistics Dept. Barcelona University [email protected] October 13,
Network Analysis. BCH 5101: Analysis of -Omics Data 1/34
Network Analysis BCH 5101: Analysis of -Omics Data 1/34 Network Analysis Graphs as a representation of networks Examples of genome-scale graphs Statistical properties of genome-scale graphs The search
Data Provenance. Functional Requirements Document: Developed in Response to the Data Provenance Task Force Recommendations. Version 1.
Data Provenance Functional Requirements Document: Developed in Response to the Data Provenance Task Force Recommendations Version 1.0 May 2015 Version History Version Revision Author Description of Change
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Semantic Search in Portals using Ontologies
Semantic Search in Portals using Ontologies Wallace Anacleto Pinheiro Ana Maria de C. Moura Military Institute of Engineering - IME/RJ Department of Computer Engineering - Rio de Janeiro - Brazil [awallace,anamoura]@de9.ime.eb.br
GC3 Use cases for the Cloud
GC3: Grid Computing Competence Center GC3 Use cases for the Cloud Some real world examples suited for cloud systems Antonio Messina Trieste, 24.10.2013 Who am I System Architect
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis
SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium
Tutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
a measurable difference
Thermo Scientific Cell Analysis Software and Informatics Products a measurable difference for everyone Thermo Scientific HCS Studio Cell Analysis Software Thermo Scientific Store Image and Database Management
Framework for Case Analysis
Framework for Case Analysis Part I Analyzing a Case What is this document? You will be asked throughout your Graduate experience to analyze cases. Because there are many ways to approach cases, the CM
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
GA as a Data Optimization Tool for Predictive Analytics
GA as a Data Optimization Tool for Predictive Analytics Chandra.J 1, Dr.Nachamai.M 2,Dr.Anitha.S.Pillai 3 1Assistant Professor, Department of computer Science, Christ University, Bangalore,India, [email protected]
HowTo: Querying online Data
HowTo: Querying online Data Jeff Gentry and Robert Gentleman May 3, 2016 1 Overview This article demonstrates how you can make use of the tools that have been provided for on-line querying of data resources.
Statistical Operations: The Other Half of Good Statistical Practice
Integrating science, technology and experienced implementation Statistical Operations: The Other Half of Good Statistical Practice Alan Hopkins, Ph.D. Theravance, Inc. Presented at FDA/Industry Statistics
The replication of empirical research is a critical
RESEARCH TECHNICAL COMMENT PSYCHOLOGY Comment on Estimating the reproducibility of psychological science Daniel T. Gilbert, 1 * Gary King, 1 Stephen Pettigrew, 1 Timothy D. Wilson 2 A paper from the Open
Web-Based Genomic Information Integration with Gene Ontology
Web-Based Genomic Information Integration with Gene Ontology Kai Xu 1 IMAGEN group, National ICT Australia, Sydney, Australia, [email protected] Abstract. Despite the dramatic growth of online genomic
Document Image Retrieval using Signatures as Queries
Document Image Retrieval using Signatures as Queries Sargur N. Srihari, Shravya Shetty, Siyuan Chen, Harish Srinivasan, Chen Huang CEDAR, University at Buffalo(SUNY) Amherst, New York 14228 Gady Agam and
CPA SECURITY CHARACTERISTIC SECURE VOIP CLIENT
26579500 CPA SECURITY CHARACTERISTIC SECURE VOIP CLIENT Version 2.0 Crown Copyright 2013 All Rights Reserved UNCLASSIFIED Page 1 About this document This document describes the features, testing and deployment
Language Evaluation Criteria. Evaluation Criteria: Readability. Evaluation Criteria: Writability. ICOM 4036 Programming Languages
ICOM 4036 Programming Languages Preliminaries Dr. Amirhossein Chinaei Dept. of Electrical & Computer Engineering UPRM Spring 2010 Language Evaluation Criteria Readability: the ease with which programs
Chapter 1. Dr. Chris Irwin Davis Email: [email protected] Phone: (972) 883-3574 Office: ECSS 4.705. CS-4337 Organization of Programming Languages
Chapter 1 CS-4337 Organization of Programming Languages Dr. Chris Irwin Davis Email: [email protected] Phone: (972) 883-3574 Office: ECSS 4.705 Chapter 1 Topics Reasons for Studying Concepts of Programming
FOOD FOR THOUGHT Topical Insights from our Subject Matter Experts UNDERSTANDING WHAT IS NEEDED TO PRODUCE QUALITY DATA
FOOD FOR THOUGHT Topical Insights from our Subject Matter Experts UNDERSTANDING WHAT IS NEEDED TO PRODUCE QUALITY DATA The NFL White Paper Series Volume 7, January 2013 Overview and a Scenario With so
THe evolution of analytical lab InForMaTICs
Informatics Strategies for the Convergent Analytical Lab TECHNOLOGY REVIEW In many labs today, the drive to replace paper has begun pitting two systems against each other. The functionality in LIMS, which
PART IV Performance oriented design, Performance testing, Performance tuning & Performance solutions. Outline. Performance oriented design
PART IV Performance oriented design, Performance testing, Performance tuning & Performance solutions Slide 1 Outline Principles for performance oriented design Performance testing Performance tuning General
Demand Generation vs. Marketing Automation David M. Raab Raab Associates Inc.
Demand Generation vs. Marketing Automation David M. Raab Raab Associates Inc. Demand generation systems help marketers to identify, monitor and nurture potential customers. But so do marketing automation
Comparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
Fault Slip Through Measurement in Software Development Process
Fault Slip Through Measurement in Software Development Process Denis Duka, Lovre Hribar Research and Development Center Ericsson Nikola Tesla Split, Croatia [email protected]; [email protected]
ENHANCED CONFIDENCE INTERPRETATIONS OF GP BASED ENSEMBLE MODELING RESULTS
ENHANCED CONFIDENCE INTERPRETATIONS OF GP BASED ENSEMBLE MODELING RESULTS Michael Affenzeller (a), Stephan M. Winkler (b), Stefan Forstenlechner (c), Gabriel Kronberger (d), Michael Kommenda (e), Stefan
Personalized Predictive Medicine and Genomic Clinical Trials
Personalized Predictive Medicine and Genomic Clinical Trials Richard Simon, D.Sc. Chief, Biometric Research Branch National Cancer Institute http://brb.nci.nih.gov brb.nci.nih.gov Powerpoint presentations
Server Load Prediction
Server Load Prediction Suthee Chaidaroon ([email protected]) Joon Yeong Kim ([email protected]) Jonghan Seo ([email protected]) Abstract Estimating server load average is one of the methods that
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Basic Testing Concepts and Terminology
T-76.5613 Software Testing and Quality Assurance Lecture 2, 13.9.2006 Basic Testing Concepts and Terminology Juha Itkonen SoberIT Contents Realities and principles of Testing terminology and basic concepts
How to Plan a Successful Load Testing Programme for today s websites
How to Plan a Successful Load Testing Programme for today s websites This guide introduces best practise for load testing to overcome the complexities of today s rich, dynamic websites. It includes 10
SIPAC. Signals and Data Identification, Processing, Analysis, and Classification
SIPAC Signals and Data Identification, Processing, Analysis, and Classification Framework for Mass Data Processing with Modules for Data Storage, Production and Configuration SIPAC key features SIPAC is
PEER REVIEW HISTORY ARTICLE DETAILS TITLE (PROVISIONAL)
PEER REVIEW HISTORY BMJ Open publishes all reviews undertaken for accepted manuscripts. Reviewers are asked to complete a checklist review form (http://bmjopen.bmj.com/site/about/resources/checklist.pdf)
Data Management Implementation Plan
Appendix 8.H Data Management Implementation Plan Prepared by Vikram Vyas CRESP-Amchitka Data Management Component 1. INTRODUCTION... 2 1.1. OBJECTIVES AND SCOPE... 2 2. DATA REPORTING CONVENTIONS... 2
Introduction. Overview of Bioconductor packages for short read analysis
Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor
> Semantic Web Use Cases and Case Studies
> Semantic Web Use Cases and Case Studies Case Study: Applied Semantic Knowledgebase for Detection of Patients at Risk of Organ Failure through Immune Rejection Robert Stanley 1, Bruce McManus 2, Raymond
Package GSA. R topics documented: February 19, 2015
Package GSA February 19, 2015 Title Gene set analysis Version 1.03 Author Brad Efron and R. Tibshirani Description Gene set analysis Maintainer Rob Tibshirani Dependencies impute
INSTRUCTIONAL MATERIALS ADOPTION Score Sheet I. Generic Evaluation Criteria II. Instructional Content Analysis III. Specific Science Criteria
GRADE: 9-12 VENDOR: Prentice Hall COURSE: Advanced Biology TITLE: Biology (Miller/Levine) COPYRIGHT DATE: 2006 SE ISBN: 0-13-166255-4 (SE) TE ISBN: 0-13-166288-0 (TE) INSTRUCTIONAL MATERIALS ADOPTION Score
ZIMBABWE SCHOOL EXAMINATIONS COUNCIL. COMPUTER STUDIES 7014/01 PAPER 1 Multiple Choice SPECIMEN PAPER
ZIMBABWE SCHOOL EXAMINATIONS COUNCIL General Certificate of Education Ordinary Level COMPUTER STUDIES 7014/01 PAPER 1 Multiple Choice SPECIMEN PAPER Candidates answer on the question paper Additional materials:
International GMP Requirements for Quality Control Laboratories and Recomendations for Implementation
International GMP Requirements for Quality Control Laboratories and Recomendations for Implementation Ludwig Huber, Ph.D. [email protected] Overview GMP requirements for Quality Control laboratories
Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected]
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) [email protected] 1 RNA Transcription to RNA and subsequent
Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova
Using the Grid for the interactive workflow management in biomedicine Andrea Schenone BIOLAB DIST University of Genova overview background requirements solution case study results background A multilevel
#jenkinsconf. Jenkins as a Scientific Data and Image Processing Platform. Jenkins User Conference Boston #jenkinsconf
Jenkins as a Scientific Data and Image Processing Platform Ioannis K. Moutsatsos, Ph.D., M.SE. Novartis Institutes for Biomedical Research www.novartis.com June 18, 2014 #jenkinsconf Life Sciences are
Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation
Identification of rheumatoid arthritis and osterthritis patients by transcriptome-based rule set generation Bering Limited Report generated on September 19, 2014 Contents 1 Dataset summary 2 1.1 Project
Adversary Modelling 1
Adversary Modelling 1 Evaluating the Feasibility of a Symbolic Adversary Model on Smart Transport Ticketing Systems Authors Arthur Sheung Chi Chan, MSc (Royal Holloway, 2014) Keith Mayes, ISG, Royal Holloway
Course on Functional Analysis. ::: Gene Set Enrichment Analysis - GSEA -
Course on Functional Analysis ::: Madrid, June 31st, 2007. Gonzalo Gómez, PhD. [email protected] Bioinformatics Unit CNIO ::: Contents. 1. Introduction. 2. GSEA Software 3. Data Formats 4. Using GSEA 5. GSEA
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
Guide for Data Visualization and Analysis using ACSN
Guide for Data Visualization and Analysis using ACSN ACSN contains the NaviCell tool box, the intuitive and user- friendly environment for data visualization and analysis. The tool is accessible from the
EDASeq: Exploratory Data Analysis and Normalization for RNA-Seq
EDASeq: Exploratory Data Analysis and Normalization for RNA-Seq Davide Risso Modified: May 22, 2012. Compiled: October 14, 2013 1 Introduction In this document, we show how to conduct Exploratory Data
Data deluge (and it s applications) Gianluigi Zanetti. Data deluge. (and its applications) Gianluigi Zanetti
Data deluge (and its applications) Prologue Data is becoming cheaper and cheaper to produce and store Driving mechanism is parallelism on sensors, storage, computing Data directly produced are complex
Data Quality Mining: Employing Classifiers for Assuring consistent Datasets
Data Quality Mining: Employing Classifiers for Assuring consistent Datasets Fabian Grüning Carl von Ossietzky Universität Oldenburg, Germany, [email protected] Abstract: Independent
Chapter 11 Boosting. Xiaogang Su Department of Statistics University of Central Florida - 1 -
Chapter 11 Boosting Xiaogang Su Department of Statistics University of Central Florida - 1 - Perturb and Combine (P&C) Methods have been devised to take advantage of the instability of trees to create
Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey
Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray
Pitfalls and Best Practices in Role Engineering
Bay31 Role Designer in Practice Series Pitfalls and Best Practices in Role Engineering Abstract: Role Based Access Control (RBAC) and role management are a proven and efficient way to manage user permissions.
