Introduction to genetic testing and pharmacogenomics



Similar documents
Electronic Medical Records and Genomics: Possibilities, Realities, Ethical Issues to Consider

These case studies were developed by NHGRI and DO NOT REPRESENT official guidance for FDA regulations. IDE risk determinations will always depend on

NGS and complex genetics

School of Nursing. Presented by Yvette Conley, PhD

The Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins

Duration of Dual Antiplatelet Therapy After Coronary Stenting

Outcome Data, Links to Electronic Medical Records. Dan Roden Vanderbilt University

Bayer Pharma AG Berlin Germany Tel News Release. Not intended for U.S. and UK Media

Bayer Initiates Rivaroxaban Phase III Study to Support Dose Selection According to Individual Benefit-Risk Profile in Long- Term VTE Prevention

Technical Issues in Aggregating and Analyzing Data from Heterogeneous EHR Systems

A Patient s Guide to Primary and Secondary Prevention of Cardiovascular Disease Using Blood-Thinning (Anticoagulant) Drugs

How does genetic testing work?

What is Pharmacogenomics? Personalization of Medications for You! Michigan State Medical Assistants Conference May 6, 2006

How To Identify A Novel Pathway Leading To Myocardial Infarction

Version Module guide. Preliminary document. International Master Program Cardiovascular Science University of Göttingen

Cancer Genomics: What Does It Mean for You?

Your healthcare provider has ordered a Boston Heart Cardiac Risk Assessment

Bayer Extends Clinical Investigation of Xarelto for the Prevention and Treatment of Life-Threatening Blood Clots in Patients with Cancer

Innovation Platform: Sudden Cardiac Death

Guidance for Industry Diabetes Mellitus Evaluating Cardiovascular Risk in New Antidiabetic Therapies to Treat Type 2 Diabetes

Incorporating Research Into Sight (IRIS) Essentia Rural Health Institute Marshfield Clinic Penn State University

New Real-World Evidence Reaffirms Low Major Bleeding Rates for Bayer s Xarelto in Patients with Non-Valvular Atrial Fibrillation

Bayer Extends Clinical Investigation of Rivaroxaban into Important Areas of Unmet Medical Need in Arterial Thromboembolism

ESC/EASD Pocket Guidelines Diabetes, pre-diabetes and cardiovascular disease

Title: Genetics and Hearing Loss: Clinical and Molecular Characteristics

Saving healthcare costs by implementing new genetic risk tests for early detection of cancer and prevention of cardiovascular diseases

KIH Cardiac Rehabilitation Program

GENERAL HEART DISEASE KNOW THE FACTS

EMA Reaffirms Positive Benefit-Risk Balance of Bayer s Xarelto for Stroke Prevention in Patients with Atrial Fibrillation

Implementation of Pharmacogenomics in Clinical Practice: Barriers and Potential Solutions

Genetic testing. The difference diagnostics can make. The British In Vitro Diagnostics Association

Big Data for Population Health and Personalised Medicine through EMR Linkages

Guidance on adverse drug reactions

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Coronary Heart Disease (CHD) Brief

Integration of genomic data into electronic health records

Anticoagulation at the end of life. Rhona Maclean

University of Ulsan College of Medicine, Asan Medical Center on behalf of the REAL-LATE and the ZEST-LATE trial

Vision for the Cohort and the Precision Medicine Initiative Francis S. Collins, M.D., Ph.D. Director, National Institutes of Health Precision

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait

Genomics and Family History Survey Questions Updated March 2007 Compiled by the University of Washington Center for Genomics & Public Health

Prevention of stroke and systemic embolism in adult patients with non-valvular atrial fibrillation (AF) with one or more risk factors

RITMIR024 - STEM CELL RESEARCH IN CARDIOLOGY

9/5/14. Objectives. Atrial Fibrillation (AF)

New Treatments for Stroke Prevention in Atrial Fibrillation. John C. Andrefsky, MD, FAHA NEOMED Internal Medicine Review course May 5 th, 2013

Investor News. Not intended for U.S. and UK media

Cilostazol versus Clopidogrel after Coronary Stenting

Workshop on Establishing a Central Resource of Data from Genome Sequencing Projects

Introductory genetics for veterinary students

Thrombophilia. Steven R. Lentz, M.D. Ph.D. Carver College of Medicine The University of Iowa May 2003

Biomedical Big Data and Precision Medicine

European Educational Programme in Epidemiology

How Can Institutions Foster OMICS Research While Protecting Patients?

Genomic CDS: an example of a complex ontology for pharmacogenetics and clinical decision support

Integrating Bioinformatics, Medical Sciences and Drug Discovery

An Introduction to Medication Adherence

The National Institute of Genomic Medicine (INMEGEN) was

Long QT Syndrome Genetic Testing for Inherited Arrhythmias. patient guide

Genetics for preventative cardiology. Objectives HEART DISEASE COMES IN MANY FORMS!

BI122 Introduction to Human Genetics, Fall 2014

Protocol. Cardiac Rehabilitation in the Outpatient Setting

Research Skills for Non-Researchers: Using Electronic Health Data and Other Existing Data Resources

The Department of Vermont Health Access Medical Policy

Mendelian inheritance and the

3/25/14. To Clot or Not What s New In Anticoagulation? Clotting Cascade. Anticoagulant drug targets. Anita Ralstin, MS CNS CNP. Heparin.

INTRODUCTION Thrombophilia deep vein thrombosis DVT pulmonary embolism PE inherited thrombophilia

Not All Clinical Trials Are Created Equal Understanding the Different Phases

Antiplatelet and Antithrombotics From clinical trials to guidelines


Dual Antiplatelet Therapy. Stephen Monroe, MD FACC Chattanooga Heart Institute

Therapeutic Approach in Patients with Diabetes and Coronary Artery Disease

Failure or significant adverse effects to all of the alternatives: Eliquis and Xarelto

Genomes and SNPs in Malaria and Sickle Cell Anemia

Gene Therapy and Genetic Counseling. Chapter 20

Christopher M. Wright, MD, MBA Pioneer Cardiovascular Consultants Tempe, Arizona

INTRODUCTION Thrombophilia deep vein thrombosis DVT pulmonary embolism PE inherited thrombophilia

Developing VA GDx: An Informatics Platform to Capture and Integrate Genetic Diagnostic Testing Data into the VA Electronic Medical Record

The largest clinical study of Bayer's Xarelto (rivaroxaban) Wednesday, 14 November :38

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

A Genetic Analysis of Rheumatoid Arthritis

BRCA Genes and Inherited Breast and Ovarian Cancer. Patient information leaflet

The Anti coagulated Patient: The Cardiologist s View. February 28, 2015

Validation and Replication

Thrombosis and Bleeding

Presenter: Marco Valgimigli, MD PhD, FESC Erasmus MC, Thoraxcenter Rotterdam The Netherlands

DUAL ANTIPLATELET THERAPY. Dr Robert S Mvungi, MD(Dar), Mmed (Wits) FCP(SA), Cert.Cardio(SA) Phy Tanzania Cardiac Society Dar es Salaam Tanzania

Transcription:

Introduction to genetic testing and pharmacogenomics Cecile Janssens Erasmus University Medical Center Rotterdam, Rotterdam, the Netherlands (a.janssens@erasmusmc.nl)

Genetic prediction of monogenic diseases Gene Protein Monogenic disease Cecile Janssens DNA-dag Utrecht 12 Maart 2010

Genetic prediction of complex diseases Gene Gene Gene Gene Protein Protein Protein Protein Gene Protein Complex disease Gene Protein Protein Protein Environment Gene Gene

McCarthy Nat Rev Genet 2008

Whole genome sequencing agtcagatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagagtcagatcgatcggctagcctagaatctgatcgattagtcgatctagcttta tcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagagtcagatgcattagtcgatctagctttatcgattcaagattca agcactagctaaagagattagctagagtcagatgctaaagagataagcactagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagt atagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgtaaa tctgatcgattagtcgatctagctttatcgattcaagcacactagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcg attagtcgatctagctttatcgtagcctagaatctgatcgattagtcgatcttctagctttatcgattcaagcactagctaaagatattatatataaagagattagctagagtcagatcgatcggcatcgatcggctagccta gaatctgatcgattagtcgatcttctgatcggaagagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagagctttatcgattcaagcaaagcactagctaaagagattagctaga gtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtactagctaaagagattagctagtagaaatcgatcggctagcctaggtagaatctgatcgattagtcgatctagc tttatcgattcaagcactagctaaatagattagctagagtcagatgctaaagagattagctacattagtcagagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagagctttatcga ttgatctagctttatcgattcaagcactagctaaagagattagctagagtcagatgctaaaattcaagcactagctaaagagattagctagagtcagatgctaaagagataagcactagctaaagagattagctaga gtcagatgctaaagagattagctaagctttatcgattcattcaagcactagctaaagagattagctagagtcagatgctaaagagataagcactagctaaagaattcaagcactagctaaagagattagctagagtc agatgctaaagagataagcactagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtatagctgagtcagatcgatcggcatcgatc ggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagctttatcgatt caagcagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtatagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattag tcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagctttatcgattcaagcaaagcactagctaaagaga attcaagcactagctaaagagattagctagagtcagatgctaaagagataagcactagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattag ctagtatagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatc gtaaatctgatcgattagtcgatctagctttatcgattcaagcaattcaagcactagctaaagagattagctagagtcagatgctaaagagataagcactagctaaagagattagctagagtcagatgctaaagagat tagctaagctttatcgattcaagcactagctaaagagattagctagtatagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaaga gattagctagtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagctttatcgattcaagcaattcaagcactagctaaagagattagctagagtcagatgctaaagagataagc actagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtatagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatc gattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagctttatcgattcaagcaattcaagcactag ctaaagagattagctagagtcagatgctaaagagataagcactagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtatagctga gtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcg attagtcgatctagctttatcgattcaagcattagctagtatagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagcta gtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagctttatcgattcaagcagagataagcactagctaaagagattagctagagtcagatgctaaagagattagctaagcttta tcgattcaagcactagctaaagagattagctagtatagctgagtcagatcgatcggcatcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtag aatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcattcaagcactagctaaagagattagc tagagtcagatgctaaagagataagcactagctaaagagattagctagagtcagatgctaaagagattagctaagctttatcgattcaagcactagctaaagagattagctagtatagctgagtcagatcgatcggc atcgatcggctagcctagaatctgatcgattagtcgatctagctttatcgattcaagcactagctaaagagattagctagtagaatctgatcgattagtcgatctagctttatcgtaaatctgatcgattagtcgatctagcttt atcgattcaagcagatctagctttatcgtctgatcgattagtcgatc

Sequencing versus GWAS 3.000.000.000 versus ~2.500.000 basepairs = GWAS assesses 1 in 1000 basepairs Approximately right, but unlikely exact

The patient (label from the paper) The patient was a 40-year-old man who presented with a family history of coronary artery disease and sudden death. His medical history was not clinically significant and the patient exercised regularly without symptoms. He was taking no prescribed medications and appeared well. Clinical characteristics were within normal limits (table 1).

What did they do? analysis of this patient s full genome sequence, risk prediction for coronary artery disease, screening for causes of sudden cardiac death, and genetic counselling prediction of genetic risk of variants associated with mendelian disease, recognised drug responses, and pathogenicity for novel variants

Results (from the abstract) Analysis of 2 6 million SNPs and 752 CNVs showed increased genetic risk for myocardial infarction, type 2 diabetes, and some cancers. We discovered rare variants in three genes that are clinically associated with sudden cardiac death TMEM43, DSP, and MYBPC3. A variant in LPA was consistent with a family history of coronary artery disease. The patient had a heterozygous null mutation in CYP2C19 suggesting probable clopidogrel resistance, several variants associated with a positive response to lipidlowering therapy, and variants in CYP4F2 and VKORC1 that suggest he might have a low initial dosing requirement for warfarin. Many variants of uncertain importance were reported.

We discovered rare variants in three genes that are clinically associated with sudden cardiac death TMEM43, DSP, and MYBPC3.

A variant in LPA was consistent with a family history of coronary artery disease.

The patient had a heterozygous null mutation in CYP2C19 suggesting probable clopidogrel resistance. Level of evidence strength of association Ashley et al. Lancet 2010

The Pharmacogenomics Journal 2010 Risk of cardiovascular recurrences N= 8,043 Risk of stent thrombosis N = 4,975 (???)

Lancet 2009

The patient had a heterozygous null mutation in CYP2C19 suggesting probable clopidogrel resistance. What then is the clinical implication? Should the patient not get clopidogrel if he needs it?

Rate (risk) of cardiovascular event Collet et al. Lancet 2009

Genetic risk estimates for major diseases Ashley et al. Lancet 2010 Beware: Genetic risk disease risk!

Monozygotic twins Who has the highest risk of type 2 diabetes?

Ashley et al. Lancet 2010 Low sample size less confidence

TCF7L2: Reproducibility of association Cauchi et al. J Mol Med 2007

Damcott et al. Diabetes 2006

Ashley et al. Lancet 2010 What do these risks tell you?

Risk distribution How useful is it to know one s risk of disease also depends on the risks of others! 0 25 50 0 25 50 If all predicted risks are around average, then the test is not useful

Type 2 diabetes AMD Don t treat Treat Don t treat Treat Lango et al Diabetes 2008 Seddon et al. IOVS 2009 AUC = 0.60 AUC = 0.76* * Distribution shown: risk scores include non-genetic factors

How good is type 2 diabetes prediction? BMJ 2010

Take home message Whole genome sequencing is by far not ready for prime time Most variants still have unknown function and/or unknown importance Prediction of disease based on multiple variants (like type 2 diabetes) is still not very predictive All does need years of (genetic) epidemiological work to translate data into risk information

A potential risk of WGS Mutations in TMEM4330 or DSP31 have been associated with familial arrhythmogenic right-ventricular dysplasia or cardiomyopathy. Review of previous clinical assessment of extended family members revealed minor criteria for this disease in one first cousin, whose son died suddenly in his teens. Overconfidence in phenotypic explanations for discovered variants