Genomics and the EHR. Mark Hoffman, Ph.D. Vice President Research Solutions Cerner Corporation



Similar documents
HOW WILL BIG DATA AFFECT RADIOLOGY (RESEARCH / ANALYTICS)? Ronald Arenson, MD

How To Share Health Information On A Network

Integration of Genetic and Familial Data into. Electronic Medical Records and Healthcare Processes

ELECTRONIC MEDICAL RECORDS. Selecting and Utilizing an Electronic Medical Records Solution. A WHITE PAPER by CureMD.

Privacy and Security Policies for Healthcare Solutions on the Cloud

Meaningful Use Stage 2 Certification: A Guide for EHR Product Managers

ABOUT MDFLOW SYSTEMS. We know healthcare, we get results.

Open Platform. Clinical Portal. Provider Mobile. Orion Health. Rhapsody Integration Engine. RAD LAB PAYER Rx

The value MIE delivers can be summed up in two words:

Karuna P Joshi, PhD. Research Asst. Professor. karuna.joshi@umbc.edu

Ross Cantor Director of Sales and Client Relations Lifepoint Informatics

HIT Workflow & Redesign Specialist: Curriculum Overview

Adding Management.

Integration of genomic data into electronic health records

Hematology, Chemistry, Microbiology. Clinical Pathology and Anatomic Pathology. Hospital Information System or Practice Management System

State of the EHR: The Vendor Perspective

Use Cases for Argonaut Project. Version 1.1

Meaningful HIE to. Advance. your Connectivity

THE EHR4CR PLATFORM AND SERVICES

HETEROGENEOUS DATA INTEGRATION FOR CLINICAL DECISION SUPPORT SYSTEM. Aniket Bochare - aniketb1@umbc.edu. CMSC Presentation

#Aim2Innovate. Share session insights and questions socially. Genomics, Precision Medicine and the EHR 6/17/2015

Building open source safety-critical medical device platforms and Meaningful Use EHR gateways

The Do s and Don ts of Medical Device integration

Automated Lab Management for Illumina SeqLab

HL7 Clinical Genomics and Structured Documents Work Groups

HOW TO ACCELERATE ADOPTION OF ELECTRONIC HEALTH RECORDS

EMDEON CLINICAL SOLUTIONS

Delivering the power of the world s most successful genomics platform

LOINC Mapping AND MAINTENANCE SERVICES. CLINICAL DATA NORMALIZATION through LOINC Mapping TURN OVER TO LEARN MORE. Test Dictionary Process

EHR Business Process Models for Care Coordination and MU

HL7 and Meaningful Use

A Semantic Foundation for Achieving HIE Interoperability

Care360 EHR Frequently Asked Questions

Spok Template v2 7/8/2015

The Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins

Patient-Centric Secure-and-Privacy-Preserving Service-Oriented Architecture for Health Information Integration and Exchange

Interoperability: White Paper. Introduction. PointClickCare Interoperability January 2014

Designing Database Solutions for Microsoft SQL Server 2012 MOC 20465

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik

Streamline Your Radiology Workflow. With Radiology Information Systems (RIS) and EHR

Personalized Medicine: Humanity s Ultimate Big Data Challenge. Rob Fassett, MD Chief Medical Informatics Officer Oracle Health Sciences

Draft Pan-Canadian Primary Health Care Electronic Medical Record Content Standard, Version 2.0 (PHC EMR CS) Frequently Asked Questions

Benefits of Image-Enabling the EHR

Standards and Interoperability: The DNA of the EHR

i-care Integrated Hospital Information System

Reasoning / Medical Context / Physicians Area of Competence

The What, When, Where and How of Natural Language Processing

Advancing Laboratory Interoperability in Health IT

An EVIDENCE-ENHANCED HEALTHCARE ECOSYSTEM for Cancer: I/T perspectives

HEALTH IT! LAW & INDUSTRY

HL7 and Meaningful Use

Electronic Health Records - An Overview - Martin C. Were, MD MS March 24, 2010

Lessons from the Stanford HIV Drug Resistance Database

Centricity 360 Case Exchange

International HL7 Interoperability Conference - IHIC 2010

Meaningful use. Meaningful data. Meaningful care. The 3M Healthcare Data Dictionary: Standardizing lab data to LOINC for meaningful use

GE Healthcare. Centricity * Clinical Archive. Unify patient images and documents across the care continuum

Creating a national electronic health record: The Canada Health Infoway experience

All-in-one, Integrated HIM Workflow Solution

Understanding Meaningful Use with a Focus on Testing the HL7 V2 Messaging Standards

SQL Server 2012 Business Intelligence Boot Camp

Course 10777A: Implementing a Data Warehouse with Microsoft SQL Server 2012

We Believe the Possibilities. Delphic AP

CHAPTER 2 Functional EHR Systems

Delphic AP. Designer software for your pathology workflow. We Believe the Possibilities.

Course Syllabus. Upon completion of all six modules, participants will have:

Health Information Technology

Eligible Professionals please see the document: MEDITECH Prepares You for Stage 2 of Meaningful Use: Eligible Professionals.

IHE, A Taxonomy for Electronic Medical Mdi lrecords

INFORMATION TECHNOLOGY CONTROLS

Implementing a Data Warehouse with Microsoft SQL Server 2012

HL7 & Meaningful Use. Charles Jaffe, MD, PhD CEO Health Level Seven International. HIMSS 11 Orlando February 23, 2011

Tools for DICOM Implementation

BEYOND IDENTITY PROOFING: How EHRs Can Become More Than Just Vendors

BI en Salud: Registro de Salud Electrónico, Estado del Arte!

REQUIREMENTS GUIDE: How to Qualify for EHR Stimulus Funds under ARRA

About CHIMA. Agenda 10/3/2012. HIM Workforce Transformation Where are the Leaders? HRABC Langley, BC Sept 29, 2012

Test Procedure for (b)(6) Transmission of electronic laboratory tests and values/results to ambulatory providers inpatient setting only

Transcription:

Genomics and the EHR Mark Hoffman, Ph.D. Vice President Research Solutions Cerner Corporation

Overview EHR from Commercial Perspective What can be done TODAY? What could be done TOMORROW? What are some of the challenges? Change management

EHR Links diagnostic, treatment, procedural, workflow, administrative information in a machine readable framework The LEGALLY BINDING MEDICAL RECORD Information must be recoverable during legal proceedings Requires ability to reconstruct information available to clinician AT THE TIME THAT A DECISION WAS MADE Strict versioning, date/time stamp Updates to interpretations must be clearly identified Enables privacy protection through: Audit trail of access Role and organization security How private is this?

Many Facets of an EHR Software Commercial Homegrown Hardware Performance Implementation decisions Collaborative team between vendor and organization Support policies and procedures We can t query the EHR

Many types of EHR Off the Shelf Configurable Customized Common build Easy start up Quick implementation Limited flexibility Data can be easily exchanged, limited depth Common architecture Release variability Modularity Implementations vary widely between sites Most data can be exchanged Custom architecture Highly flexible Significant effort to implement Limited ability to deploy innovations beyond parent institution

Meaningful Use some important lessons Incentive based enables providers to purchase and install specific EHR capabilities Focuses on functionality, does not prescribe how to deliver functionality Commercial systems have significant investments in their platforms

What can we do TODAY to support genomics in the EHR? Non-exceptionalist perspective: Any genetic or genomic test can be ordered from an EHR via CPOE Any genetic test report can be included in the EHR as a text document Some EHR systems (or LIS modules within an EHR): Support storage of discrete genetic findings (variants, quantitative results, cytogenetic abnormalities, karyotypes) Support the workflow in molecular diagnostic laboratories Provide ISCN syntax checking Enable automated interactions with molecular diagnostic devices (DNA extractions, RT-PCR etc.) Can configure decision support rules that utilize discrete genetic information

Current capabilities Streamline laboratory process Codify discrete results LOINC for orders CBO: becoming de facto standard 17 diagnostic labs in US, Canada and Egypt, VA and 15+ other organizations in process Provides rich semantic structure Enable decision support with discrete results Publish interpretative reports to EHR Works within the most widely used HL7 framework (2.x)

it s Personal Initiative Decision Support HIV Genotype - drug resistance report that guides physician towards alternative therapies based on how the virus is evolving through course of treatment. Current: displays recent mutations for patient based on current therapy. Red indicates new mutations identified. Summation: displays all mutations found for the patient through course of treatment

it s Personal Initiative Family History Consumer-driven Cerner Health PHR Accessible web-based Cerner Health PHR Portable one Cerner Health connection to multiple providers Time Saving Completed prior to seeing clinician Data Sharing Copy tree and share with family members Standardized HL7 compliant and SNOMED enabled Clinically Relevant Visual representation for clinicians to track familial conditions using NSCG pedigree standards

What could be done TOMORROW? Link storage of DNA sequencing output to EHR Some lessons from large image files that are stored in archive approach Can be compressed by storing differences relative to a reference sequence Assist diagnostic expert with interpretation of DNA sequence results (current or NextGEN) Highlight variants of known significance Highlight variants with likely impact despite lack of known signficance (stop, frameshift) Document and archive variants of unknown significance for future interpretation Periodically reassess results of unknown significance as new findings become available

The problem with using a fixed set of codes There s always that extra piece Difficult for curated content to keep up with the pace of science CTTCTCCGTGTCCACCTTGCGCAACTTGGG CCTGGGCAAGAAGTCGCTGGAGCAGTGG GTGACCGAGGAGGCCGCCTGCCTTTGTGC CGCCTTCGCCGACCAAGCCGG

The problem with codifying after the result is captured. Codification depends on the rules that are implemented at the time that a result is captured If (when) the logical rules change, the codification of a variant can vary due to minor modification of the rules. Querying these codes will be challenging. CTTCTCCGTGTCCACCTTGCGCAACTTGGG CCTGGGCAAGAAGTCGCTGGAGCAGTGG GTGACCGAGGAGGCCGCCTGCCTTTGTGC CGCCTTCGCCGACCAAGCCGG

A Computer in the Exam Room? Change Management - Scenario 1 That it will ever come into general use, notwithstanding its value, is extremely doubtful because its beneficial application requires much time and gives a good bit of trouble, both to the patient and to the practitioner because its hue and character are foreign and opposed to all our habits and associations. from The London Times in 1834 Commenting on... the stethoscope

Change Management - Scenario 2 The ipad was immediately utilized in clinical practice Users saw immediate value and did not seek permission or regulatory approval

Imaging some similar issues

Some lessons and questions from imaging Reports and orders are within EHR context Large image files are stored in archive, with links to EHR Would the $10 MRI mean that everybody would and should have an MRI? Are there enough radiologists to support the interpretation of the results?

Architecture Collaborative Cloud Infrastructure Cloud-based Research Platform Private Sequence Archive Private Sequence Archive EHR LIS EHR LIS

Scenario 3 Here is my DNA sequence! Courtesy: A. Gonzalez

Mark Hoffman www.clinbioinformatics.org mhoffman1@cerner.com 816-201-3291