Rift Valley Fever situation in the Democratic Republic of Congo (DRC) Livestock case
Geographic position
RVF occurrence Central Africa: D R Congo Very few published data dealing with this region, Occurrence of clinical and acute outbreak never known but, Serological evidence reported in humans (Theiler, 1952) and animals (P C Lefevre, 1989) and, Existence of typical clinical and pathological changes in some cattle farms (abortion, stillbirth, high mortality rate in calves, non viable calves), Abundance of risk factors: climate (temperature and humidity), ecology, vectors (cornucopia of mosquitoes genus: culex, aedes, and anopheles genus), Endemicity established,
RVF surveillance decision at the country level! A routine field visit carried out (since 2007) when invited by cattle farmers about a very low reproductive performance in Northern Katanga, where the following syndrome was watched by our own: Abortions, Stillbirth, Non viable calves, Calves mortalities and globally, Natality rate (47 50%) despite, the immunisation programme introduction for Brucellosis prevention and since many years, No significant change and the dilemma still ongoing, Other typical RVF occurrence conditions were present: Many pastures permanently flooded (in dry season), Many mosquitoes within and around the pastures, Abortion still being a major concern, etc.
RVF initially suspected area (in Northern Katanga)
RVF specific sampling and laboratory diagnostic was initiated at (the first stage in the above mentioned area). 151 specimens sera samples were collected, The availability of the fetus (abortions) tissues was recommended, A detection system using the following diagnostic was initiated: Indirect ELISA (ielisa) using the RVFV recombinant N protein (major virus immunocompetent and highly conserved protein) for IgG and Ig M antibodies detection, Immunohistochemistry (sections immunostaining): of formalin fixed and paraffin embedded tissues, using the Avidin Biotin Complex (ABC) and Horseraddish Peroxidase, A two steps RT PCR using Qiagen RNA/DNA kit for RNA extraction, Invitrogen Thermoscript TM RT PCR System for reverse transcription and cdna production and, primers (NSa: CCTTAACCTCTAATCAAC, nts 841 824 and NS2g: TGATTTGCAGAGTGGTCGTC, nts 61 80 80 ) was achieved and, A careful post mortem exploration of fetus was advised.
Laboratory diagnostic (cont.): - RVFV RNA extraction using Qiagen kit and, - OBP live vaccine used as positive control for our RT PCR, - a BSL2 cabinet used for RNA extraction
Serology results in the most suspected farm in (2006): prevalence 49% (Ig G, Ig M) and 8,6% Ig M Positive Birth Year Age Number lg G lg M +VEs 1996 11 1 1 0 0 1997 10 7 4 1 3 1998 9 19 9 2 9 1999 8 75 32 8 42 2000 7 17 9 1 7 2001 6 29 16 1 13 2003 4 1 1 0 0 2005 2 1 1 0 0 2006 1 1 1 0 0 Overall 151 74 13 74
Prevalence according to age: in the same most suspected farm. OVER ALL 80 70 60 50 40 30 20 10 0 1996 1997 1998 1999 2000 2001 2003 2005 2006 BIRTH YEAR Age Number Positive lg G Positive lg M
Immuno staining (IMP): fetus liver tissue, Ag Ac complexes in portal area (RVFV is hepatotropic and its N protein histologically detectable RT PCR : vaccine virus gene 800 bp detected, but our samples degraded (1) (2) (3) (4) (5) (6) (7) (8) (9) (10) (11)
Classical gross changes: focalised necrotic areas in a freshly aborted fetus liver as described in in the text books.
Given the initial results other provinces surveyed retrospectively from our sero bank samples, only Ig G ielisa used
RVF: LOCATIONS PREVALENCES (1) N Location Province Sera tested (n) Positiv e (n) 1 Kindele 2 Mushindi 3 Kiabukwa Katanga 197 32 Katanga 50 14 Katanga 100 23 4 Lodja Kasaï-Oriental 48 6 5 Mutokoyi 6 Bandundu (Mukoki) Kasaï-Oriental 78 14 Bandundu 15 0 7 Bandundu (Lumumba) 8 Bandundu (Volonte) 9 Bandundu (Ntombo) 10 Bandundu (Lumanda) Bandundu 15 0 Bandundu 10 0 Bandundu 8 0 Bandundu 14 0
RVF: LOCATIONS PREVALENCES (2) 11 Bandundu (Mukoki) 12 Bandundu (Mbumba) 13 Bandundu (Ngungu) 14 Bandundu (Fakana) 15 Bandundu (Ntunu) 16 Bandundu (Kasongo Lunda) 17 Bandundu (Ozuku) 18 Bandundu (Bodi) 19 Bandundu (Mamvu) 20 Province Orientale (ARU) Bandundu 8 2 Bandundu 8 5 Bandundu 7 4 Bandundu 15 8 Bandundu 5 0 Bandundu 67 2 Bandundu 15 0 Bandundu 15 0 Bandundu 12 0 Province Orientale 28 0
RVF: LOCATIONS PREVALENCES (3) 21 Province Orientale (ABG) 22 Province Orientale (KER) 23 Province Orientale (KAB) 24 Province Orientale (MA) 25 Province Orientale (LUB) 26 Province Orientale (NY) Province Orientale 4 0 Province Orientale 36 1 Province Orientale 28 2 Province Orientale 40 0 Province Orientale 83 18 Province Orientale 56 2 Total number of tested / positive animals 962 133 OVERALL prevalence (only cattle samples) 14%
PROVINCES PREVALENCE ESTIMATE: so far tested samples ( survey being extended to other provinces locations) PREVALENCE BY SURVEYED PROVINCE 25 20 P revalence 15 10 5 Série1 0 Katanga Kasai- Oriental Bandundu Province Orientale Nord-Kivu Province
CONCLUSION These preliminary findings suggest a dormant disease under a sub clinical but active form, An epizoo epidemic outbreak should be feared at any period of time, Cattle seems to be the most involved species of ruminants (so not playing significant role as virus amplifier for humans, according to some workers), As far as livestock immunisation form the basis of humans protection (Lefevre, 1989), Large scale epidemiological studies still needed in order to detected further challenged areas.
NEXT STEP AND FUTURE WORK Testing as many samples as possible from our sero bank as well as from the field including all the provinces, Going on with virus molecular detection, depending on following prerequisites: Proper sampling, instead of receiving samples from herdsmen, specific field operations should be carried out by our own bringing anti RNAse reagents (Guanidine Isothiocyanate) and Nitrogen liquid, Up to date RT PCR manipulations: chiefly based on good RNA extraction and for one step RT PCR reagents, Quantitative molecular investigation covering all the country.
New facility : rt PCR machine, allowing a molecular quantitative investigation which is allowing our to carry out a large scale survey given the size of our country
AKNOWLEDGEMENT International Atomic Energy Agency (IAEA) for equipment and reagents (Gerrit Viljoen), Institut Pasteur de Paris: primers being used for RT - PCR have been supplied by them (Michele Mbouloy), Onderstepoort Veterinary Institute (OVI) for the first recombinant N protein based ielisa kit for Ig G and Ig M Abs detection through (Roy Williams), University of Pretoria / Pathology Dpt. for IMP (Johann C Steyl), National Institute for Communicable Diseases (NICD) for the second recombinant N protein test and kit (Janusz Paweska) and, Our team at the CVL in Kinshasa.
THANK YOU