Lab 5: DNA Fingerprinting

Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the same individual or from different individuals. DNA fingerprinting (a.k.a. DNA typing, DNA profiling) uses DNA to show relatedness or identity of individual humans, other animals, or plants. In addition to forensic science, DNA fingerprinting has many other applications. For example: - Food identification: identifying impurities in food products - Freeing innocent convicted felons - Identifying human remains (historical sites, during times of war) - Determining relatedness of family members, paternity testing - Identifying organisms that cause disease In today s experiment, we will try to determine whether DNA from any of 5 crime suspects matches a DNA sample found at a crime scene. For this experiment, it is necessary to review the structure of DNA molecules. The DNA structures shown here represent very small sections of DNA from 3 different individuals. DNA consists of a series of nitrogenous base molecules bonded a sugar-phosphate backbone. Remember, the phosphate groups are negatively charged. The nitrogenous bases are adenine, thymine, guanine, and cytosine (A, T, G, and C). The bases from each strand pair with bases from the opposite strand according to base-pairing rules: A with T, and G with C. Figure 1 S = sugar (deoxyribose) P = phosphate The basic principle underlying DNA fingerprinting is that the sequence of bases (A, T, G, C) is unique in the DNA molecules of each organism (with the exception of identical twins). Therefore, your DNA is like your fingerprint it can identify you and distinguish you from other organisms. As with regular fingerprints, we need a way to visualize DNA fingerprints. For this, we rely on the use of restriction enzymes. to (continued on next page) 47

Activity 5a Restriction Enzyme Digestion of DNA Purpose In this activity, you will learn what restriction enzymes do and what their role is in DNA fingerprinting. You will use two restriction enzymes to digest DNA samples from the suspects as well as from the crime scene. The DNA products of the restriction enzyme digestion will be analyzed in Activities 5b and 5c. Background: Restriction enzymes: DNA cutting tools, or molecular scissors. Isolated from bacteria, who use them as a defensive tool to cut up foreign DNA There are many different restriction enzymes. Each restriction enzyme cuts DNA at a specific sequence of nucleotides (called restriction sites). All restriction sites are palindromic sequences, which means that the sequence on one DNA strand is the same as the sequence on the complementary DNA strand when it is read in the opposite direction. For example, we will be using 2 different restriction enzymes in today s lab: EcoRI cuts DNA at the sequence G A A T T C C T T A A G PstI cuts DNA at the sequence C T G C A G G A C G T C Let s look at a restriction digestion with EcoRI on a DNA molecule with the following sequence: A T G A A T T C T C A A T T A C C T T A C T T A A G A G T T A A T G G A A T G T A C T T A A A A T T C T C A A T T A C C T G A G T T A A T G G A Cutting this DNA sequence with EcoRI has now produced 2 DNA molecules of different sizes. DNA fragment size can be expressed as the number of base pairs in the fragment. Here, one of the DNA fragments is 3 base pairs (3 bp), and the other fragment is 11 base pairs (11 bp). In DNA fingerprinting, DNA from different individuals is cut with restriction enzymes in order to create a unique profile of DNA fragments this is the fingerprint that can determine whether two DNA samples came from the same individual or from different individuals. 48

Procedure 1. First, assemble the following materials for your group at your lab bench: EcoRI/PstI enzyme mix (80 µl) on ice. P-10 pipet, P-100 pipet, yellow micropipet tips colored microfuge tubes (green, blue, orange, violet, red, & yellow) sharpie marker to label tubes foam microfuge tube holder for waterbath incubation laboratory tape to label samples, gels 2. The Instructor bench will have the following materials when you are ready to use them: Crime scene DNA with buffer Suspect 1 DNA with buffer Suspect 2 DNA with buffer Suspect 3 DNA with buffer Suspect 4 DNA with buffer Suspect 5 DNA with buffer 37 C waterbath or incubator 3. Label your reaction tubes as follows: Green tube: CS (crime scene) Blue tube: S1 (suspect 1) Orange tube: S2 (suspect 2) Violet tube: S3 (suspect 3) Red tube: S4 (suspect 4) Yellow tube: S5 (suspect 5) * Also, make sure your group # or name is on the tubes so they don t get confused with other groups tubes. 4. Add DNA samples to tubes. Go to instructor bench and transfer 10 µl of each DNA sample from the colored stock tubes into each of the corresponding labeled colored tubes. Make sure to use a fresh pipet tip for each sample!!! 5. Add 10 µl of enzyme mix to each tube of DNA. Make sure to use a fresh pipet tip for each sample!!! 6. Mix the tube contents by gently flicking the tubes with your finger (ask instructor to demonstrate). {do not use vortex!} 7. Spin the tubes in a microcentrifuge for about two seconds to force the liquid to the bottom of the tubes. Make sure the tubes are balanced in the microcentrifuge! 8. Incubate the samples at 37 C for 45 minutes. Record start time and stop time for your incubation in your lab notebook. Also, make a table in your notebook listing the contents in each tube for quick reference. While your restriction digests are incubating, you will prepare your agarose gels for gel electrophoresis. Since we cut the DNA from the crime scene and the DNA from suspects #1-5 with the same restriction enzymes, we can compare the sizes of the DNA fragments to determine whether any of the suspects DNA matches DNA obtained from the crime scene. In order to compare the sizes of the DNA fragments, we need a way to separate them by size and visualize the DNA fragments. To do this, we will use a technique called gel electrophoresis. 49

Activity 5b Gel Electrophoresis Purpose This activity will introduce you to the technique of gel electrophoresis, which is a method for the separation of biological molecules. You will use agarose gel electrophoresis to separate the products of your restriction enzyme digestion. Once separated on a gel, the DNA fragments will then be visualized by DNA staining in Activity 5c. Background: Gel electrophoresis: lab technique that uses electricity and a thin gel to separate nucleic acids or proteins by size. DNA fragments from each sample are loaded into wells in an agarose gel slab, which is placed into a chamber filled with a conductive buffer solution. A current is passed between wire electrodes at each end of the chamber. Since DNA molecules are negatively charged (due to the negatively charged phosphate groups in the sugar-phosphate backbone), they will move toward the positive electrode. The matrix of the agarose gel acts as a molecular sieve through which smaller DNA molecules can move more easily than larger ones. - an analogous situation: Imagine a classroom where all the desks and chairs have been pushed together. An individual student can wind his/her way through the maze more quickly and easily than a string of four students trying to wind through the maze. Figure 2 Mixture of DNA molecules of different sizes Power source Gel + + Completed gel Longer molecules Shorter molecules After the DNA fragments produced from restriction enzyme digestion are separated by gel electrophoresis, the shorter molecules will migrate farther than the larger ones (as shown in Figure 3). Fragments of the same size will migrate together in the gel and appear as single bands of DNA. These bands will be seen in the gel after the DNA is stained. Procedure Your instructor has already poured 1% agarose gels for each group. There will also be some extra agarose gels for you to practice loading before you load your DNA into the gel. If you would like to learn how to pour agarose gels, materials are available for that, and your instructor can help show you how to pour agarose gels while your gel is running. 50

1. Prepare your samples to be loaded into the gel. a) Obtain an aliquot of loading dye (LD) from your instructor. b) Using a new tip for each sample, add 5 µl of loading dye (LD) to each sample tube. Tightly cap each tube. Mix the components by gently flicking the tubes with your finger. c) Obtain an aliquot of DNA marker from your instructor. 2. Before loading your gel, practice loading a dye solution into one of the practice agarose gels that has been set up for you. Ask your instructor to demonstrate loading technique. You want to make sure that you don t go down to the second stop too forcefully when expelling the sample into the well of the gel so that the sample doesn t explode out of the well. Also, once you have delivered all of the sample into the well, make sure not to release the plunger until your pipet is all the way out of the gel; otherwise, you may withdraw some of the DNA sample back into the pipet tip. 3. Once everyone in your group has had a chance to practice, you are ready to load your gel. a) Place the gel tray into the electrophoresis chamber in the proper orientation (with the wells at the (-) electrode, which is colored black). b) Fill the electrophoresis chamber with 1X TAE buffer use enough buffer to just cover the wells of the gel by 1-2 mm. c) Just before loading your samples, spin them in a microcentrifuge for a few seconds to make sure that all the sample is at the bottom of the tube (make sure tubes are balanced if you have an odd number of tubes, you must use a blank tube). d) Using a separate pipet tip for each sample, use your P-100 to load your digested DNA samples into the gel. Gels are read from left to right. The first sample is loaded in the well at the lefthand corner of the gel. Make sure you record the order in which you loaded your samples in your lab notebook. Lane 1: DNA size marker (clear tube), 10 µl Lane 2: CS (green tube), 20 µl Lane 3: S1 (blue tube), 20 µl Lane 4: S2 (orange tube), 20 µl Lane 5: S3 (violet tube), 20 µl Lane 6: S4 (red tube), 20 µl Lane 7: S5 (yellow tube), 20 µl Figure 3 4. Run the gel. a) Secure the lid on the gel box. The lid will only attach to the base in one orientation (red to red & black to black). Connect the electrical leads to the power supply. b) Turn on the power supply. Set it for 125 V (check this with your instructor) and electrophorese the samples for about 30 minutes, or until the dye front is near the bottom of the gel. Write down the time you started the electrophoresis in your lab notebook. c) Once you turn on the power supply, you should see bubbles coming up from the electrodes if everything is working properly. After about 5 minutes, you should observe movement of the dye front away from the wells toward the anode. 51

Activity 5c DNA staining Purpose This activity will show you how DNA molecules can be visualized using a DNA stain. You will use Fast Blast DNA stain to see the DNA fragments produced from restriction enzyme digestion in your agarose gel. This will allow you to determine which of the suspect s DNA matches the DNA found at the crime scene. Background Since DNA is naturally colorless, it is not visible in the gel. The blue color that you see only indicates the positions of the loading dye and not the positions of the DNA fragments. DNA fragments will be visualized by staining the gel with a blue stain called Fast Blast DNA stain. The blue stain molecules are positively charged (+) and have a high binding affinity for DNA, which is negatively charged (-). The blue stain strongly binds to the DNA fragments and allows the DNA to become visible. These visible bands of DNA may then be traced, photographed, sketched, or retained as a permanently dried gel for analysis. Procedure 1. When the electrophoresis is complete, turn off the power supply and remove the lid from the gel box. Carefully remove the gel tray and gel from the electrophoresis chamber. Be very careful, as the gel is fragile use a spatula to avoid breaking the gel. Place the gel in a staining tray. Please share staining trays with at least one other group make sure to identify your gel in some way! One good way is to cut the corner or nick one group s gel. Also, use label tape on the staining tray to write the group s number or initials. 2. Before adding stain, make sure you have enough warm water for the destain rinses. You ll need about 1.5 2 L of warm water (between 40 55 C). To prepare this, heat water in the microwave in a plastic beaker until hot to the touch. Then mix with room temperature water to end up with warm water. You may need repeat this in between washes. 3. Pour approximately 120 ml of 100X stain into the staining tray enough stain to completely submerge the gels. Stain the gels for 2-3 minutes, but not for more than 3 minutes. Using a funnel, pour the 100X stain into a storage bottle (it can be re-used). 4. Pour 500 700 ml of warm water into the tray. Rinse ~ 10 seconds. 5. Holding onto the gels with your hand, pour out the wash water, and add another 500 700 ml of warm water for a second wash. Gently rock or shake the gel on a shaker for 5 min. 6. Perform another wash as in step 5. Figure 4 for 52

7. Pour off the water and examine the stained gels. The bands may appear fuzzy immediately after the second wash, but will begin to develop into sharper bands within 5-15 minutes after the second wash as the stain molecules bind more tightly to the DNA. To obtain maximum contrast, additional washes in warm water may be necessary. 8. Place your gel on a light background (white paper, or light box, if available) and record your results by making a diagram as follows. Place a clear sheet of plastic wrap over your gel. Using a sharpie marker, trace the wells where you loaded your samples and trace the band patterns. Then remove the plastic wrap and ask your instructor to make a copy for your notebook or trace the wells and band patterns into your notebook. 53

Lab 5 Homework Name: 1) Look at the DNA structure cartoon shown in Figure 1 (pg. 1). a) Are there any differences in the sugar-phosphate arrangements in the 3 DNA molecules? b) What are the similarities and differences regarding the bases in the 3 DNA samples? c) Are the bases paired in an identical manner in all 3 DNA samples? 2) Could the following DNA sequences possibly be a restriction sites (sites in DNA where a restriction enzyme might cut)? Why or why not? a) TCGCGA b) ATCTGA 3) Given this DNA fragment sequence: TGTCATGAATTCTCAATTCTGCAGACCT ACAGTACTTAAGAGTTAAGACGTCTGGA a) How many DNA fragments would result from cutting with EcoRI (recognizes GAATTC, cuts between the G & A)? b) What are the sizes of these fragments? b) How many DNA fragments would result from cutting with both EcoRI (recognizes GAATTC, cuts between G & A) and PstI (recognizes CTGCAG, cuts between A & G)? 4) Our gels were made from a 1% agarose solution prepared in TAE buffer. If you were to prepare this from agarose powder and TAE buffer, how much agarose would you need to prepare 50 ml of agarose gel? Show your calculations, and describe how you would make the 1% agarose solution. 54

5) The electrophoresis apparatus creates an electrical field with a positive electrode at one end of the gel and a negative electrodes at the other end of the gel. a) Which direction will DNA molecules migrate in the gel (+ ) or ( +)? b) Explain why DNA molecules migrate in the direction you chose in part a. c) Which DNA size fragment (large vs. small) would you expect to move toward the opposite end of the gel most quickly? Explain your answer. 6) Looking at the cartoon of a stained agarose gel shown here, answer the following questions: a) What can you assume is contained within each band? b) Which of the DNA samples have the same number of restriction sites for the restriction enzyme used? Write the lane numbers. c) Which sample contains the smallest DNA fragment? d) How many restriction sites were there in the DNA sample in lane five? e) Which DNA samples appear to have been cut into the same number and size of fragments (in other words, which suspect s DNA matches the DNA found at the crime scene)? 55