DNA as a Biometric. Biometric Consortium Conference 2011 Tampa, FL



Similar documents
Melissa May. NetBio - Vice President Strategic Planning. Date: 22/10/2013

Paternity Testing. Chapter 23

Rapid DNA Instrument Update & Enhancement Plans for CODIS

Commonly Used STR Markers

Touch DNA and DNA Recovery. H. Miller Coyle

Forensic DNA Testing Terminology

Forensic Statistics. From the ground up. 15 th International Symposium on Human Identification

DHS Rapid and Low-cost DNA Biometrics

TOP TEN COMPANIES IN FORENSICS TECHNOLOGY SAS020A. David Christofides Project Analyst ISBN:

Single Nucleotide Polymorphisms (SNPs)

DNA & CRIME VICTIMS: WHAT VICTIMS NEED TO KNOW

DNA and Forensic Science

LRmix tutorial, version 4.1

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.

Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis

Forensic. Sciences. Forensic Sciences. Specialties. Programs. Career Pathways

Annex to the Accreditation Certificate D-PL according to DIN EN ISO/IEC 17025:2005

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Rapid DNA Analysis in the Police Booking Suite: FBI Initiative for Reference Sample Point-of-Collection Analysis

DNA Stability Studies: FTA vs 903

Y Chromosome Markers

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

A Simplified Guide To DNA Evidence

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait

Computer with GeneMapper ID (version or most current) software Microsoft Excel, Word Print2PDF software

Chapter 13: Meiosis and Sexual Life Cycles

Mitochondrial DNA Analysis

for Lawyers and Investigating Officers

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Willmar Public Schools Curriculum Map

Forensic Anthropology. Introduction

patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015

Name: Class: Date: ID: A

The College of Forensic Sciences at NAUSS: The pioneer of Forensics in the Arab world

CURRICULUM GUIDE. When this Forensics course has been completed successfully, students should be able to:

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics

Introduction to Post PCR Cleanup

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other?

DNA PROFILING IN FORENSIC SCIENCE

Patient Information. for Childhood

Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation

DNA for Defense Attorneys. Chapter 6

Mixture Interpretation: Defining the Relevant Features for Guidelines for the Assessment of Mixed DNA Profiles in Forensic Casework*

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

Forensic Anthropology Introduction. Human Biology/Forensics B.M.C. Durfee High School

Framework for Biometric Enabled Unified Core Banking

The Science Detectives- Murder in a Science Lab

DNA databases and human rights

Heredity - Patterns of Inheritance

In recent years the number of DNA genetic tests that you can

Rules for conducting ISAG Comparison Tests (CT) for animal DNA testing.

Forensic Science International: Genetics

HISTORY AND SCIENCE OF FORENSIC DNA TESTING. BY: Paul Couenhoven

The Human Genome Project

FIVS 316 BIOTECHNOLOGY & FORENSICS Syllabus - Lecture followed by Laboratory

Gene Mapping Techniques

DNA paternity and relationship testing services

DNA Determines Your Appearance!

Crime Scene Genetics: Transforming Forensic Science through Molecular Technologies MELISSA LEE PHILLIPS

DNA Detection. Chapter 13

Evidence Preservation in Sexual Assault: Between the Crime Scene and the Medical Examination

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

DNA: FORENSIC AND LEGAL APPLICATIONS By: Lawrence Koblinsky, Thomas F. Liotti, Jamel Oeser-Sweat

FORENSIC DNA COLLECTION: A CITIZEN S GUIDE TO YOUR RIGHTS SCENARIOS AND RESPONSES

Package forensic. February 19, 2015

SNP Essentials The same SNP story

Information for patients and the public and patient information about DNA / Biobanking across Europe

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

FAD-DNA-SOP-TOC.1 Page 1 of 2 Issued by Technical Leader

Extracting evidence from forensic DNA analyses: future molecular biology directions

Careers for Biologists in the FORENSIC SCIENCES

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Validation and Replication

Biology and Genetics of New Autosomal STR Loci Useful for Forensic DNA Analysis

Factors for success in big data science

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

Fact Sheet 14 EPIGENETICS

Efficient Attendance Management: A Face Recognition Approach

COMPARISON OF VARIOUS BIOMETRIC METHODS

CCR Biology - Chapter 7 Practice Test - Summer 2012

Chapter 13: Meiosis and Sexual Life Cycles

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.

A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes.

Application Guide... 2

SEQUENCING. From Sample to Sequence-Ready

Transcription:

DNA as a Biometric Biometric Consortium Conference 2011 Tampa, FL September 27, 2011 Dr. Peter M. Vallone Biochemical Science Division National Institute of Standards and Technology Gaithersburg, MD 20899

Outline Basics of DNA Typing DNA as a Biometric

General Characteristics of Genomic DNA Each individual has a unique DNA profile with exception of monozygotic siblings Each person's DNA is the same in every cell DNA from skin cells will match DNA from blood cells An individual s DNA profile remains the same throughout life Half of your DNA comes from your mother and half from your father implications for determining kinship

Sources of Biological Evidence Saliva Blood Semen Urine Hair Teeth Bone Tissue Blood Sample Only a very small amount of blood is needed to obtain a DNA profile best results with >100 cells, but DNA profiles can be recovered from fewer cells

Forensic DNA Testing Probe subsets of genetic variation in order to differentiate between individuals (14 to 16 regions in the human genome) DNA typing must be done efficiently and reproducibly (information must hold up in court) Over 10 million profiles in the national FBI database Typically, we are not looking at genes little/no information about race, predisposition to disease, or phenotypic information (eye color, height, hair color) is obtained

What Type of Genetic Variation? Sequence Variation single nucleotide polymorphisms (SNPs) insertions/deletions GCTAGTCGATGCTC[G/A]GCGTATGCTGTAGC Length Variation short tandem repeats (STRs) CTAGTCGT[GATA][GATA][GATA]GCGATCGT

Short Tandem Repeat (STR) Markers An accordion-like DNA sequence that occurs between genes TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA GATAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACA TGCTTACAGATGCACAC = 12 GATA repeats ( 12 is all that is reported) 7 repeats 8 repeats 9 repeats 10 repeats 11 repeats 12 repeats 13 repeats Target region [short tandem repeat] The number of consecutive repeat units can vary between people The frequency of these repeats observed in the general population have been sampled and are used for the statistical representation of a DNA profile

Core STR Loci for the United States Position of Forensic STR Markers on Human Chromosomes TPOX 13 Core U.S. STR Loci D3S1358 D5S818 D8S1179 TH01 VWA 1997 FGA CSF1PO D7S820 AMEL Sex-typing D13S317 D16S539 D18S51 D21S11 AMEL

Technology Genetics Biology Steps in Forensic DNA Analysis Usually 1-2 day process (a minimum of ~8 hours) Blood Stain Buccal swab Sample Collection & Storage 1.5 h 1.5 h DNA Extraction DNA Quantitation Statistics Calculated DNA Database search Paternity test Reference sample ~3.5 h Multiplex PCR Amplification DNA separation and sizing Applied Use of Information 1.5 h STR Typing Interpretation of Results

Identifiler [Applied Biosystems] 15 STR Loci Kit Information is tied together with multiplex PCR and data analysis D8S1179 {15,16} D21S11 D8S1179 {29,29} D7S820 {9,11} CSF1PO {10,11} D3S1358 {16,17} TH01 D3S1358 {6,7} TH01 D13S317 {8,12} D16S539 {10,11} D2S1338 {19,19} D19S433 {14,16} D19S433 D5S818 AMEL D5S818 {9,11} VWA VWA {15,17} TPOX {8,12} D18S51 {11,15} Amel {X,Y} FGA {19,22} D21S11 Multiplying the frequency of each D13S317 TPOX FGA genotype D7S820 at CSF1PO each locus gives us the Random Match Probability (RMP) D16S539 of 1.25x10 D2S1338-15 for unrelated individuals The chance of an unrelated individual D18S51 having this exact same profile is 1 in 800 trillion This test contains the 13 FBI core loci

Kinship Testing DNA profiles can also be used to evaluate the probability of a specific familial relationship As a familial relationship becomes more distant, the ability of DNA (using 13-15 STRs) to confirm the likelihood of that relationship decreases 1. Parent-offspring 2. Siblings 3. Half siblings = uncle/nephew = grandchild 4. Cousins

Dad Autosomal Paternity Example Child Brother Sister Mom

DNA as a Biometric

Current Biometrics Some commonly measured features Physical Fingerprints (Palm/hand geometry) Iris, retinal Face Odor/scent DNA Behavioral Gait Voice Vein (IR thermogram) Hand geometry Handwriting

Characteristics of a Biometric Universality each person should have the characteristic Uniqueness is how well the biometric separates individuals from another Permanence measures how well a biometric resists aging and variance over time Collectability ease of acquisition for measurement Jain, A. K.; Ross, Arun; Prabhakar, Salil [January 2004], "An introduction to biometric recognition", IEEE Transactions on Circuits and Systems for Video Technology 14th [1]: 4 20

Characteristics of a Biometric (practical considerations) Performance accuracy, speed, and robustness of technology used Acceptability degree of approval of a technology Circumvention/Spoofing ease of use of a substitute Jain, A. K.; Ross, Arun; Prabhakar, Salil [January 2004], "An introduction to biometric recognition", IEEE Transactions on Circuits and Systems for Video Technology 14th [1]: 4 20

DNA Typing as a Biometric Advantages High level of accuracy (Gold Standard) Solid scientific foundation of Forensic DNA Testing (pop stats, molecular biology, court acceptance, protocols, training, education) Kinship determination (unique to DNA) Potential use for: Phenotype (traits; eye/hair color) Biogeographical Ancestry (but not with STR markers) Expensive Challenges Time consuming Sample collection (invasive, stability issues) Technical expertise required for analysis Policy/Privacy/Ethical issues

Interest in Rapid DNA Typing DoD (field testing, rapid intelligence, mass fatalities) DHS (kinship determination, border security, immigration) DoJ (law enforcement, arrestees, initial information) Industry (security, authentication) Each customer will have specific requirements sample input information output degrees of accuracy Time required for generating STR profiles will have to be reduced to less than 2 h. Does the application warrant the time and expense?

Goals for Rapid DNA Typing Systems Develop a fully integrated system capable of performing DNA testing in less than 1-2 hours Little user interaction (or experience) Rugged Swab in answer out Robust Simple data interpretation 4-16 samples per run Disposable chips (with reagents on board)

Rapid DNA Typing Systems Under Development Systems are currently under development These are STR-based and use similar genetic marker systems as law enforcement (CODIS-FBI NDIS) Network Biosystems (Woburn, MA) http://www.netbio.com ZyGEM and Lockheed Martin (Charlottesville,VA) http://www.zygem.com IntegenX (Pleasanton, CA) http://www.integenx.com Forensic Science Service (UK) and Univ of AZ http://www.forensic.gov.uk/ Tomorrow: Special Rapid DNA Session 9:00 AM Session 2 - Rooms 15/16

Questions about the limitations of DNA Identical (monozygotic) twins Occurrence ~1 in 285 births Standard forensic DNA tests can not distinguish between identical twins Fingerprints will be different Random Match Probability does not apply to related individuals Combine biometric modes (DNA + fingerprints) If possible, question when enrolling an individual

Questions about the limitations of DNA Chimeras (different DNA types within the same person) Example: Blood may exhibit one DNA type, but saliva another, OR a combination of both Inherited, acquired from transplant or transfusion Occurrence??? If the DNA profile indicates a mixture, repeat DNA typing to confirm Question when enrolling an individual Combine biometric modes

Birthday Problem 365 possible birthdays Assume no leap year, that all birthdays are equivalent, no bias In a room of 23 people what is the probability that two of them will share a birthday???? 1/365 = 0.27% Answer: There is a ~50% probability of two people sharing a birthday in a room of 23 people. Relevant to multiple occurrences of any birthday http://en.wikipedia.org/wiki/birthday_problem Weir, B. The Rarity of DNA Profiles The Annals of Applied Statistics (2007) 1: 358 370.

These are different questions One to one Many to many The estimated frequency at which a particular STR profile would be expected in a population The estimated frequency at which two STR profiles will match in a set of n profiles Kaye, David H., Trawling DNA Databases for Partial Matches: What is the FBI Afraid of? (February 1, 2009). Cornell Journal of Law and Public Policy, Vol. 19, No. 1, 2009; Penn State Legal Studies Research Paper No. 8-2010.

Thank you for your attention! Questions? Peter.Vallone@nist.gov 301-975-4872 Acknowledgements Erica Butts Outside funding agencies: FBI - Evaluation of Forensic DNA Typing as a Biometric Tool NIJ Interagency Agreement with the Office of Law Enforcement Standards