MOLECULAR IDENTIFICATION OF SARCOCYSTIS SPECIES IN BOVINE MINCED MEAT USING PARTIAL CYTOCHROME OXIDASE SUBUNIT 1 (COX1) GENE IN VAN PROVINCE, TURKEY
|
|
- Janis Perkins
- 13 days ago
- Views:
Transcription
1 TRADITION AND MODERNITY IN VETERINARY MEDICINE, 2022, vol. 7, No 1(12): MOLECULAR IDENTIFICATION OF SARCOCYSTIS SPECIES IN BOVINE MINCED MEAT USING PARTIAL CYTOCHROME OXIDASE SUBUNIT 1 (COX1) GENE IN VAN PROVINCE, TURKEY Bekir Oguz*, M. Serdar Deger University of Van Yüzüncü Yıl, Faculty of Veterinary Medicine, Van, Turkey ABSTRACT Sarcocystis species are obligate two-host protozoan parasites classified in the phylum Apicomplexa. Cattle are generally accepted to be the intermediate hosts for seven species, i.e.,. S. cruzi, S. hirsuta, S. hominis, S. bovifelis, S. bovini, S. rommeli, and S. heydorni. Since it is not possible to differentiate between some species using amplification of the 18S ribosomal (rrna) gen, the aim of this study was to reveal the molecular characterization of Sarcocystis species obtained from cattle minced meat amplifying partial cytochrome oxidase subunit 1 (Cox1) gene. Fifty DNA samples were used. Sequence analyzes of amplicons belonging to positive isolates were performed and their phylogenetic structures were investigated. While S. hominis was found in only one sample, it was molecularly confirmed that S. bovifelis was dominant species in other samples. We designed primer set in present study could not differentiate between S. bovini, S. rommeli and S. bovifelis species. Phylogenetic analyzes of isolates with GenBank records (OK OK041353) were performed with similar isolates in the world. According to phylogenetic analysis, sequence of S. bovifelis (OK041347) was found closer to the isolates from cattle skeletal muscle in Argentina (KT and KT900962). S. hominis (OK041352) isolate showed high genetic similarity to isolates from Netherlands and Italy (MK497840; MH021119). In conclusion, genetic characterization of S. bovifelis and S. hominis was performed for the first time in Van province of Turkey by partial cytochrome oxidase subunit 1 (Cox1) gene. Key words: : sarcocystis, cox1, cattle, PCR, Van, Turkey. Introduction Sarcocystis species are protozoan parasites, with an obligatory two-host cycle and classified in the phylum Apicomplexa. Over 220 species were identified in the genus Sarcocystis and widely seen across the world (Prakas and Butkauskas, 2012; Oğuz et al. 2021). Sarcocystis spp. heteroxen and protozoan parasites form cysts in tissues of intermediate hosts and are thrown out as sporocysts with definitive hosts. Sarcocystis species are obligate two-host protozoan parasites classified in the phylum Apicomplexa. Although there has recently been confusion regarding the validity and classification of several Sarcocystis spp., cattle are generally accepted to be the intermediate hosts for seven species, i.e., S. cruzi, S. hirsuta, S. hominis, S. bovifelis, S. bovini, S. rommeli, and S. heydorni. (Hu et al. 2017; Prakas et al. 2020; Rubiola et al. 2021). Canids (S. cruzi), felids (S. hirsuta and S. rommeli) and humans (S. hominis and S. heydorni) are reported as the definitive hosts of these species. In addition, it is reported that the definitive host of S. bovini and S. bovifelis species is cats (Dubey, 2015; Gjerde, 2016; Hu et al. 2017; Rubiola et al. 2018). It is very important to be able to make precise species identifications of this genus, which also includes zoonotic species. There are morphologically indiscriminable species in the Sarcocystis genus. For this reason, species identification has been applied by molecular technique in recent years (Gjerde, 2016; Hoeve-Bakker et al. 2019; Rubiola et al. 2019; Murata et al. 2018; Prakas et al. 2020; Oğuz et al. 2021; Rubiola et al. 2021).
2 Molecular identification of sarcocystis species in bovine minced meat using 19 It has been reported that the 18S rrna fragment and S. hominis, S. bovifelis, S. bovini and S. rommeli can not be discrimination and the term S. hominis-like should be used for all of them (Rubiola et al. 2018). There is considerable confusion about the validity and classification various Sarcocystis spp. in cattle. Researchers can identify S. bovifelis, S. hominis, S. cruzi, S. rommeli and S. hirsuta using Cox1 gene (Rubiola et al. 2019; Rubiola et al. 2020; Prakas et al. 2020; Rubiola et al. 2021). Moreover, it has been reported that this gene region is more preferable in differentiate taxonomically related Sarcocystis species (Gjerde, 2013; Prakas et al. 2020). It is necessary to establish a accurate diagnosis of species in order to evaluate the public health problems arising from the consumption of contaminated beef. In the previous work (Oğuz et al. 2021), there are samples could not identify Sarcocystis spp. in cattle minced meat obtained from various butcher shops and markets in Van, Turkey. The aim of the present study was to molecular identification of Sarcocystis species obtained from cattle minced meat using partial cytochrome oxidase subunit 1 (Cox1) gene. Materials and methods During 2019, a number of 150 meat sample of cattle were collected from various butcher shops and markets in Van. Fifty samples whose species could not be identified using the 18S rrna gene were selected (Oğuz et al. 2021). Then, they were stored at -20ºC for partial cytochrome oxidase subunit 1 (Cox1) gene analysis. Genomic DNA was initially subjected to PCR with the forward primer F1: 5 - TGTACATACTTACGGCAGGT-3 and reverse R1: 5 - CCG- TAGGTATGGCGATCAT-3 specific primers that amplify approximately 850 bp for the Cox1 gene (Rubiola et al. 2018). PCR was performed in a final volume of 25µl containing 10 µl of 5X MyTaq Reaction buffer (taq polymerase free), 10 pmol 1 µl of each primer, 0.5 µl Taq DNA polymerase (1.25 IU) (MBI Fermentas, Lithuania), 5 µl genomic DNA and 7.5 µl DNase- and RNase-free sterile distilled water (Biobasic, Canada). The cycling conditions began with one cyle at 94 C for 5 min, followed by 35 cycles at 94 C for 1 min, 60 C for 45 s, 72 C for 30 s and ending with one cycle at 72 C for 5 min. PCR products (10 μl) were subjected to electrophoresis on 1.5% agarose gel and visualized with the gel documentation system. PCR products were sent to Sentebiolab biotechnology company in Ankara for sequencing. The final consensus sequences of the isolates were analyzed in the GenBank database "nucleotide BLASTn" (National Center for Biotechnology Information, and similarity rates were compared with the isolates reported from different countries. For the samples whose accurate identification or sequencing results could not be obtained at the initial PCR step were subjected to the PCR by using the different specific primers; COI_HB: AATGTGGTGCGGTATGAACT and COI_H: GGCACCAACGAACATGGTA (amplifying ~420 bp) for S. hominis; COI_HB: AATGTGGTGCGGTATGAACT and COI_B: TCAAAAAC- CTGCTTTGCTG (amplifying ~700 bp) for S. bovifelis (Rubiola et al. 2020). Sarcocystis spp. (bovini/rommeli/bovifelis?), which amplifies approximately 230 bp from the Cox1 gene, BOVF: GGTTTTGCCCAGAATCAACG and BOVR: CGCCGTACCCAGGAAGTTGA were subjected to PCR with the original specific primers. PCR was performed in a final volume of 25µl containing 10 µl of 5X MyTaq Reaction buffer (taq polymerase free), 10 pmol 1 µl of each primer, 0.5 µl Taq DNA polymerase (1.25 IU) (MBI Fermentas, Lithuania), 5 µl genomic DNA and 7.5 µl DNase- and RNase-free sterile distilled water (Biobasic, Canada). The cycling conditions began with one cyle at 95 C for 3 min, followed by 35 cycles at 95 C for 1 min, 58 C for 1 min and 72 C for 30 s and ending with one cycle at 72 C for 5 min. The products (10 μl) obtained at the end
3 20 Bekir Oguz, M. Serdar Deger of PCR were subjected to electrophoresis at 100 volts for 1 hour on 1.5% agarose gel and visualized with the gel documentation system. The identification was made by considering the band sizes in the reference manuscript (Rubiola et al. 2020). Primers for Sarcocystis spp. (bovini/rommeli/bovifelis?) were designed and determined on the partial cytochrome oxidase subunit 1 (Cox1) gene region of the isolate registered as Genbank accession number: LC It was then synthesized in a commercial company (Sentebiolab, Ankara). Sanger sequencing The sequence chromatograms were controlled and arranged using the BioEdit software (Hall 1999). The final consensus sequences of our isolates were subjected to the BLAST analysis ( and their similarity rates were compared with the isolates reported from different countries. Genetic distances were calculated using the Kimura 2 parameter model in MEGA 7.0 (Kumar et al. 2016). The phylogenetic analysis and the construction of phylogenetic tree were performed with 1000-repeated bootstrap using maximum likelihood (ML) and 2500-repeated bootstrap using Neighbor-Joining methods in the MEGA 7.0 (Kumar et al. 2016) software. The nucleotide sequences obtained in the study were submitted as the corresponding accession numbers of OK OK in GenBank. Results Expected fragments of ~850 bp for Sarcocystis spp., ~420 bp for S. hominis, ~700 bp for S. bovifelis and ~230 bp for Sarcocystis spp. (bovini/rommeli/bovifelis?) were successfully amplified. Sarcocystis spp. (~850 bp) was determined in all positive DNA samples (Figure 1). Moreover, S. bovifelis was found in 41 samples (Figure 2), whereas S. hominis was detected in only one samples (Figure 3). As a result of the Sarcocystis spp. (bovini/rommeli/bovifelis?) primer, 32 samples were found positive bands (Figure 4). According to sequence results, 37 readable results were obtained, while 13 of our samples did not result in readable sequences. The sequence results of 32 isolates from which 850 bp and 700 bp bands were obtained were subjected to comparison analysis in the GenBank database, and it was determined that they were 99% similar to Sarcocystis bovifelis (accession numbers: KT and KT900970) (Figures 5 and 6). Our S. hominis (OK041352) isolates was found to be 99% similar to (accession number: MH021119) from Italy (Figure 7). The sequence results of four isolates with bands around 230 bp showed 100% homology with S. bovini (accession number: KT901022) and S. rommeli (accession number: KY120292) (Figure 8). These isolates also displayed a high identity of 97% with S. bovifelis (accession number: KT900976). In this sense, the identifying the types as S. bovini, S. rommeli and S. bovifelis could not be determined with original primer set designed in this study. The reason for the accurate unidentified species can be attributed to the shortness of the amplified region, the low specificity of the primer set we designed, the low genetic difference between three species and the possibility of mixed infections.
4 Molecular identification of sarcocystis species in bovine minced meat using 21 Figure 1: The single-pcr products of Sarcocystis species. M: bp molecular size marker, NC: Negative PCR control; C75, C47, C44, C92, C84, C98, C76, C55, C99, C61: Sarcocystis spp. positives (~850 bp). Figure 2: The single-pcr products of Sarcocystis bovifelis. NC; Negative PCR control Figure 3: The single-pcr products of Sarcocystis hominis. M; bp marker, NC; Negative PCR control, Pozitive sample; H88. Negative samples; H22, H8, H52, H81, H17, H11, H10, H63, H18, H71, H30, H20, H49, H40,
5 22 Bekir Oguz, M. Serdar Deger H91, H62, H69. Figure 4: The single-pcr products of Sarcocystis species. M: bp molecular size marker, NC: Negative PCR control; B70, B51, B73, B78, B58, B19, B29, B54, B68, B48, B72, B50, B83, B100, B2, B67, B24, B93: Sarcocystis spp. positives (~230 bp). Figure 5: DNA sequence alignment of Cox 1 gene in isolated S. bovifelis (~ 700 bp) samples compared with the published sequences of S. bovifelis on GenBank (accessison number: KT900970).
6 Molecular identification of sarcocystis species in bovine minced meat using 23 Figure 6: DNA sequence alignment of Cox 1 gene in isolated Sarcocystis spp. (~ 850 bp) samples compared with the published sequences of S. bovifelis on GenBank (accessison number: KT900962). Figure 7: DNA sequence alignment of Cox 1 gene in isolated Sarcocystis hominis (~ 420 bp) samples compared with the published sequences of S. hominis on GenBank (accessison number: MH021119).
7 24 Bekir Oguz, M. Serdar Deger Figure 8: DNA sequence alignment of Cox 1 gene in isolated Sarcocystis spp. (~ 230 bp) samples compared with the published sequences of S. bovini, S. rommeli and S. bovifelis on GenBank (accessison number: LC KY KT900976).
8 Molecular identification of sarcocystis species in bovine minced meat using 25 Phylogenetic analysis showed that the Cox 1 gene was suitable for the differentiation of S. bovifelis and S. hominis from other species (Figures 9 and 10). Sarcocystis spp. isolates (OK041353) shows greatest similarity with S. bovini and S. rommeli in the same topology in the phylogenetic tree. A subset was also formed with S. bovifelis (MT MT796912) and S. rangiferi (KF KF241401) isolates (Figure 11). According to pairwise comparisons, S. bovifelis and S. hominis showed an average genetic difference of 0.4% with other species. Figure 9: Neighbor-Joining phylogenetic tree of Sarcocystis bovifelis Cox 1 gene sequences with 2,500 bootstrap replicates. The evolutionary history was inferred by using the Kimura 2 parameter. GenBank accession numbers and sequences were obtained from the GenBank database. Isolates from this study are indicated with a black round.
9 26 Bekir Oguz, M. Serdar Deger Figure 10: Neighbor-Joining phylogenetic tree of Sarcocystis hominis Cox 1 gene sequences with 2,500 bootstrap replicates. The evolutionary history was inferred by using the Kimura 2 parameter. GenBank accession numbers and sequences were obtained from the GenBank database. Isolates from this study are indicated with a black round.
10 Molecular identification of sarcocystis species in bovine minced meat using 27 Figure 11: Maximum likelihood phylogenetic tree of Sarcocystis spp. Cox 1 gene sequences with 1,000 bootstrap replicates. The evolutionary history was inferred by using the Kimura 2 parameter. GenBank accession numbers and sequences were obtained from the GenBank database. Isolates from this study are indicated with a black round. Discussion Foods can act as carriers for disease-causing agents such as helminths, protozoa and nematodes. Biological differences in definitive hosts of Sarcocystis species are an important factor affecting transmission. For this reason, determining the dominant species in endemic regions is crucial in terms of ensuring effectiveness in control programs with antiparasitic drugs. The emergence of new species in cattle has led parasitologists and food safety experts to seek different methods to compare the same taxonomic groups (Gjerde, 2016). DNA sequencing and phylogenetic analyzes have been successfully applied in classification of foodborne pathogens (Gjerde, 2016; Hu et al. 2017; Rubiola et al. 2018; Prakas et al. 2020; Oğuz et al. 2021; Rubiola et al. 2021). Although the genus Sarcocystis
11 28 Bekir Oguz, M. Serdar Deger is not as outstanding as other protozoans, it is important for public health in contains zoonotic species. The identification of different species of Sarcocystis is great importance in terms of the epidemiology and control of sarcosporidiosis. The 18S rrna, cytochrome oxidase 1 (cox1) and internal transcribed spacer 1 (ITS1) genes are used in the molecular analyses of species causing cattle sarcosporidiosis. In particular, the 18S rrna gene is more widely used for the identification of Sarcocystis spp. than the other genes (Gjerde, 2016; Hoeve-Bakker et al. 2019; Rubiola et al. 2019; Murata et al. 2018; Prakas et al. 2020; Oğuz et al. 2021; Rubiola et al. 2021). However, taxonomic studies have revealed that Cox 1 is the useful genetic marker for the Sarcocystis family (Gjerde, 2013, 2016; Rubiola et al. 2019). In a study based on the analysis of the 18S rrna gene, the high presence of S. hominis in North-West Italian cattle tested by molecular methods has left some question marks in mind (Chiesa et al. 2013). Researchers confirmed the same samples with the cox 1 gene, reported that their samples were S. bovifelis, and therefore the role of domestic felines in bovine sarcosporidiosis should be reconsidered (Rubiola et al. 2019). In current study, S. hominis and S. bovifelis were identified. While S. hominis was found in one sample, it was determined that the dominant species was S. bovifelis. In the phylogenetic analysis of the cox1 gene; S. bovifelis isolates were found to be located in a single cluster on the phylogenetic tree, and it was also determined that they had a very different genetic structure from S. hominis, S. bovini and S. rommeli. Prakas et al. (2020) revealed the diagnoses of S. bovifelis, S. cruzi and S. hirsuta with the cox1 gene. They reported that the highest overall intraspecific genetic variability was in S. cruzi. Measurement of intraspecific genetic variability of the species found in present study was not performed. However, overall sequence similarity was 99% compared to similar species registered in the Gen- Bank database. Hu et al. (2017) conducted an experimental study showing that cats are definitive hosts of S. rommeli. They detected oocysts/sporocysts in the fecals of two cats fed bovine muscle containing S. rommeli cysts after a day prepatent period. Cox1 sequences results for S. rommelia oocysts/sporocysts isolated from experimental fecal samples showed very high identity with those from S. rommeli sarcocysts (99.4%) isolated from bovine muscle tissue. However, the same samples showed similarity with S. bovini on average (99.5%), and the two species could not be distinguished from each other. No experimental study was conducted in current study. Primer set designed for S. bovini was subjected to PCR reaction and the obtained isolates showed a high rate (100%) similarity with both S. rommeli and S. bovini. On the other hand, it has been determined that it is genetically similar to S. bovifelis at a rate of 97%. It should be noted that S. bovini and S. rommeli have not been identified in Turkey yet. S. bovini has been confirmed in Argentina and New Zealand (Gjerde, 2016;Murata et al. 2018). In addition, S. rommeli has been found in China (Hu et al. 2017). Previous studies have been reported S. bovifelis in cattle from Turkey by using light microscopy (Şaki et al. 2010). These data need to be confirmed by current molecular detection techniques. According to Cox1 phylogenetic analysis, it was determined that S. hominis in the same subgenus showed high genetic differences from these three species. In previous study, we could not obtain accurate information for S. hominis (Oğuz et al. 2021). Because in the past study, the 18S rrna gene region was used. This gene region is widely used for the molecular diagnosis of bovine sarcosporidiosis and has a lower discriminative. The expression S. hominis-like was used for unidentified samples (Rubiola et al. 2018; Oğuz et al. 2021). In the current study, the cox1 gene region and the primer set developed by Rubiola et al. (2020) were used. S. hominis cox1 sequence (Gen- Bank accession number OK041352) showed 99% homology with S. hominis (Hoeve-Bakker et al. 2019) isolated from cattle in the Netherlands and (Rubiola et al. 2020) isolated in human feces in
12 Molecular identification of sarcocystis species in bovine minced meat using 29 Italy. In addition, according to the phylogenetic analysis results, it was revealed that S. hominis can be distinguished from S. bovifelis, S. bovini and S. rommeli in cattle due to the high level of differentiation of the mitochondrial cox1 sequence. Conclusion Molecular characterizations of the species responsible for Sarcocystis infection were conducted in 50 DNA samples obtained from cattle minced meats in Van province, Turkey. The findings of present study, the presence of S. bovifelis and S. hominis was revealed and the primary common species was determined as S. bovifelis. In the present study, S. bovifelis and S. hominis were genetically characterized for the first time in cattle in the region. In Turkey, there is studies noncurrent and microscopic data of the geographical distribution of these two Sarcocystis species. Especially, further research on the zoonotic character of S. hominis is recommended. Acknowledgements This work was financially supported by a grant from Van Yüzüncü Yıl University under the Scientific Research Project (TSA ). The approval of the Ethics Committee for this research was obtained from the Animal Experiments Local Ethics Committee of Van Yüzüncü Yıl University (dated 29/07/2021 and numbered 2021/07-03). The authors declared that there is no conflict of interest. References 1. Chiesa F., Muratore E., Dalmasso A., Civera T. (2013). A new molecular approach to assess the occurrence of Sarcocystis spp. in cattle and products thereof: preliminary data. Ital. J. Food. Safety. 2: e Dubey J.P. (2015). Foodborne and waterborne zoonotic sarcocystosis. Food. Waterborne. Parasitol. 1: Gjerde B. (2013). Phylogenetic relationships among Sarcocystis species in cervids, cattle and sheep inferred from the mitochondrial cytochrome c oxidase subunit I gene. Int. J. Parasitol. 43: Gjerde B. (2016). Molecular characterisation of Sarcocystis bovifelis, Sarcocystis bovini n. sp., Sarcocystis hirsuta and Sarcocystis cruzi from cattle (Bos taurus) and Sarcocystis sinensis from water buffaloes (Bubalus bubalis). Parasitol. Res. 115: Hall T. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis suite. Nucleic. Acids. Symp. Ser. 41: Hoeve-Bakker B.J.A., van der Giessen J.W.B., Franssen F.F.J. (2019). Molecular identification targeting cox1 and 18S genes confirms the high prevalence of Sarcocystis spp. in cattle in the Netherlands. Int. J. Parasitol. 49: Hu J.J., Huang S., Wen T., Esch G.W., Liang Y., Li H.L. (2017). Morphology, molecular characteristics, and demonstration of a definitive host for Sarcocystis rommeli from cattle (Bos taurus) in China. J. Parasitol. 103: Kumar S., Stecher G., Tamura K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 33: Murata R., Suzuki J., Hyuga A., Shinkai T., Sadamasu K. (2018). Molecular identification and characterization of Sarcocystis spp. in horsemeat and beef marketed in Japan. Parasite. 25: 27.
13 30 Bekir Oguz, M. Serdar Deger 10. Oğuz B., Değer M.S., Koşal S. (2021). Molecular identification using 18S ribosomal RNA of Sarcocystis spp. in bovine minced meat in Van Province, Turkey. Ankara. Univ. Vet. Fak. Derg. 68(2): Prakas P., Butkauskas D. (2012). Protozoan parasites from genus Sarcocystis and their investigations in Lithuania. Ekologija. 58: Prakas P., Strazdaitė-Žielienė Ž., Januškevičius V., Chiesa F., Baranauskaite A., Rudaity-Lukosiene E., Serviene E., Petkevicius S., Butkauskas D. (2020). Molecular identification of four Sarcocystis species in cattle from Lithuania, including S. hominis, and development of a rapid molecular detection method. Parasites. Vectors. 13: Rubiola S., Chiesa F., Zanet S., Civera T. (2018). Molecular identification of Sarcocystis spp. in cattle: partial sequencing of Cytochrome C Oxidase subunit 1 (COI). Ital. J. Food. Saf. 7: Rubiola S., Chiesa F., Zanet S., Civera T. (2019). Molecular identification of Sarcocystis spp in cattle: partial sequencing of cytochrome c oxidase subunit 1 (COI). Ital. J. Food. Saf. 7: Rubiola S., Civera T., Ferroglio E., Zanet S., Zaccaria T., Brossa S., Cipriani R., Chiesa F. (2020). Molecular differentiation of cattle Sarcocystis spp. by multiplex PCR targeting 18S and COI genes following identification of Sarcocystis hominis in human stool samples. Food. Waterborne. Parasitol. 21: 18:e Rubiola S., Civera T., Panebianco F., Vercellino D., Chiesa F. (2021). Molecular detection of cattle Sarcocystis spp. in North-West Italy highlights their association with bovine eosinophilic myositis. Parasites. Vectors. 14: Şaki C., Değer S., Ozer E. (2010). Türkiye'de Sarcosporidiosis. Yüzüncü Yıl Üniversitesi Vet. Fak. Derg. (new name Van Vet J) 21 (2): [in Turkish]
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Course Descriptions. I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students)
Course Descriptions I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students) This course is offered during the first semester of the second year of the MD Program. It
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
A quick and simple method for the identi cation of meat species and meat products by PCR assay
Meat Science 51 (1999) 143±148 A quick and simple method for the identi cation of meat species and meat products by PCR assay T. Matsunaga a, K. Chikuni b *, R. Tanabe b, S. Muroya b, K. Shibata a, J.
(Anisoptera: Libellulidae)
Odonatohgica34(2): 173178 June I, 2005 The morphological forms of Palpopleuralucia (Drury) are separatespecies as evidenced by DNA sequencing (Anisoptera: Libellulidae) A. Mitchell¹ and M.J. Samways ²
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS
COMPARING DNA SEQUENCES TO DETERMINE EVOLUTIONARY RELATIONSHIPS AMONG MOLLUSKS OVERVIEW In the online activity Biodiversity and Evolutionary Trees: An Activity on Biological Classification, you generated
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
The Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
Nucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES
Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS
NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT
1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
P. ramorum diagnostics - update. USDA APHIS PPQ CPHST March, 2006
P. ramorum diagnostics - update USDA APHIS PPQ CPHST March, 2006 The Times (UK) 11/17/05 Provisional Approval Process Protocol still evolving and improving > 20 labs in system 7 approved: CDFA, ODA, Oregon
Table 1.1. Sensitivity, specificity and predictive values of latex agglutination test during the first week of illness
LEPTOSPIROSIS Evaluation of indigenously developed leptospira latex agglutination test for diagnosis of Leptospirosis A latex agglutination assay was developed for the detection of antibodies to leptospires
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Reliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA
BIO440 Genetics Laboratory DNA sequencing DNA sequencing is the process of determining the precise order of the nucleotide bases in a particular DNA molecule. In 1974, two methods of DNA sequencing were
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the
Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the ribosomal 16S rdna gene and a fragment of the nuclear single
The National Antimicrobial Resistance Monitoring System (NARMS)
The National Antimicrobial Resistance Monitoring System (NARMS) Strategic Plan 2012-2016 Table of Contents Background... 2 Mission... 3 Overview of Accomplishments, 1996-2011... 4 Strategic Goals and Objectives...
TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river
TURIN Historical capital of Italy City of Art, Nature, Food and Sport Turin is crossed by the Po river, the Italy s longest river The Mole Antonelliana (1863-1889), 167.5 Meters tall is the symbol of the
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action
Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Evidence from Mitochondrial DNA That Head Lice and Body Lice of Humans (Phthiraptera: Pediculidae) are Conspecific
SHORT COMMUNICATION Evidence from Mitochondrial DNA That Head Lice and Body Lice of Humans (Phthiraptera: Pediculidae) are Conspecific N. P. LEO, 1,2 N.J.H. CAMPBELL, 2 X. YANG, 3 K. MUMCUOGLU, 4 AND S.
excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to http://report.predict.global
excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to http://report.predict.global FUTURE DIRECTIONS Historically, attempts to control deadly viruses, such as SARS and
Sándor Hornok 1*,Jenő Kontschán 2,3, Agustín Estrada-Peña 4, Isabel G Fernández de Mera 5,Snežana Tomanović 6 and José de la Fuente 5,7
Hornok et al. Parasites & Vectors (205) 8:47 DOI 0.86/s307-05-0665-0 SHORT REPORT Open Access Contributions to the morphology and phylogeny of the newly discovered bat tick species, Ixodes ariadnae in
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 38 credit hours: 1- Basic requirements: 10 credit hours. 150701, 150702, 150703,
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Zoonotic Protozoan Parasites in Cattle: Emerging Issues
Zoonotic Protozoan Parasites in Cattle: Emerging Issues Dr. Merle E. Olson, Microbiology and Infectious Diseases, University of Calgary, Calgary, Alberta Canada. T2N 4N1. molson@ucalgary.ca Introduction
Fungal DNA sequencing from laser capture microdissection samples
APPLICATION NOTE Laser capture microdissection and Sanger sequencing Fungal DNA sequencing from laser capture microdissection samples Introduction The direct identification of human fungal pathogens by
A data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
2 Short biographies and contact information of the workshop organizers
1 Title of the workshop from sequence to surveillance 2 Short biographies and contact information of the workshop organizers Dr Peter Durr - peter.durr@csiro.au Veterinary epidemiologist, Australian Animal
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Highly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
Protozoologica. More Acanthamoeba Genotypes: Limits to Use rdna Fragments to Describe New Genotype. Daniele Corsaro 1,2 and Danielle Venditti 2
Acta Protozoologica Acta Protozool. (2011) 50: 51 56 http://www.eko.uj.edu.pl/ap More Acanthamoeba Genotypes: Limits to Use rdna Fragments to Describe New Genotype Daniele Corsaro 1,2 and Danielle Venditti
Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application
Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
14.3 Studying the Human Genome
14.3 Studying the Human Genome Lesson Objectives Summarize the methods of DNA analysis. State the goals of the Human Genome Project and explain what we have learned so far. Lesson Summary Manipulating
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
The Variability in the Fungal Ribosomal DNA (ITS1, ITS2, and 5.8 S rrna Gene): Its Biological Meaning and Application in Medical Mycology
The Variability in the Fungal Ribosomal DNA (ITS1, ITS2, and 5.8 S rrna Gene): Its Biological Meaning and Application in Medical Mycology M. Korabecna * Department of Biology, Faculty of Medicine in Pilsen,
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined
Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination