TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU
|
|
|
- Cameron Davidson
- 9 years ago
- Views:
Transcription
1 Conceptual Questions C1. Answer: It is a double-stranded structure that follows the AT/GC rule. C2. Answer: Bidirectional replication refers to DNA replication in both directions starting from one origin. C3. Answer: Statement C is not true. A new strand is always made from a preexisting template strand. Therefore, a double helix always contains one strand that is older than the other. C4. Answer: A. TTGGHTGUTGG HHUUTHUGHUU B. TTGGHTGUTGG HHUUTHUGHUU TTGGHTGUTGG CCAAACACCAA AACCCACAACC HHUUTHUGHUU TTGGHTGUTGG TTGGGTGTTGG CCAAACACCAA CCAAACACCAA AACCCACAACC AACCCACAACC GGTTTGTGGTT HHUUTHUGHUU C5. Answer: No. In a conservative mechanism, one double helix would always be fully methylated so the cell would not have any way to delay the next round of DNA replication via a methylation mechanism. C6. Answer: If we assume there are 4,600,000 bp of DNA, and that DNA replication is bidirectional at a rate of 750 nucleotides per second: If there were just a single replication fork: 4,600,000/750 = 6,133 seconds, or minutes Because replication is bidirectional: 102.2/2 = 51.1 minutes Actually, this is an average value based on a variety of growth conditions. Under optimal growth conditions, replication can occur substantially faster. With regard to errors, if we assume an error rate of one mistake per 100,000,000 nucleotides: 4,600,000 1,000 bacteria = 4,600,000,000 nucleotides of replicated DNA 4,600,000,000/100,000,000 = 46 mistakes When you think about it, this is pretty amazing. In this population, DNA polymerase would cause only 46 single mistakes in a total of 1,000 bacteria, each containing 4.6 million bp of DNA.
2 C7. Answer: 5 DNA polymerase >3 3 5 C8. Answer: DNA polymerase would slide from right to left. The new strand would be 3 CTAGGGCTAGGCGTATGTAAATGGTCTAGTGGTGG 5 C9. Answer: 1. DnaA boxes Binding sites for the DnaA protein. 2. Methylation sites Sites of adenine methylation that are important for regulating DNA replication. 3. AT-rich region Site where the DNA initially separates to form an opening that is sometimes called a replication bubble. C10. Answer: A. When looking at Figure 11.5, the first, second, and fourth DnaA boxes are running in the same direction, and the third and fifth are running in the opposite direction. Once you realize that, you can see that the sequences are very similar to each other. B. According to the direction of the first DnaA box, the consensus sequence is TGTGGATAA ACACCTATT C. This sequence is nine nucleotides long. Because there are four kinds of nucleotides (i.e., A, T, G, and C), the chance of this sequence occurring by random chance is 4 9, which equals once every 262,144 nucleotides. Because the E. coli chromosome is more than 10 times longer than this, it is fairly likely that this consensus sequence occurs elsewhere. The reason why there are not multiple origins, however, is because the origin has five copies of the consensus sequence very close together. The chance of having five copies of this consensus sequence occurring close together (as a matter of random chance) is very small. C11. Answer: A. Your hand should be sliding along the white string. The free end of the white string is the 5 end, and DNA helicase travels in the 5 to 3 direction. B. The white string should be looped by your right hand. The black string is the template strand for the synthesis of the leading strand. DNA polymerase III moves directly toward the replication fork to synthesize the leading strand. The white string is the template for the lagging strand. The template DNA for the lagging strand must be looped around DNA polymerase III so it can move toward the replication fork.
3 C12. Answer: 1. According to the AT/GC rule, a pyrimidine always hydrogen bonds with a purine. A transition still involves a pyrimidine hydrogen bonding to a purine, but a transversion causes a purine to hydrogen bond with a purine or a pyrimidine to hydrogen bond with a pyrimidine. The structure of the double helix makes it much more difficult for this latter type of hydrogen bonding to occur. 2. The induced-fit phenomenon of the active site of DNA polymerase makes it unlikely for DNA polymerase to catalyze covalent bond formation if the wrong nucleotide is bound to the template strand. A transition mutation creates a somewhat bad interaction between the bases in opposite strands, but it is not as bad as the fit caused by a transversion mutation. In a transversion, a purine is opposite another purine, or a pyrimidine is opposite a pyrimidine. This is a very bad fit. 3. The proofreading function of DNA polymerase is able to detect and remove an incorrect nucleotide that has been incorporated into the growing strand. A transversion is going to cause a larger distortion in the structure of the double helix and make it more likely to be detected by the proofreading function of DNA polymerase. C13. Answer: A primer is needed to make each Okazaki fragment. The average length of an Okazaki fragment is 1,000 to 2,000 bp. If we use an average value of 1,500 bp for each Okazaki fragment, then there needs to be approximately 4,600,000 = 3,067 copies 1,500 C14. Answer: Primase and DNA polymerase are able to knock the single-strand binding proteins off the template DNA. C15. Answer: A. The removal of RNA primers occurs in the 5 to 3 direction, while the proofreading function occurs in the 3 to 5 direction. B. No. The removal of RNA primers occurs from the 5 end of the strand. C16. Answer: A. The right Okazaki fragment was made first. It is farthest away from the replication fork. The fork (not seen in this diagram) would be to the left of the three Okazaki fragments, and moving from right to left. B. The RNA primer in the right Okazaki fragment would be removed first. DNA polymerase would begin by elongating the DNA strand of the middle Okazaki fragment and remove the right RNA primer with its 5 to 3 exonuclease activity. DNA polymerase I would use the 3 end of the DNA of the middle Okazaki fragment as a primer to synthesize DNA in the region where the right RNA primer is removed. If the middle fragment was not present, DNA polymerase could not fill in this DNA (because it needs a primer).
4 C. You need DNA ligase only at the right arrow. DNA polymerase I begins at the end of the left Okazaki fragment and synthesizes DNA to fill in the region as it removes the middle RNA primer. At the left arrow, DNA polymerase I is simply extending the length of the left Okazaki fragment. No ligase is needed here. When DNA polymerase I has extended the left Okazaki fragment through the entire region where the RNA primer has been removed, it hits the DNA of the middle Okazaki fragment. This occurs at the right arrow. At this point, the DNA of the middle Okazaki fragment has a 5 end that is a monophosphate. DNA ligase is needed to connect this monophosphate with the 3 end of the region where the middle RNA primer has been removed. D. As mentioned in the answer to part C, the 5 end of the DNA in the middle Okazaki fragment is a monophosphate. It is a monophosphate because it was previously connected to the RNA primer by a phosphoester bond. At the location of the right arrow, there was only one phosphate connecting this deoxyribonucleotide to the last ribonucleotide in the RNA primer. For DNA polymerase to function, the energy to connect two nucleotides comes from the hydrolysis of the incoming triphosphate. In this location shown at the right arrow, however, the nucleotide is already present at the 5 end of the DNA, and it is a monophosphate. DNA ligase needs energy to connect this nucleotide with the left Okazaki fragment. It obtains energy from the hydrolysis of ATP or NAD +. C17. Answer: DNA methylation is the covalent attachment of methyl groups to bases in the DNA. Immediately after DNA replication, the newly made daughter strands are not methylated. The initiation of DNA replication at the origin does not readily occur until after it has become fully methylated. Thus, the time delay of DNA methylation helps to prevent premature DNA replication immediately after cell division. C18. Answer: 1. It recognizes the origin of replication. 2. It initiates the formation of a replication bubble. 3. It recruits helicase to the region. C19. Answer: It would be difficult to delay DNA replication after cell division because the dilution of the DnaA protein is one mechanism that regulates replication. One might expect that such a strain would have more copies of the bacterial chromosome per cell than a normal strain. C20. Answer: The picture would depict a ring of helicase proteins traveling along a DNA strand and separating the two helices, as shown in Figure C21. Answer: An Okazaki fragment is a short segment of newly made DNA in the lagging strand. It is necessary to make these short fragments because in the lagging strand, the replication fork is exposing nucleotides in a 5 to 3 direction, but DNA polymerase is sliding along the template strand in a 3 to 5 direction away from the replication fork. Therefore, the newly made lagging strand is synthesized in short pieces that are eventually attached to each other. C22. Answer: The leading strand is primed once, at the origin, and then DNA polymerase III synthesizes DNA continuously in the direction of the replication fork. In the lagging strand, many short pieces of DNA (Okazaki fragments) are made. This requires many RNA primers. The primers are removed by DNA polymerase I, which then fills in the gaps with DNA. DNA ligase then covalently connects the Okazaki fragments together. Having the
5 enzymes within a complex such as a primosome or replisome provides coordination among the different steps in the replication process and thereby allows it to proceed faster and more efficiently. C23. Answer: The active site of DNA polymerase has the ability to recognize a mismatched nucleotide in the newly made strand and remove it by exonuclease cleavage. Proofreading occurs in a 3 to 5 direction. After the mistake is removed, DNA polymerase resumes DNA synthesis in the 5 to 3 direction. C24. Answer: A processive enzyme is one that remains clamped to one of its substrates. In the case of DNA polymerase, it remains clamped to the template strand as it makes a new daughter strand. This is important to ensure a fast rate of DNA synthesis. C25. Answer: Regulation of DNA replication is necessary to have the correct number of chromosomes per cell. If DNA replication is too slow, daughter cells may not receive any chromosomes. If it is too fast, they may receive too many chromosomes. C26. Answer: The inability to synthesize DNA in the 3 to 5 direction and the need for a primer prevent replication at the 3 end of the DNA strands. Telomerase is different than DNA polymerase in that it uses a short RNA sequence, which is part of its structure, as a template for DNA synthesis. Because it uses this sequence many times in row, it produces a tandemly repeated sequence in the telomere at the 3 ends of linear chromosomes. C27. Answer: The opposite strand is made in the conventional way by DNA polymerase using the strand made via telomerase as a template. C28. Answer: Fifty, because two replication forks emanate from each origin of replication. DNA replication is bidirectional. C29. Answer: The ends labeled B and C could not be replicated by DNA polymerase. DNA polymerase makes a strand in the 5 to 3 direction using a template strand that is running in the 3 to 5 direction. Also, DNA polymerase requires a primer. At the ends labeled B and C, there is no place (upstream) for a primer to be made. C30. Answer: A. Both reverse transcriptase and telomerase use an RNA template to make a complementary strand of DNA. B. Because reverse transcriptase does not have a proofreading function, it is more likely for mistakes to occur. This creates many mutant strains of the virus. Some mutations might prevent the virus from proliferating. However, other mutations might prevent the immune system from battling the virus. These kinds of mutations would enhance the proliferation of the virus. C31. Answer: As shown in Figure 11.24, the first step involves a binding of telomerase to the telomere. The 3 overhang binds to the complementary RNA in telomerase. For this reason, a 3 overhang is necessary for telomerase to replicate the telomere.
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
DNA: Structure and Replication
7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
Bio 102 Practice Problems Chromosomes and DNA Replication
Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Semiconservative DNA replication. Meselson and Stahl
DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis
Appendix C DNA Replication & Mitosis
K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:
C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?
1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Basic attributes of genetic processes (replication, transcription, translation)
411-3 2008 Lecture notes I. First general topic in the course will be mutation (in broadest sense, any change to an organismʼs genetic material). Intimately intertwined with this is the process of DNA
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
7. 3. replication. Unit 7: Molecular biology and genetics
7. 3 DN replication he fact that DN is a self-replicating molecule and can make copies of itself is the basis of all life forms. It is the essence of what life is. Indeed, according to Richard Dawkins
STRUCTURES OF NUCLEIC ACIDS
CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building
Chapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
Viral Infection: Receptors
Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
The Structure, Replication, and Chromosomal Organization of DNA
Michael Cummings Chapter 8 The Structure, Replication, and Chromosomal Organization of DNA David Reisman University of South Carolina History of DNA Discoveries Friedrich Miescher Isolated nuclein from
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
Copyright 1999 2003 by Mark Brandt, Ph.D.
Central dogma of molecular biology The term central dogma of molecular biology is patterned after religious terminology. owever, it refers to a process that is subject to the changes in understanding that
Nucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
Every time a cell divides the genome must be duplicated and passed on to the offspring. That is:
DNA Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: Original molecule yields 2 molecules following DNA replication. Our topic in this section is how is
K'NEX DNA Models. Developed by Dr. Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine
KNEX DNA Models Introduction Page 1 of 11 All photos by Kevin Kelliher. To download an Acrobat pdf version of this website Click here. K'NEX DNA Models Developed by Dr. Gary Benson Department of Biomathematical
Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
3120-1 - Page 1. Name:
Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,
RNA: Transcription and Processing
8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction
Transcription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
NAME. EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12. V. / 10(grads) TOTAL /100 or 110
EXAM IV I. / 60 December 7, 1998 Biochemistry I II. / 15 BI/CH421, BI601, BI/CH621 III. / 13 IV. / 12 V. / 10(grads) TOTAL /100 or 110 I. MULTIPLE CHOICE. (60 points; first 14 are 3 pts the last 9 are
DNA Replication and Repair
DNA Replication and Repair This lecture explores the mechanisms of DNA replication and also the ways in which DNA can repair any replication errors. It also looks at some of the causes of DNA damage and
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Molecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein
ranslation (written lesson) Q: How are proteins (amino acid chains) made from the information in mrn? : ranslation Ribosomes translate mrn into protein ranslation has 3 steps also! 1. ranslation Initiation:
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Illumina TruSeq DNA Adapters De-Mystified James Schiemer
1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Academic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Chapter 14 Lecture Notes: Nucleic Acids
Educational Goals Chapter 14 Lecture Notes: Nucleic Acids 1. Know the three chemical components of a nucleotide: a monosaccharide residue (either ribose or deoxyribose), at least one phosphate group, and
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
Energy & Enzymes. Life requires energy for maintenance of order, growth, and reproduction. The energy living things use is chemical energy.
Energy & Enzymes Life requires energy for maintenance of order, growth, and reproduction. The energy living things use is chemical energy. 1 Energy exists in two forms - potential and kinetic. Potential
DNA Worksheet BIOL 1107L DNA
Worksheet BIOL 1107L Name Day/Time Refer to Chapter 5 and Chapter 16 (Figs. 16.5, 16.7, 16.8 and figure embedded in text on p. 310) in your textbook, Biology, 9th Ed, for information on and its structure
DNA Scissors: Introduction to Restriction Enzymes
DNA Scissors: Introduction to Restriction Enzymes Objectives At the end of this activity, students should be able to 1. Describe a typical restriction site as a 4- or 6-base- pair palindrome; 2. Describe
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
CHAPTER 5 DNA REPLICATION I: Enzymes and mechanism. Basic Mechanisms of Replication
CHER 5 DN RELICION I: Enzymes and mechanism fundamental property of living organisms is their ability to reproduce. Bacteria and fungi can divide to produce daughter cells that are identical to the parental
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
The Biotechnology Education Company
EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
Name Class Date. Summarize the events of DNA replication. Compare DNA replication in prokaryotes with that of eukaryotes.
12.3 DNA Replication Lesson Objectives Summarize the events of DNA replication. Compare DNA replication in prokaryotes with that of eukaryotes. Lesson Summary Copying the Code Each strand of the double
NO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Disaccharides consist of two monosaccharide monomers covalently linked by a glycosidic bond. They function in sugar transport.
1. The fundamental life processes of plants and animals depend on a variety of chemical reactions that occur in specialized areas of the organism s cells. As a basis for understanding this concept: 1.
DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464
Call for action: Paradigm shift in teaching microbiology in a community colleges Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Project Course:
Chapter 8: Energy and Metabolism
Chapter 8: Energy and Metabolism 1. Discuss energy conversions and the 1 st and 2 nd law of thermodynamics. Be sure to use the terms work, potential energy, kinetic energy, and entropy. 2. What are Joules
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Lecture 6. Regulation of Protein Synthesis at the Translational Level
Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP
Chapter 4 The role of mutation in evolution
Chapter 4 The role of mutation in evolution Objective Darwin pointed out the importance of variation in evolution. Without variation, there would be nothing for natural selection to act upon. Any change
Introduction to Proteins and Enzymes
Introduction to Proteins and Enzymes Basics of protein structure and composition The life of a protein Enzymes Theory of enzyme function Not all enzymes are proteins / not all proteins are enzymes Enzyme
Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope
Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron
MULTIPLE CHOICE QUESTIONS
MULTIPLE CHOICE QUESTIONS 1. Most components of energy conversion systems evolved very early; thus, the most fundamental aspects of energy metabolism tend to be: A. quite different among a diverse group
Biology [SBI 4U] FINAL EXAMINATION
Biology [SBI 4U] FINAL EXAMINATION Date: November 28, 2012 (Wednesday) Time: 8:30 a.m. 10:30 a.m. Length: 2 hours Lecturer: Ms. Kimberley Gagnon Canadian International Matriculation Programme Student Name:
Proteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
How To Understand The Chemistry Of Organic Molecules
CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which
BIOLOGY TOPICAL: Molecular Biology Test 1
BIOLOGY TOPICAL: Molecular Biology Test 1 Time: 25 Minutes* Number of Questions: 19 * The timing restrictions for the science topical tests are optional. If you are using this test for the sole purpose
Transcription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
1. A covalent bond between two atoms represents what kind of energy? a. Kinetic energy b. Potential energy c. Mechanical energy d.
1. A covalent bond between two atoms represents what kind of energy? a. Kinetic energy b. Potential energy c. Mechanical energy d. Solar energy A. Answer a is incorrect. Kinetic energy is the energy of
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Lecture 5. 1. Transfer of proper aminoacyl-trna from cytoplasm to A-site of ribosome.
Elongation & Termination of Protein Synthesis (5.1) Lecture 5 1. INITIATION Assembly of active ribosome by placing the first mrna codon (AUG or START codon) near the P site and pairing it with initiation
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
