Certificate of Analysis
|
|
|
- Teresa Mason
- 9 years ago
- Views:
Transcription
1 General CoA (without Mass Spec or HPLC traces) Certificate of Analysis Customer Name: Customer Report Date: 1/16/2009 Order #: QC Summary Name Oligo # Sequence Expected Observed Mass Pass/Fail Lot # Mass Mass Error 1 Name ACGTACGTACGTACGTACG % Pass Name ACGTACGTACGTACGTACG % Pass 1. Observed mass should be within 0.1% of expected mass unless the sequence contains degenerate base(s) Method Summary Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the observed mass. Approved for Released: QC Manager
2 Example of Customer Specified CoA (without Mass Spec or HPLC traces) Certificate of Analysis Customer Name: Customer Report Date: 1/15/2009 Order #: QC Summary Product ID Batch No. Expected Observed % Tolerance Result Mass Mass Difference Name , % +/- 0.1% Pass Volume (ml) Concentration (µm) Total nmoles Purification method HPLC, Reverse-phase Method Summary Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the observed mass. Approved for Release: QC Manager
3 Example of Customer Specified CoA (with Mass Spec and HPLC traces) Certificate of Analysis Customer Name: Customer Report Date: 1/16/2009 Order #: QC Summary DNA Expected Observed Mass HPLC HPLC Amount Amount Amount Name Mass Mass Error 1 Spec Purity 2 Shipped Shipped Shipped Name % >85% 88% 1001 OD 34.5 mg 5.15 µmol 2. Observed mass should be within 0.1% of expected mass 3. HPLC purity determined using RP-HPLC Method Summary HPLC Analytical HPLC analysis was carried out using reverse-phase chromatography under the following conditions: Column: Waters Xbridge OST C18 (4.6 x 50 mm, 2.5 µm) Wavelength: 260 nm Flow: 1.0 ml/min. Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the observed mass. Approved for Released: QC Manager
4 Mass Spec Data: Comments: MOD ACGTACGTACGTACGTACGT Sample ID: Name Target Mass Summary Target Mass (Da) Observed Mass (Da) Mass Error Intensity %Purity (Estimate) Da ( %) 3.54E G Result Code Mass (Da) Intensity DeltaMass %Relative %Total PresumedIdentity E Target Mass: E (A depurination)
5 HPLC Data:
6 Example of a Large Scale Synthesis CoA (with Mass Spec and HPLC traces) Certificate of Analysis Customer Name: Name Report Date: 1/16/2009 Order #: QC Summary DNA Name Oligo # Expected Mass Observed Mass Mass Error 1 HPLC Spec HPLC Purity Amount Shipped Name % >65% 91.1% 12,243 ug Name % >65% 91.0% 10,909 ug 1. Observed mass should be within 0.1% of expected mass Method Summary HPLC Analytical HPLC analysis was carried out using reverse-phase chromatography under the following conditions: Column: Chromolith RP-18e (4.6 x 150 mm) Wavelength: 260nm and 490nm Flow: 1.0 ml/min. Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the observed mass. Approved for Released: QC Manager
7 Mass Spec Data: Sequence: 4ACGTACGTACGTACGTACGTACGTACGT Sample ID: Name Target Mass (Da) Observed Mass (Da) Mass Error Intensity %Purity (Estimate) Result Code Da (0.042 %) 1.41E G Mass (Da) Intensity DeltaMass %Relative %Total PresumedIdentity E Target Mass: E (*K adduct)
8 HPLC Data:
9 Example of an OEM CoA (with Mass Spec and HPLC traces) Certificate of Analysis Customer Name: OEM Report Date: 8/13/2008 Order #: QC Summary DNA Name Expected Mass Observed Mass Mass Error 1 HPLC Spec HPLC Purity 2 Amount Shipped Name % >/= 85% 94.6% 79.3 mgs Name % >/= 85% 95.0% 79.7 mgs Name % >/= 85% 92.3% 80.2 mgs 1. Observed mass should be within 0.1% of expected mass 2. HPLC purity determined using RP-HPLC Method Summary HPLC Analytical HPLC analysis was carried out using the reverse-phase chromatography under the following conditions: Column: Chromolith RP-18e (4.6 x 150 mm) Wavelength: 260nm Flow: 1.0 ml/min. Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the observed mass. Approved for Released: QC Manager
10 Mass Spec Data Sample Name: Name Sequence: ACGTACGTACGTACGTACGTACGTACGT Target Mass (Da) Observed Mass (Da) Mass Error Intensity Da (0.042 %) %Purity (Estimate) Result Code 9.37E G Mass (Da) Intensity DeltaMass %Relative %Total PresumedIdentity E Target Mass: E ? E (A depurination)
11 IE-HPLC Data
12 Example of an Internal Customer CoA (without Mass Spec and HPLC traces) Certificate of Analysis Customer Name: Internal Customer Report Date: 1/19/2009 Order #: QC Summary Name Oligo # Sequence Expected Observed Mass Pass/Fail Lot # Mass Mass Error 1 Z ACGTACGTACGTACGTKNNNKNKNK % Pass Z ACGTACGTACGTACGTKNNNKNKNK % Pass 1. Observed mass should be within 0.1% of expected mass. For sequences containing degenerate base(s), the expected mass should be within 0.5% of the expected MW. 2. These oligos contain degenerate bases. Method Summary Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the observed mass. Approved for Released: QC Manager
13 Example of a Customer Specified CoA (with water specification included) Certificate of Analysis Customer: Name Report Date: 1/16/2009 Order #: QC Summary HPLC Spec HPLC Sequence Amount DNA Name Oligo # Expected Observed Mass Mass Mass Error 1 Purity 2 Shipped Name % >/= 85% 94.6% 4ACGTACGTACGTACGTACGT 150µM x 200µL Name % >/= 85% 86.2% 4ACGTACGTACGTACGTACGT 150µM x 200µL 1 Observed mass should be within 0.1% of the expected mass. 2 HPLC purity was determined by RP-HPLC. Analytical Method Summary HPLC Analytical RP-HPLC analysis was carried out under the following conditions: Column: Chromolith RP-18e (4.6 x 150 mm) Wavelength: 260nm Flow: 1.0 ml/min. Mass Spec Samples were desalted using RP-guard column prior to mass spec analysis by ESI-MS. M/Z (mass/charge) ranging from Dalton was obtained and the m/z data was deconvoluted to determine the mass. Approved for Release: QC Manager
14
LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research
LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research J. Jones, J. Denbigh, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 20581 Key Words SPE, SOLA,
Gel Filtration Standard
Gel Filtration Standard Instruction Manual Catalog # 151-1901 Table of Contents Section 1 Introduction... 1 1.1 Instructions... 1 1.2 Recommended Volume of Standard... 2 1.3 Shelf Life... 5 1.4 Storage...
Protein Separation Technology
[ ] Protein Separation Technology Protein Separation Technology The analysis and characterization of protein samples requires the detection of small chemical differences between large molecules. Most often
HPLC Analysis of Acetaminophen Tablets with Waters Alliance and Agilent Supplies
HPLC Analysis of Acetaminophen Tablets with Waters Alliance and Agilent Supplies Application Note Small Molecule Pharmaceuticals Authors Jignesh Shah, Tiantian Li, and Anil Sharma Agilent Technologies,
Reversed phase C-18 chromatography: From analytical scale to preparative scale
Reversed phase C-18 chromatography: From analytical scale to preparative scale Veronica Thomason*, Jeffrey V. Mitten, and Paul Bellinghausen Teledyne Isco, Inc. P.O. Box 82531 Lincoln, NE 68501 2 Abstract
High-Throughput 3-D Chromatography Through Ion Exchange SPE
High-Throughput 3-D Chromatography Through Ion Exchange SPE Application Note 205 Luke Roenneburg and Alan Hamstra (Gilson, Inc.) Introduction 2-dimensional (2-D) separation is the separation of a sample
Reversed Phase High Presssure Liquid Chromatograhphic Technique for Determination of Sodium Alginate from Oral Suspension
International Journal of PharmTech Research CODEN (USA): IJPRIF ISSN : 0974-4304 Vol.2, No.2, pp 1634-1638, April-June 2010 Reversed Phase High Presssure Liquid Chromatograhphic Technique for Determination
Affi-Prep Protein A Matrix Instruction Manual
Affi-Prep Protein A Matrix Instruction Manual Catalog Numbers 156-0005 156-0006 Bio-Rad Laboratories, 2000 Alfred Nobel Dr., Hercules, CA 94547 LIT-230 Rev B Table of Contents Section 1 Introduction...1
How To Use An Acquity Qda Detector
Mass-Directed Isolation of a Synthetic Peptide Using the ACQUITY QDa Detector Jo-Ann M. Jablonski and Andrew J. Aubin Waters Corporation, Milford, MA, USA APPLICATION BENEFITS The ACQUITY QDa Detector
International GMP Requirements for Quality Control Laboratories and Recomendations for Implementation
International GMP Requirements for Quality Control Laboratories and Recomendations for Implementation Ludwig Huber, Ph.D. [email protected] Overview GMP requirements for Quality Control laboratories
Analysis of Vegetable Oils by High Performance Liquid Chromatography
Analysis of Vegetable Oils by High Performance Liquid Chromatography Using Evaporative Light Scattering Detection and Normal Phase Eluents Andrew J. Aubin, Cecilia B. Mazza, Donald A. Trinite, and Patricia
Separation of Peptides from Enzymatic Digestion on Different Acclaim Columns: A Comparative Study
Application Update Now sold under the Thermo Scientific brand Separation of Peptides from Enzymatic Digestion on Different claim Columns: A Comparative Study INTRODUCTION Separation of peptides which can
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
Extraction and Properties of the Polyphenol, Catechin, as an Antioxidant
Extraction and Properties of the Polyphenol, Catechin, as an Antioxidant Anthony U. Onuzuruike and Jacob J. Woltering Department of Chemistry, University of Missouri-Columbia, Columbia, Missouri 65201
Fast, Reproducible LC-MS/MS Analysis of Dextromethorphan and Dextrorphan
Fast, Reproducible LC-MS/MS Analysis of and Kimberly Phipps, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 685 Key Words Accucore C18, dextromethorphan, dextrorphan, SOLA CX Abstract
Supporting Information
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2013 More than Meets the Eye: Conformational Switching of a Stacked Dialkoxynaphthalene Naphthalenetetracarboxylic diimide
Analysis of Various Vitamins in Multivitamin Tablets
High Performance Liquid Chromatography Analysis of Various Vitamins in Multivitamin Tablets Effective August 24, 2007, the US Food and Drug Administration (FDA) issued a regulation (21 CFR Part 111) that
# LCMS-35 esquire series. Application of LC/APCI Ion Trap Tandem Mass Spectrometry for the Multiresidue Analysis of Pesticides in Water
Application Notes # LCMS-35 esquire series Application of LC/APCI Ion Trap Tandem Mass Spectrometry for the Multiresidue Analysis of Pesticides in Water An LC-APCI-MS/MS method using an ion trap system
Simultaneous determination of L-ascorbic acid and D-iso-ascorbic acid (erythorbic acid) in wine by HPLC and UV-detection (Resolution Oeno 11/2008)
Method OIV-MA-AS313-22 Type II method Simultaneous determination of L-ascorbic acid and D-iso-ascorbic acid (erythorbic acid) in wine by HPLC and UV-detection (Resolution Oeno 11/2008) 1. Introduction
Thermo Scientific SOLAµ SPE Plates Technical Guide. Consistent excellence. for bioanalysis
Thermo Scientific SOLAµ SPE Plates Technical Guide Consistent excellence for bioanalysis SOLAµ - delivering reproducible low volume extractions. Everytime! Thermo Scientific SOLAµ plates are designed for
Thermo Scientific SOLA SPE cartridges and plates Technical Guide. Join the revolution. unparalleled performance
Thermo Scientific SOLA SPE cartridges and plates Technical Guide Join the revolution unparalleled performance Join the revolution next-generation SPE Thermo Scientific SOLA products revolutionize Solid
Peptide synthesis, radiolabelling and radiochemical analysis
SUPPLEMENTAL DATA MATERIALS AND METHODS Peptide synthesis, radiolabelling and radiochemical analysis Solid phase synthesis of peptides was carried out on using ABI 433A peptide synthesizer, on a preloaded
Method Development for Size-Exclusion Chromatography of Monoclonal Antibodies and Higher Order Aggregates
Method Development for Size-Exclusion Chromatography of Monoclonal Antibodies and Higher Order Aggregates Paula Hong and Kenneth J. Fountain Waters Corporation, 34 Maple St., Milford, MA, USA APPLICATION
Products & OEM Services
Products & OEM Services Frits / Filter / Empty Column Frits Frits for SPE/Flash Frits for AC Frits for DNA 4Tip Filter H2OStop Filter Empty SPE Column (with frits) Empty Affinity Chromatography Column
Determination of Food Dye Concentrations in an Unknown Aqueous Sample Using HPLC
Determination of Food Dye Concentrations in an Unknown Aqueous Sample Using HPLC Abstract: High performance liquid chromatography (HPLC) was used to determine the identity and concentrations of food dyes
1.Gene Synthesis. 2.Peptide & Phospho-P. Assembly PCR. Design & Synthesis. Advantages. Specifications. Advantages
1.Gene Synthesis Assembly PCR Looking for a cdna for your research but could not fish out the gene through traditional cloning methods or a supplier? Abnova provides a gene synthesis service via assembly
Certificate of Analysis
BQ-GPEP-A2G2S2-10U Certificate of Analysis Cat. #: BQ-GPEP-A2G2S2-10U Batch: B318-03 Size: 10 μg (3.49nmol) Glycan Structure Oxford Notation CFG Notation Text Notation The glycopeptide is comprised of
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
Thermo Scientific Mass Spectrometric Immunoassay (MSIA)
INSTRUCTIONS FOR USE OF PRODUCTS Thermo Scientific Mass Spectrometric Immunoassay (MSIA) Demonstration Protocol for Affinity Purification and Analysis of Human Insulin from Human Plasma Utilizing MSIA
ERDOSTEINE - MONOGRAPH.
STRUCTURAL FORMULA (±1S-(2-[N-3-(2-oxotetrahydro thienyl)]acetamido)-thioglycolic acid) C 8 H 11 NO 4 S 2 M.W. = 249.307 DESCRIPTION Color : White to ivory white Appearance : Microcrystalline powder SOLUBILITY
TCI Chiral HPLC Column
TCI Chiral HPLC Column ~ Spiral Polymer New Chiral Stationary Phase ~ Tokyo Chemical Industry Co.,Ltd. Chromatography Department 29 Tokyo Chemical Industry Co., Ltd. Features of TCI Chiral A unique new
Unique Bonding Chemistry
columns Acclaim HPLC Columns Reversed-phase silica columns for pharmaceutical, nutraceutical, environmental, food, and life science applications in HPLC. High hydrophobicity, low polarity phases LC/MS
Guide to Reverse Phase SpinColumns Chromatography for Sample Prep
Guide to Reverse Phase SpinColumns Chromatography for Sample Prep www.harvardapparatus.com Contents Introduction...2-3 Modes of Separation...4-6 Spin Column Efficiency...7-8 Fast Protein Analysis...9 Specifications...10
Increasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays
Increasing the Multiplexing of High Resolution Targeted Peptide Quantification Assays Scheduled MRM HR Workflow on the TripleTOF Systems Jenny Albanese, Christie Hunter AB SCIEX, USA Targeted quantitative
Monitoring Protein PEGylation with Ion Exchange Chromatography
Monitoring Protein PEGylation with Ion Exchange Chromatography Peter Yu, Deanna Hurum, Jinyuan (Leo) Wang, Terry Zhang, and Jeffrey Rohrer Thermo Fisher Scientific, Sunnyvale, CA; Thermo Fisher Scientific,
MEDICINAL CHEMISTRY APPLICATIONS BOOK
MEDICINAL CHEMISTRY APPLICATIONS BOOK Introduction...3 The Role of LC and MS in Medicinal Chemistry...5 SCREENING System Management for a High Throughput Open Access UPLC/MS System Used During the Analysis
HiTrap Heparin HP, 1 ml and 5 ml
Instructions 71-7004-00 AU HiTrap affinity columns HiTrap Heparin HP, 1 ml and 5 ml HiTrap Heparin HP is a prepacked ready to use, column for preparative affinity chromatography. The special design of
Q-TOF User s Booklet. Enter your username and password to login. After you login, the data acquisition program will automatically start.
Q-TOF User s Booklet Enter your username and password to login. After you login, the data acquisition program will automatically start. ~ 1 ~ This data acquisition window will come up after the program
Innovative vs Traditional
And in the red corner, introducing the challenger NASDAQ April 4 2011 243.47 $ 1.38 $ 0.58 % 0.07 $ 0.02 $ 39.4 % Technology DVD Digital Streamline Instant Play Internet Access Unlimited Selection No Late
PURIFICATION. Preparative Chromatography Modular Solutions from Manual Systems to Full Automation. Scale Up. Reverse. Phase. Impurity Isolation
PURIFICATION Preparative Chromatography Modular Solutions from Manual Systems to Full Automation PREPARATIVE CHROMATOGRAPHY SOLUTIONS Lab scale Scale Up Reverse Phase Medicinal Chemistry Natural Products
Simultaneous determination of aspartame, benzoic acid, caffeine, and saccharin in sugar-free beverages using HPLC
Simultaneous determination of aspartame, benzoic acid, caffeine, and saccharin in sugar-free beverages using HPLC Mackenzie Ree and Erik Stoa Department of Chemistry, Concordia College, 901 8 th St S,
Supplemental data. A simple and effective cleavable linker for chemical proteomics applications
Supplemental data A simple and effective cleavable linker for chemical proteomics applications Yinliang Yang, annes ahne, Bernhard Kuster, and Steven. L. Verhelst * Figure S1 Figure S2 Figure S3 Table
Appendix 5 Overview of requirements in English
Appendix 5 Overview of requirements in English This document is a translation of Appendix 4 (Bilag 4) section 2. This translation is meant as a service for the bidder and in case of any differences between
Custom Polyclonal Anti-Peptide Antibody, Brochure
Custom Polyclonal Anti-Peptide Antibody, Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a
Application Note. Determination of Nitrite and Nitrate in Fruit Juices by UV Detection. Summary. Introduction. Experimental Sample Preparation
Application Note Determination of Nitrite and Nitrate in Fruit Juices by UV Detection Category Food Matrix Fruit Juice Method HPLC Keywords Ion pair chromatography, fruit juice, inorganic anions AZURA
Protocol: HPLC (amino acids)
Page 1 of 6 1. Chemicals Composition M MW gram volume (ml) product code 0-pthaldialdehyde C 8H 6O 2 134.13 Sigma P0657 Perchloric acid HClO 4 3.5 100.46 Dilute 70% stock solution 1:1 with demi to obtain
ORIGINAL SCIENTIFIC PAPER. Gabriella POHN. Éva VARGA-VISI SUMMARY KEY WORDS
ORIGINAL SCIENTIFIC PAPER 269 Determination of the Enantiomers of Methionine and Cyst(e)ine in the Form of Methionine-sulphon and Cysteic Acid After Performic Acid Oxidation by Reversed Phase High Performance
A Complete Solution for Method Linearity in HPLC and UHPLC
Now sold under the Thermo Scientific brand A Complete Solution for Method Linearity in HPLC and UHPLC Frank Steiner, Fraser McLeod, Tobias Fehrenbach, and Andreas Brunner Dionex Corporation, Germering,
Analysis of Polyphenols in Fruit Juices Using ACQUITY UPLC H-Class with UV and MS Detection
Analysis of Polyphenols in Fruit Juices Using ACQUITY UPLC H-Class with UV and MS Detection Evelyn Goh, Antonietta Gledhill Waters Pacific, Singapore, Waters Corporation, Manchester, UK A P P L I C AT
METHOD OF ANALYSIS. N methyl 2-pyrrolidone
METHOD OF ANALYSIS N methyl 2-pyrrolidone Center for Veterinary Medicine U.S. Food and Drug Administration 7500 Standish Place, Rockville, Maryland 20855 September 26, 2011 This method of detection for
Analytical Test Report
Analytical Test Report Customer: Address (City, State): Purchase Order: Report Number: Project Number: Date Received: Date of Report: Test Location: Boulder, CO. Assay: Part Number: Amino Acids by HPLC
Chapter 28: High-Performance Liquid Chromatography (HPLC)
Chapter 28: High-Performance Liquid Chromatography (HPLC) Scope Instrumentation eluants, injectors, columns Modes of HPLC Partition chromatography Adsorption chromatography Ion chromatography Size exclusion
Data File. Sephadex G-25 media and pre-packed columns. Introduction. Sephadex G-25 Bead structure. Desalting/buffer exchange and gel filtration
P H A R M A C I A B I O T E C H Sephadex G-25 media and pre-packed columns Data File Desalting/buffer exchange and gel filtration Reproducible desalting and buffer exchange in minutes with 90% 100% recovery
PhD Theses STUDY OF THE SOLVENT GRADIENT SIMULATED MOVING BED PREPARATIVE LIQUID CHROMATOGRAPHIC PROCESS. Written by Melinda Nagy
PhD Theses STUDY OF THE SOLVENT GRADIENT SIMULATED MOVING BED PREPARATIVE LIQUID CHROMATOGRAPHIC PROCESS Written by Melinda Nagy Consultants Tibor Szánya Géza Horváth University of Pannonia Department
Oligonucleotide Yield, Resuspension, and Storage
Oligonucleotide Yield, Resuspension, and Storage Contents 1. Introduction... 1 2. Yields of Custom Synthesis Reactions... 1 3. Synthesis Scale, Purification, and Yield... 3 3.1 Scale and Yield... 3 3.2
New drugs of abuse? A case study on Phenazepam & Methoxetamine
New drugs of abuse? A case study on Phenazepam & Methoxetamine Presenter: Nadia Wong Co authors: Dr Yao Yi Ju & Alex Low Xuan Kai Analytical Toxicology Laboratory Clinical & Forensic Toxicology Unit Applied
High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK
High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK Background Unilabs YBS are a bioanalytical CRO based in York (Uk) Copenhagen
ApplicationNOTE Introduction
Introduction Honey, like other foods, is subject to strict quality control measures before it can be sold commercially. It is a natural product, produced solely by bees from flower and tree pollen. Human
Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide
Electronic Supplementary Information Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide W. Mei Kok, a,b,c Denis B. Scanlon, b John A. Karas,
Transfer of a USP method for prednisolone from normal phase HPLC to SFC using the Agilent 1260 Infinity Hybrid SFC/UHPLC System Saving time and costs
Agilent Application Solution Transfer of a USP method for prednisolone from normal phase PLC to SFC using the Agilent 126 Infinity ybrid SFC/UPLC System Saving time and costs Application Note Pharmaceutical
IFC. A new perspective i l ifi ti. p p g p. Single softw FractPAL software plug-in for Agilent ChemStation. Medicinal Chemistry.
IFC A new perspective i l ifi ti Medicinal Chemistry p p CombiChem Compound Isolation Autopurification Drug Discovery y y q p p p p g p Single softw FractPAL software plug-in for Agilent ChemStation The
Specific Challenges in Large-Scale Manufacturing of Peptide as API s Presentation at TIDES Conference, Las Vegas, April 25 29, 2004
Specific Challenges in Large-Scale Manufacturing of Peptide as API s Presentation at TIDES Conference, Las Vegas, April 25 29, 2004 Oleg Werbitzky Slide 2 Agenda Market environment Current manufacturing
Drospirenone and Ethinyl Estradiol Tablets. Type of Posting. Revision Bulletin Posting Date. 31 July 2015 Official Date
Drospirenone and Ethinyl Estradiol Tablets Type of Posting Revision Bulletin Posting Date 31 July 2015 Official Date 01 August 2015 Expert Committee MonographsSmall Molecules 4 Reason for Revision Compliance
Supporting Information
Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany DNA minicircles with gaps for versatile functionalization** Goran Rasched, Damian Ackermann, Thorsten L. Schmidt, Peter Broekmann, Alexander
Development of an Automated Method for Monoclonal Antibody Purification and Analysis. Introduction. Gurmil Gendeh, 1 Wim Decrop, 2 and Remco Swart 2 1
Development of an utomated Method for Monoclonal ntibody Purification and nalysis Gurmil Gendeh, 1 Wim Decrop, and Remco Swart 1 Thermo Fisher Scientific, Sunnyvale, C, US; Thermo Fisher Scientific, msterdam,
Automation of Solid Phase Extraction and Column Chromatographic Cleanup
Automation of Solid Phase Extraction and Column Chromatographic Cleanup Haibin Wan Ltd. Problems with Manual Operation 1. Unstable flow rate affects reproducibility and throughput. 2. Not convenient for
CORESTA RECOMMENDED METHOD N 72
CORESTA RECOMMENDED METHOD N 72 DETERMINATION OF TOBACCO-SPECIFIC NITROSAMINES IN SMOKELESS TOBACCO PRODUCTS BY LC-MS/MS (February 216). INTRODUCTION The CORESTA Smokeless Tobacco Sub-Group studied various
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Multivariate Chemometric and Statistic Software Role in Process Analytical Technology
Multivariate Chemometric and Statistic Software Role in Process Analytical Technology Camo Software Inc For IFPAC 2007 By Dongsheng Bu and Andrew Chu PAT Definition A system Understand the Process Design
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
Experimental procedures. Solid phase peptide synthesis (SPPS)
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry This journal is The Royal Society of Chemistry 214 Experimental procedures Solid phase peptide synthesis (SPPS) Solid phase
SPE, LC-MS/MS Method for the Determination of Ethinyl Estradiol from Human Plasma
SPE, LC-MS/MS Method for the Determination of Ethinyl Estradiol from uman Plasma Krishna Rao Dara, Dr. Tushar N. Mehta, Asia Pacific Center of Excellence, Thermo Fisher Scientific, Ahmedabad, India Application
Determination of Caffeine in Beverages HPLC-1
Determination of in s HPLC-1 Introduction This experiment provides an introduction to the application of High Performance Liquid Chromatography (HPLC) to the solution of complex analytical problems. Cola
Development of validated RP- HPLC method for estimation of rivaroxaban in pharmaceutical formulation
IJPAR Vol.4 Issue 4 Oct Dec - 2015 Journal Home page: ISSN: 2320-2831 Research Article Open Access Development of validated RP- HPLC method for estimation of rivaroxaban in pharmaceutical formulation V.
Journal of Chemical and Pharmaceutical Research
Available on line www.jocpr.com Journal of Chemical and Pharmaceutical Research J. Chem. Pharm. Res., 2010, 2(1): 91-99 ISSN No: 0975-7384 A Stability-Indicating RP-LC method for the Determination of Related
Application Note # LCMS-92 Interlaboratory Tests Demonstrate the Robustness and Transferability of the Toxtyper Workflow
Application Note # LCMS-92 Interlaboratory Tests Demonstrate the Robustness and Transferability of the Toxtyper Workflow Abstract There is high demand in clinical research and forensic toxicology for comprehensive,
Application Note # LCMS-62 Walk-Up Ion Trap Mass Spectrometer System in a Multi-User Environment Using Compass OpenAccess Software
Application Note # LCMS-62 Walk-Up Ion Trap Mass Spectrometer System in a Multi-User Environment Using Compass OpenAccess Software Abstract Presented here is a case study of a walk-up liquid chromatography
POROS CaptureSelect affinity columns for rapid, small-scale purification and sample preparation of recombinant proteins
APPLICATION NOTE POROS CaptureSelect affinity chromatography columns POROS CaptureSelect affinity columns for rapid, small-scale purification and sample preparation of recombinant proteins Introduction
POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins
APPLICATION NOTE POROS CaptureSelect affinity chromatography columns POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins Introduction POROS columns, containing highperformance
Project SMT-CT96-2045
1 Project SMT-CT96-2045 VALIDATION OF ANALYTICAL METHODS TO DETERMINE THE CONTENT OF AFLATOXINS, OCHRATOXIN AND PATULIN IN FOODSTUFFS OF VEGETABLE ORIGIN Partner 7 - Jörg Stroka and Elke Anklam European
1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis
1) Technical informations - a) How does it work? - b) Purification - c) Quality Control 2) Standard synthesis - a) Standard peptides - b) Modified peptides - c) Shipment and Delivery Time - d) How to order?
STANFORD UNIVERSITY MASS SPECTROMETRY 333 CAMPUS DR., MUDD 175 STANFORD, CA 94305-5080
Training on the ZQ Open access MS Questions? Contact Dr. Allis Chien [email protected] 650-723-0710 0710 STANFORD UNIVERSITY MASS SPECTROMETRY STANFORD UNIVERSITY MASS SPECTROMETRY 333 CAMPUS DR., MUDD
Vitamin C quantification using reversed-phase ion-pairing HPLC
Vitamin C quantification using reversed-phase ion-pairing HPLC Thomas Grindberg and Kristy Williams Department of Chemistry, Concordia College, 901 8 th St S, Moorhead, MN 56562 Abstract Vitamin C, an
CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY
CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY 9.1 POLICY This test method may be used to confirm the presence of zolpidem (ZOL), with diazepam-d 5 (DZP-d 5 ) internal standard, in
Exclusive customized epigenetic antibodies
Exclusive customized epigenetic antibodies For many years, Diagenode has acquired a strong and reliable experience in the production of custom epigenetic antibodies, allowing us to become one of the most
BY UV SPECTROPHOTOMETRY
1 of 9 1. PURPOSE This Standard Operating Procedure describes the method for measuring the concentration of viral particles using UV/Vis spectrophotometry at 260 and 280 nm. 2. SCOPE This procedure is
Automated Fast-Bead Synthesis of Small Peptides
Automated Fast-Bead Synthesis of Small Peptides Application Note 228 Joan Stevens, Ph.D., Norbert Wodke, Tim Hegeman and Kirby Reed (Gilson, Inc.) Introduction In proteomic research, the synthesis of peptides
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Turning HTE Agilent LC/MS Data to Knowledge in 1hr
With permission Reaction Analytics Inc. 2011 Page 1 Turning HTE Agilent LC/MS Data to Knowledge in 1hr Neal Sach With permission Reaction Analytics Inc. 2011 Page 2 Contents Acquiring Data Fast demo method
Application Note. Purifying common light-chain bispecific antibodies using MCSGP. Summary
Application Note Purifying common light-chain bispecific antibodies using MCSGP Category Matrix Method Keywords Analytes ID Continuous chromatography, biochromatography Antibodies MCSGP Bispecific antibody,
UPLC-MS/MS Analysis of Aldosterone in Plasma for Clinical Research
UPLC-MS/MS Analysis of in Plasma for Clinical Research Dominic Foley and Lisa Calton Waters Corporation, Wilmslow, UK APPLICATION BENEFITS Analytical selectivity improves reproducibility through removal
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
S olid Ph ase Extraction (SP E) Method:
Solid Phase Extraction of US EPA 535 for Chloroacetanilide and Acetamide Degradates in Drinking Water Samples Prior to Liquid Chromatography/ Tandem Mass Spectrometry Toni Hofhine, Horizon Technology,
EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100