Peptide synthesis, radiolabelling and radiochemical analysis

Size: px
Start display at page:

Download "Peptide synthesis, radiolabelling and radiochemical analysis"

Transcription

1 SUPPLEMENTAL DATA MATERIALS AND METHODS Peptide synthesis, radiolabelling and radiochemical analysis Solid phase synthesis of peptides was carried out on using ABI 433A peptide synthesizer, on a preloaded Thr(tBu)-Wang resin, using N-Fmoc amino acids and HBTU as the coupling reagent (Merck Chemicals). Amino acids had the following protection groups Arg(Pbf), Lys(Boc) Gln (Trt) Asp(OtBu)and Asn(Trt). In order to biotinylate DTPA-A20FMDV2, biotinyl-lysine was incorporated at position two in place of the usual alanine. Following chain assembly, DTPA-tetra(tBu ester) (4eq) (Macrocyclics) was coupled to the N terminal of the protected peptidyl-resin using HOBT/DIC activation and overnight agitation. Following reaction, and washing of the peptidyl-resin, the peptide was cleaved from the resin and side chain protecting groups removed by treatment with 92.5% trifluoroacetic acid, 2.5% ethanedithiol, 2.5% triisopropyl silane, and 2.5% H 2 O. After 2 h, the resin was removed by filtration and peptides were precipitated with diethyl ether on ice. Peptides were isolated by centrifugation, then dissolved in H 2 O and freeze dried overnight. The crude peptides were analysed by Agilent 1100 reverse phase HPLC and electrospray mass spectroscopy. Peptides were purified by reverse phase HPLC to > 90% purity on an Aquapore ODS 20 micron 250 x 10 mm column and lyophilised. During synthesis and purification, use of glassware was avoided. Peptide stock solutions were prepared in metal-free water and standard concentrations were confirmed spectrophometrically using absorption at 215nm. Briefly, 111 In-InCl 3 (58 µl, MBq in 0.1mM HCl) and ammonium acetate (15 µl, 1 M, ph 5.5) were mixed in a polypropylene vial. The peptide conjugate DTPA-A20FMDV2 or DTPA-A20FMDV2ran (5 µl. 1mg/ml in sterile water) was added, the solution was vortexed

2 briefly and incubated for 30 minutes at 25 o C, after which time the reaction was quenched with ethylenediaminetetraacetic acid ([EDTA] 4 µl, 0.1M). Radiochemical purity was determined by reverse-phase HPLC on LC Module 1 (Waters, Hertfordshire, UK) connected to sodium-iodide detector (5-µm Jupiter 300 column, 250 x 4.6 mm inner diameter, Phenomenex; solvent A, 0.1% trifluoroacetic acid [TFA] in HPLC grade water; solvent B, 0.1% TFA in acetonitrile; flow rate, 1 ml/min; gradient, 5% solvent B for 5 min, then change to 60% solvent B over 20 min, then change to 100% solvent B over 3 min, and change back to 5% solvent B over 5 min). Radiochemical purity was greater than 95% at a specific activity of 16 MBq/nmol with no evidence of fragmentation or aggregation during the labelling process as indicated by sharp single peak (see Supplemental Fig. 1) therefore no further purification was done. Any un-reacted 111 In-InCl 3 formed a complex with EDTA eluting off first with t R of 3 min which formed 3-5% impurity. The RP-HPLC elution time for 111 In-DTPA-A20FMDV2 was min and 111 In-DTPA-A20FMDVran min. Instant thin-layer chromatography was carried out using reverse phase plates (Whatman MKC18 Silica Gel 60 A, 200 mm, 1.0 x 7.0 cm) with mobile phase (25mM EDTA in 0.1 M ammonium acetate, ph 5.5); Rf for both radiolabelled peptides 111 In-DTPA-A20FMDV2 and 111 In-DTPA-A20FMDVran was and 111 In-EDTA was Endotoxin content in the final sample was analysed to be less than 17.5 EU (endotoxin unit) using an Endosafe - Portable Testing System (Charles River Laboratories, L Arbresle Cedex, France) with use of FDA-licensed disposable cartridges for accurate endotoxin testing.

3 Supplemental Table 1 PCR primer sequences Gene Sequence Murine itgb6 Sense 5 - TCTGAGGATGGAGTGCTGTG -3 Antisense 5 - GGCACCAATGGCTTTACACT -3 Murine hprt Sense 5 -TGAAAGACTTGCTGGAGATGTCA-3 Antisense 5 -CCAGCAGGTCAGCAAAGAACT-3 Human ITGB6 Sense 5 -AAACGGGAACCAATCCTCTGT-3 Antisense 5 -GCTTCTCCCTGTGCTTGTAGGT-3 Human β2m Sense 5 -AATCCAAATGCGGCATCT-3 Antisense 5 -GAGTATGCCTGCCGTGTG-3

4 Supplemental Figure 1 HPLC profiles of 111 In-DTPA-A20FMDV (A) and 111 In-DTPA-A20FMDVran (B) peptides showing the retention times at and minutes respectively.

5 Supplemental Figure 2 Kinetics and biodistribution of 111 In-labelled DTPA-A20FMDV2 peptide in mice instilled with saline 28 days prior to imaging. Mice were injected intravenously with the αvβ6-

6 specific 111 In- DTPA-A20FMDV2 peptide and subjected to NanoSPECT-CT analysis 1 hour (1-h) and 3 hours (3-h) later. The bladder is masked in each of the scans. Images of a representative mouse are shown.

7 Supplemental Figure 3 NanoSPECT-CT analysis of 111 In-DTPA-A20FMDV2ran peptide binding in the lungs of mice instilled intratracheally with saline (A) and bleomycin-treated (B) mice 28 days earlier. Mice were injected intravenously with peptide and imaged 1 hour later. Images of a representative mouse are shown.

8 Supplemental Figure 4 Coronal NanoSPECT-CT scans of the upper torso showing binding of 111 In- DTPA-A20FMDV2 in the lungs, oral cavity and submandibular glands of animals instilled intratracheally with bleomycin. Mice received IgG2a isotype control (A) or an αvβ6 blocking antibody (B) (2.5mg/Kg) 24 hours prior to imaging, and binding was assessed one hour after intravenous injection of the radiolabelled peptide. Images of a representative mouse are shown.

9 Supplemental Figure 5 Axial NanoSPECT-CT scans of 111 In- DTPA-A20FMDV2 peptide binding within the lungs of bleomycin (A&B) or saline-treated (C&D) animals. Peptide uptake was assessed in each individual animal at both 2 weeks (A&C) and 4 weeks (B&D) after intratracheal instillation of bleomycin or saline. Images of representative mice are shown.

10 Supplemental Figure 6 Immunohistochemical analysis of lung αvβ6 levels (brown), 28 days after treatment with intratracheal saline (A) or bleomycin (B). Images from representative mice are shown. Scale bar is 20µm.

11 Supplemental Figure 7 Hydroxyproline (A) and itgb6 mrna (B) levels were measured in lungs from mice treated with bleomycin (n=6/group) or saline (n=4/group) for 28 days. ITGB6 mrna expression was assessed in lung samples from IPF patients compared with non-fibrotic lungs (C; n=3/ group). Data are presented as mean ± SEM. (**** P< ; * P<0.05). Correlation of 111 In-DTPA- A20FMDV2 binding within the lungs at 28 days post saline (open circles; n=4) or bleomycin (closed circles; n=6) treatment with itgb6 mrna expression (D).

12 Supplemental Video 1 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDV2 peptide within saline-treated lungs. Mice instilled intratracheally with saline 28 days prior to NanoSPECT-CT imaging were injected intravenously with the αvβ6 binding peptide, 111 In-DTPA-A20FMDV2. NanoSPECT-CT scans were performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 2 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDV2 peptide within bleomycin-treated lungs. Mice instilled intratracheally with bleomycin 28 days prior to NanoSPECT-CT imaging were injected intravenously with the αvβ6 binding peptide, 111 In- DTPA-A20FMDV2. NanoSPECT-CT scans were performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 3 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDVran control peptide within saline-treated lungs. Mice instilled intratracheally with saline 28 days prior to NanoSPECT-CT imaging were injected intravenously with the control peptide, 111 In- DTPA-A20FMDVran. NanoSPECT-CT scans performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 4 3D reconstruction of NanoSPECT-CT images of the thorax visualizing binding of 111 In- DTPA-A20FMDVran control peptide within bleomycin-treated lungs. Mice instilled intratracheally with bleomycin 28 days prior to NanoSPECT-CT imaging were injected intravenously with the control peptide, 111 In- DTPA-A20FMDVran. NanoSPECT-CT scans were performed 1 hour later. The reconstruction of a representative mouse is shown. Supplemental Video 5 3D reconstruction of NanoSPECT/CT images of the upper torso visualizing binding of 111 In- DTPA-A20FMDV2 peptide within bleomycin-treated animals in the presence of isotype control antibody (2.5mg/Kg) 24 hours before peptide administration. NanoSPECT-CT scans were performed 1 hour after the intravenous injection of the radiolabelled peptide. The reconstruction of a representative mouse is shown.

13 Supplemental Video 6 3D reconstruction of NanoSPECT-CT images of the upper torso visualizing binding of 111 In- DTPA-A20FMDV2 peptide within bleomycin-treated animals in the presence of antiαvβ6 blocking antibody (2.5mg/Kg) administered 24 hours prior to imaging, NanoSPECT-CT scans were performed 1 hour after the intravenous injection of the radiolabelled peptide. The reconstruction of a representative mouse is shown.

1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis

1) Technical informations. - a) How does it work? - b) Purification - c) Quality Control. 2) Standard synthesis 1) Technical informations - a) How does it work? - b) Purification - c) Quality Control 2) Standard synthesis - a) Standard peptides - b) Modified peptides - c) Shipment and Delivery Time - d) How to order?

More information

Supplemental Material: peptide synthesis

Supplemental Material: peptide synthesis Supplemental Material: peptide synthesis Synthesis of MMAE containing ACPPs (Scheme 1) The peptides were synthesized by using regular solid phase Fmoc peptide synthesis. Peptides that were used for fluorescence

More information

Experimental procedures. Solid phase peptide synthesis (SPPS)

Experimental procedures. Solid phase peptide synthesis (SPPS) Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry This journal is The Royal Society of Chemistry 214 Experimental procedures Solid phase peptide synthesis (SPPS) Solid phase

More information

lung cancer targeted photodynamic therapy and imaging

lung cancer targeted photodynamic therapy and imaging 99m Tc-Hematoporphyrin linked albumin nanoparticles for lung cancer targeted photodynamic therapy and imaging Su-Geun Yang, Ji-Eun Chang, Byungchul Shin, Sanghyun Park, Kun Na and Chang-Koo Shim* *Corresponding

More information

Novel Method for Solid Phase Peptide Synthesis Using Microwave Energy

Novel Method for Solid Phase Peptide Synthesis Using Microwave Energy Novel Method for Solid Phase Peptide Synthesis Using Microwave Energy Jonathan M. Collins, Michael J. Collins, Rebecca C. Steorts CEM Corporation, Matthews, NC 28106-0200, U.S.A. Presented at American

More information

Guide to Reverse Phase SpinColumns Chromatography for Sample Prep

Guide to Reverse Phase SpinColumns Chromatography for Sample Prep Guide to Reverse Phase SpinColumns Chromatography for Sample Prep www.harvardapparatus.com Contents Introduction...2-3 Modes of Separation...4-6 Spin Column Efficiency...7-8 Fast Protein Analysis...9 Specifications...10

More information

Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide

Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide Electronic Supplementary Information Solid-phase Synthesis of Homodimeric Peptides: Preparation of Covalently-linked Dimers of Amyloid-beta Peptide W. Mei Kok, a,b,c Denis B. Scanlon, b John A. Karas,

More information

Standard practices for Fmoc-based solid-phase. peptide synthesis in the Nowick laboratory. (Version 1.6.1)

Standard practices for Fmoc-based solid-phase. peptide synthesis in the Nowick laboratory. (Version 1.6.1) Standard practices for Fmoc-based solid-phase peptide synthesis in the Nowick laboratory (Version 1.6.1) Adam G. Kreutzer and Patrick J. Salveson E-mail: Contents Contributions to this guide 3 General

More information

Peptide Synthesis Zheng Miao* and Zhen Cheng

Peptide Synthesis Zheng Miao* and Zhen Cheng Peptide Synthesis Zheng Miao* and Zhen Cheng 1 Department of Radiology, Molecular Imaging Program at Stanford, Stanford University School of Medicine, Stanford, USA *For correspondence: [email protected]

More information

SUCRALOSE. White to off-white, practically odourless crystalline powder

SUCRALOSE. White to off-white, practically odourless crystalline powder SUCRALOSE Prepared at the 41st JECFA (1993), published in FNP 52 Add 2 (1993). Metals and arsenic specifications revised at the 63rd JECFA (2004). An ADI of 0-15 mg/kg bw was established at the 37th JECFA

More information

Supplemental data. A simple and effective cleavable linker for chemical proteomics applications

Supplemental data. A simple and effective cleavable linker for chemical proteomics applications Supplemental data A simple and effective cleavable linker for chemical proteomics applications Yinliang Yang, annes ahne, Bernhard Kuster, and Steven. L. Verhelst * Figure S1 Figure S2 Figure S3 Table

More information

Automated Fast-Bead Synthesis of Small Peptides

Automated Fast-Bead Synthesis of Small Peptides Automated Fast-Bead Synthesis of Small Peptides Application Note 228 Joan Stevens, Ph.D., Norbert Wodke, Tim Hegeman and Kirby Reed (Gilson, Inc.) Introduction In proteomic research, the synthesis of peptides

More information

CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY

CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY CONFIRMATION OF ZOLPIDEM BY LIQUID CHROMATOGRAPHY MASS SPECTROMETRY 9.1 POLICY This test method may be used to confirm the presence of zolpidem (ZOL), with diazepam-d 5 (DZP-d 5 ) internal standard, in

More information

An In-Gel Digestion Protocol

An In-Gel Digestion Protocol An In-Gel Digestion Protocol This protocol describes the digestion of a protein present in an SDS-PAGE gel band with trypsin. The band can be taken from either a 1D or 2D electrophoresis gel. Reagents

More information

How To Use An Acquity Qda Detector

How To Use An Acquity Qda Detector Mass-Directed Isolation of a Synthetic Peptide Using the ACQUITY QDa Detector Jo-Ann M. Jablonski and Andrew J. Aubin Waters Corporation, Milford, MA, USA APPLICATION BENEFITS The ACQUITY QDa Detector

More information

Peptide Library Synthesis

Peptide Library Synthesis Peptide Library Synthesis Jamie M. R. Moore Guy Laboratory UCSF I. verview.. page 2 II. Reagents and Apparatus. page 4 III. Flow Chart. page 6 IV. Protocol. page 7 IV. Tables A. List of Fmoc Amino. page

More information

Purification of reaction mixtures using flash chromatography.

Purification of reaction mixtures using flash chromatography. Purification of reaction mixtures using flash chromatography. This technical note details the use of ISOLUTE Flash chromatography columns for the purification of reaction mixtures. What is flash chromatography?

More information

Structure-Based Design of Covalent Siah Inhibitors

Structure-Based Design of Covalent Siah Inhibitors Chemistry & Biology, Volume 20 Supplemental Information Structure-Based Design of Covalent Siah Inhibitors John L. Stebbins, Eugenio Santelli, Yongmei Feng, Surya K. De, Angela Purves, Khatereh Motamedchaboki,

More information

High-Throughput 3-D Chromatography Through Ion Exchange SPE

High-Throughput 3-D Chromatography Through Ion Exchange SPE High-Throughput 3-D Chromatography Through Ion Exchange SPE Application Note 205 Luke Roenneburg and Alan Hamstra (Gilson, Inc.) Introduction 2-dimensional (2-D) separation is the separation of a sample

More information

Chapter 2 Antibodies. Contents. Introduction

Chapter 2 Antibodies. Contents. Introduction Chapter 2 Antibodies Keywords Immunohistochemistry Antibody labeling Fluorescence microscopy Fluorescent immunocytochemistry Fluorescent immunohistochemistry Indirect immunocytochemistry Immunostaining

More information

Quality. Now Certified to ISO 9001:2008

Quality. Now Certified to ISO 9001:2008 Quality Now Certified to ISO 90012008 Quality Policy It is Peptides International's goal is to achieve complete customer satisfaction by addressing customer needs and delivering what we promise. The company

More information

Synthesis of Leucine Zippers and Leucine Zipper Dendrimers

Synthesis of Leucine Zippers and Leucine Zipper Dendrimers Supplementary Materials Helical Supramolecules and Fibers Utilizing Leucine-Zipper Displaying Dendrimers Min Zhou, David Bentley, Indraneel Ghosh Contribution from the Department of Chemistry, University

More information

Peptide Antibody Production

Peptide Antibody Production Peptide Antibody Production A) Peptide BioSynthesis (http://www.biosyn.com, 800-227-0627) B) Conjugation of peptide to KLH (Imject Maleimide Activated KLH, PIERCE=Thermo #77605, 10 mg) C) Peptide affinity

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Aspects of industrial purification of peptides using large-scale chromatography. Lars Andersson and Jonas Persson

Aspects of industrial purification of peptides using large-scale chromatography. Lars Andersson and Jonas Persson Aspects of industrial purification of peptides using large-scale chromatography Introduction By Lars Andersson and Jonas Persson PolyPeptide Laboratories (Sweden) AB PO Box 30089 SE-200 61 LIMHAMN SWEDEN

More information

Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide using Biotage

Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide using Biotage Application ote A098 Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide Page 1 Small μmol Scale Synthesis of a Labeled Antimicrobial Peptide using Biotage Initiator+ Alstra Introduction Labeled

More information

TANNIC ACID. SYNONYMS Tannins (food grade), gallotannic acid, INS No. 181 DEFINITION DESCRIPTION

TANNIC ACID. SYNONYMS Tannins (food grade), gallotannic acid, INS No. 181 DEFINITION DESCRIPTION TANNIC ACID Prepared at the 39th JECFA (1992), published in FNP Add 1 (1992) superseding specifications prepared at the 35th JECFA (1989), published in FNP 49 (1990) and in FNP 52 (1992). Metals and arsenic

More information

Supplementary Materials and Methods (Metabolomics analysis)

Supplementary Materials and Methods (Metabolomics analysis) Supplementary Materials and Methods (Metabolomics analysis) Metabolite extraction and mass spectrometry analysis. 12 Vldlr-/- knock out and 12 wild type (WT) retinas were separately frozen at -80 ºC in

More information

Materials and Methods. Protocol for Fmoc- based solid- phase peptide synthesis

Materials and Methods. Protocol for Fmoc- based solid- phase peptide synthesis Materials and Methods All commercially available materials (Aldrich, TCI, ovabiochem, Fluka ) were used without further purification. All solvents were reagent grade or PLC grade (Fisher ). Anhydrous TF,

More information

High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK

High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK High sensitivity assays using online SPE-LC-MS/MS -How low can you go? Mohammed Abrar Unilabs York Bioanalytical solutions, York, UK Background Unilabs YBS are a bioanalytical CRO based in York (Uk) Copenhagen

More information

Supporting Information

Supporting Information Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2013 More than Meets the Eye: Conformational Switching of a Stacked Dialkoxynaphthalene Naphthalenetetracarboxylic diimide

More information

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on

More information

α-cyclodextrin SYNONYMS α-schardinger dextrin, α-dextrin, cyclohexaamylose, cyclomaltohexaose, α- cycloamylase

α-cyclodextrin SYNONYMS α-schardinger dextrin, α-dextrin, cyclohexaamylose, cyclomaltohexaose, α- cycloamylase α-cyclodextrin New specifications prepared at the 57th JECFA (2001) and published in FNP 52 Add 9 (2001). An ADI not specified was established at the 57th JECFA (2001). SYNONYMS α-schardinger dextrin,

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

Materials for Pharmaceutical Manufacturing

Materials for Pharmaceutical Manufacturing Materials for Pharmaceutical Manufacturing GRACE WHITEPAPER Vydac 150HC Purification Media Greater Loading Capacity and Resolution for Improved Productivity in Peptide Purification Technical Development:

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

Analytical Test Report

Analytical Test Report Analytical Test Report Customer: Address (City, State): Purchase Order: Report Number: Project Number: Date Received: Date of Report: Test Location: Boulder, CO. Assay: Part Number: Amino Acids by HPLC

More information

Overview'of'Solid-Phase'Peptide'Synthesis'(SPPS)'and'Secondary'Structure'Determination'by'FTIR'

Overview'of'Solid-Phase'Peptide'Synthesis'(SPPS)'and'Secondary'Structure'Determination'by'FTIR' verviewofsolid-phasepeptidesynthesis(spps)andsecondarystructuredeterminationbyftir Introduction Proteinsareubiquitousinlivingorganismsandcells,andcanserveavarietyoffunctions.Proteinscanactas enzymes,hormones,antibiotics,receptors,orserveasstructuralsupportsintissuessuchasmuscle,hair,and

More information

LUMEFANTRINE Draft proposal for The International Pharmacopoeia (October 2006)

LUMEFANTRINE Draft proposal for The International Pharmacopoeia (October 2006) October 2006 RESTRICTED LUMEFANTRINE Draft proposal for The International Pharmacopoeia (October 2006) DRAFT FOR DISCUSSION World Health Organization 2006 All rights reserved. This draft is intended for

More information

Monoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry

Monoclonal Antibody Fragment Separation and Characterization Using Size Exclusion Chromatography Coupled with Mass Spectrometry Monoclonal ntibody Fragment Separation and haracterization Using Size Exclusion hromatography oupled with Mass Spectrometry uthors Haiying hen Katherine McLaughlin Sepax Technologies, Inc. 5 Innovation

More information

Guidance for Industry

Guidance for Industry Guidance for Industry for the Submission of Chemistry, Manufacturing, and Controls Information for Synthetic Peptide Substances Center for Drug Evaluation and Research (CDER) Center for Biologics Evaluation

More information

The Use of Micro Flow LC Coupled to MS/MS in Veterinary Drug Residue Analysis

The Use of Micro Flow LC Coupled to MS/MS in Veterinary Drug Residue Analysis The Use of Micro Flow LC Coupled to MS/MS in Veterinary Drug Residue Analysis Stephen Lock AB SCIEX Warrington (UK) Overview A rapid, robust, sensitive and specific LC-MS/MS method has been developed for

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

Gel Filtration Standard

Gel Filtration Standard Gel Filtration Standard Instruction Manual Catalog # 151-1901 Table of Contents Section 1 Introduction... 1 1.1 Instructions... 1 1.2 Recommended Volume of Standard... 2 1.3 Shelf Life... 5 1.4 Storage...

More information

LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research

LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research LC-MS/MS Method for the Determination of Docetaxel in Human Serum for Clinical Research J. Jones, J. Denbigh, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 20581 Key Words SPE, SOLA,

More information

A prochelator with a modular masking group featuring hydrogen peroxide activation with concurrent fluorescent reporting

A prochelator with a modular masking group featuring hydrogen peroxide activation with concurrent fluorescent reporting Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information A prochelator with a modular masking group featuring hydrogen peroxide activation

More information

FAST AND EFFICIENT PURIFICATION OF SYNTHETIC PEPTIDES BY SOLID-PHASE EXTRACTION

FAST AND EFFICIENT PURIFICATION OF SYNTHETIC PEPTIDES BY SOLID-PHASE EXTRACTION ACTA CHROMATOGRAPHICA, NO. 14, 2004 FAST AND EFFICIENT PURIFICATION OF SYNTHETIC PEPTIDES BY SOLID-PHASE EXTRACTION W. Kamysz 1,*, M. Okrój 2, E. Łempicka 3, T. Ossowski 3, and J. Łukasiak 1 1 Faculty

More information

Affi-Prep Protein A Matrix Instruction Manual

Affi-Prep Protein A Matrix Instruction Manual Affi-Prep Protein A Matrix Instruction Manual Catalog Numbers 156-0005 156-0006 Bio-Rad Laboratories, 2000 Alfred Nobel Dr., Hercules, CA 94547 LIT-230 Rev B Table of Contents Section 1 Introduction...1

More information

Extraction of Epinephrine, Norepinephrine and Dopamine from Human Plasma Using EVOLUTE EXPRESS WCX Prior to LC-MS/MS Analysis

Extraction of Epinephrine, Norepinephrine and Dopamine from Human Plasma Using EVOLUTE EXPRESS WCX Prior to LC-MS/MS Analysis Application Note AN844 Extraction of, and from Human Plasma Using EVOLUTE EXPRESS WCX Page 1 Extraction of, and from Human Plasma Using EVOLUTE EXPRESS WCX Prior to LC-MS/MS Analysis Introduction Catecholamines

More information

Method Development of LC-MS/MS Analysis of Aminoglycoside Drugs: Challenges and Solutions

Method Development of LC-MS/MS Analysis of Aminoglycoside Drugs: Challenges and Solutions Method Development of LC-MS/MS Analysis of Aminoglycoside Drugs: Challenges and Solutions authors Angela (Qi) Shen, Ling Morgan, Marcele L. Barroso, and Xin Zhang; Tandem Labs Tuyen Nguyen; Sepracor Inc.

More information

TECHNICAL BULLETIN. FluoroTag FITC Conjugation Kit. Product Number FITC1 Storage Temperature 2 8 C

TECHNICAL BULLETIN. FluoroTag FITC Conjugation Kit. Product Number FITC1 Storage Temperature 2 8 C FluoroTag FITC Conjugation Kit Product Number FITC1 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description The FluoroTag FITC Conjugation Kit is suitable for the conjugation of polyclonal and

More information

Your partner in immunology

Your partner in immunology Your partner in immunology Expertise Expertise Reactivity Reactivity Quality Quality Advice Advice Who are we? Specialist of antibody engineering Covalab is a French biotechnology company, specialised

More information

Custom Polyclonal Anti-Peptide Antibody, Brochure

Custom Polyclonal Anti-Peptide Antibody, Brochure Custom Polyclonal Anti-Peptide Antibody, Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a

More information

--not necessarily a protein! (all proteins are polypeptides, but the converse is not true)

--not necessarily a protein! (all proteins are polypeptides, but the converse is not true) 00Note Set 5b 1 PEPTIDE BONDS AND POLYPEPTIDES OLIGOPEPTIDE: --chain containing only a few amino acids (see tetrapaptide, Fig 5.9) POLYPEPTIDE CHAINS: --many amino acids joined together --not necessarily

More information

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex. METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE

More information

Chromatin Immunoprecipitation (ChIP)

Chromatin Immunoprecipitation (ChIP) Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without

More information

RESOURCE Q, 1 ml and 6 ml RESOURCE S, 1 ml and 6 ml

RESOURCE Q, 1 ml and 6 ml RESOURCE S, 1 ml and 6 ml GE Healthcare Life Sciences Instructions 71-7146-00 AI Ion Exchange Columns RESOURCE Q, 1 ml and 6 ml RESOURCE S, 1 ml and 6 ml Introduction RESOURCE Q and S are pre-packed columns for separating biomolecules

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

Antibody Services. Best Guarantees in the Industry! Monoclonal Antibody Services. Polyclonal Antibody Services. Express Antibody TM Services

Antibody Services. Best Guarantees in the Industry! Monoclonal Antibody Services. Polyclonal Antibody Services. Express Antibody TM Services Antibody Services Best Guarantees in the Industry! Monoclonal Antibody Services Polyclonal Antibody Services Express Antibody TM Services Guaranteed Antibody Services Antibody Purification Services Your

More information

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

SIMULTANEOUS DETERMINATION OF NALTREXONE AND 6- -NALTREXOL IN SERUM BY HPLC

SIMULTANEOUS DETERMINATION OF NALTREXONE AND 6- -NALTREXOL IN SERUM BY HPLC SIMULTANEOUS DETERMINATION OF NALTREXONE AND 6- -NALTREXOL IN SERUM BY HPLC Katja SÄRKKÄ, Kari ARINIEMI, Pirjo LILLSUNDE Laboratory of Substance Abuse, National Public Health Institute Manerheimintie,

More information

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,

More information

Solid Phase Peptide Synthesis Methodology with Integrin α5 and Ligand Ac-RGDNP-NH2

Solid Phase Peptide Synthesis Methodology with Integrin α5 and Ligand Ac-RGDNP-NH2 Solid Phase Peptide Synthesis Methodology with Integrin α5 and Ligand Ac-RGDNP-NH2 Amy Ho The University of Texas at Dallas 2006 Abstract Peptides are short chains of amino acids that biologically function

More information

Overview. Purpose. Methods. Results

Overview. Purpose. Methods. Results A ovel Approach to Quantify Unbound Cisplatin, Carboplatin, and xaliplatin in Human Plasma Ultrafiltrate by Measuring Platinum-DDTC Complex Using LC/M/M Min Meng, Ryan Kuntz, Al Fontanet, and Patrick K.

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

Interim Progress Report R&D Project 348. Development of a Field Test Kit for Detection of Blue-Green Algal Toxins

Interim Progress Report R&D Project 348. Development of a Field Test Kit for Detection of Blue-Green Algal Toxins Interim Progress Report R&D Project 348 Development of a Field Test Kit for Detection of Blue-Green Algal Toxins Biocode Limited November 1992 R&D 348/04/A ENVIRONMENT AGENCY 135357 CONTENTS SUMMARY KEYWORDS

More information

HiPer Ion Exchange Chromatography Teaching Kit

HiPer Ion Exchange Chromatography Teaching Kit HiPer Ion Exchange Chromatography Teaching Kit Product Code: HTC001 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 5-6 hours Storage Instructions: The kit is stable for

More information

PrepTip. Reverse Phase PrepTip User Guide

PrepTip. Reverse Phase PrepTip User Guide PrepTip Reverse Phase PrepTip User Guide All text, photographs and illustrations are copyrighted by Harvard Apparatus, Inc. 2004. PrepTip is a trademark of Harvard Apparatus, Inc. Harvard Apparatus 84

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

Spatial Screening of Cyclic Neoglycopeptides: Identification of Multivalent Wheat Germ Agglutinin Ligands**

Spatial Screening of Cyclic Neoglycopeptides: Identification of Multivalent Wheat Germ Agglutinin Ligands** 1 Spatial Screening of Cyclic Neoglycopeptides: Identification of Multivalent Wheat Germ Agglutinin Ligands** Valentin Wittmann* and Sonja Seeberger Experimental Section General. Solid-phase peptide synthesis

More information

SIMULTANEOUS DETERMINATION OF TELMISARTAN AND HYDROCHLOROTHIAZIDE IN TABLET DOSAGE FORM USING REVERSE PHASE HIGH PERFORMANCE LIQUID CHROMATOGRAPHY

SIMULTANEOUS DETERMINATION OF TELMISARTAN AND HYDROCHLOROTHIAZIDE IN TABLET DOSAGE FORM USING REVERSE PHASE HIGH PERFORMANCE LIQUID CHROMATOGRAPHY CHAPTER 5 SIMULTANEOUS DETERMINATION OF TELMISARTAN AND HYDROCHLOROTHIAZIDE IN TABLET DOSAGE FORM USING REVERSE PHASE HIGH PERFORMANCE LIQUID CHROMATOGRAPHY CHAPTER 5 Simultaneous determination of Telmisartan

More information

TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C

TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C HIS-Select Nickel Affinity Gel Catalog Number P6611 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select Nickel Affinity Gel is an immobilized metalion affinity chromatography (IMAC)

More information

USP's Therapeutic Peptides Expert Panel discusses manufacturing processes and impurity control for synthetic peptide APIs.

USP's Therapeutic Peptides Expert Panel discusses manufacturing processes and impurity control for synthetic peptide APIs. Control Strategies for Synthetic Therapeutic Peptide APIs Part III: Manufacturing Process Considerations By Brian Gregg,Aleksander Swietlow,Anita Y. Szajek,Harold Rode,Michael Verlander,Ivo Eggen USP's

More information

Application Note. Separation of three monoclonal antibody variants using MCSGP. Summary

Application Note. Separation of three monoclonal antibody variants using MCSGP. Summary Application Note Separation of three monoclonal antibody variants using MCSGP Category Matrix Method Keywords Analytes ID Continuous chromatography, Biochromatography; FPLC Protein A-purified monoclonal

More information

From Biology to Discovery

From Biology to Discovery POLYCLONAL ANTIBODY PRODUCTION SERVICES Abbiotec offers custom polyclonal antibody production services to the scientific community to accelerate a project From Biology to Discovery. When the antibody for

More information

A Guide to the Analysis and Purification of Proteins and Peptides by Reversed-Phase HPLC

A Guide to the Analysis and Purification of Proteins and Peptides by Reversed-Phase HPLC A Guide to the Analysis and Purification of Proteins and Peptides by Reversed-Phase HPLC HPLC Columns David Carr Your decision has lasting effects. Choose wisely. HPLC Columns Ultra Inert Base-Deactivated

More information

Short Peptide Synthesis

Short Peptide Synthesis Short Peptide Synthesis Keith ó Proinsias 8 th February 2010 Introduction Amide bond and basic amide synthesis Solution phase peptide synthesis Protecting groups required for peptide synthesis Coupling

More information

POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins

POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins APPLICATION NOTE POROS CaptureSelect affinity chromatography columns POROS CaptureSelect affinity columns for highspeed quantification of IgG Fc fusion proteins Introduction POROS columns, containing highperformance

More information

MagExtractor -Genome-

MagExtractor -Genome- Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification

More information

Separation of Peptides from Enzymatic Digestion on Different Acclaim Columns: A Comparative Study

Separation of Peptides from Enzymatic Digestion on Different Acclaim Columns: A Comparative Study Application Update Now sold under the Thermo Scientific brand Separation of Peptides from Enzymatic Digestion on Different claim Columns: A Comparative Study INTRODUCTION Separation of peptides which can

More information

How To Get Rid Of Small Dna Fragments

How To Get Rid Of Small Dna Fragments AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique

More information

The basic division explosives for forensic purposes is shown in Fig. 1

The basic division explosives for forensic purposes is shown in Fig. 1 Isolation, concentration and determination of post blast residua by liquid chromatography with DAD detector capillary electrophoresis with DAD detector Firearm fumes (gunshot residua, GSR) - various metallic

More information

AxyPrep TM Mag PCR Clean-up Protocol

AxyPrep TM Mag PCR Clean-up Protocol AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

INSTRUCTION Probemaker

INSTRUCTION Probemaker INSTRUCTION Probemaker Instructions for Duolink In Situ Probemaker PLUS (Art. no. 92009-0020) and Duolink In Situ Probemaker MINUS (Art. no. 92010-0020) Table of content 1. Introduction 4 2. Applications

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105

Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Background Gold nanoparticle conjugates have been widely used in biological research and biosensing applications.

More information

Application Note. Purifying common light-chain bispecific antibodies using MCSGP. Summary

Application Note. Purifying common light-chain bispecific antibodies using MCSGP. Summary Application Note Purifying common light-chain bispecific antibodies using MCSGP Category Matrix Method Keywords Analytes ID Continuous chromatography, biochromatography Antibodies MCSGP Bispecific antibody,

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

SPE, LC-MS/MS Method for the Determination of Ethinyl Estradiol from Human Plasma

SPE, LC-MS/MS Method for the Determination of Ethinyl Estradiol from Human Plasma SPE, LC-MS/MS Method for the Determination of Ethinyl Estradiol from uman Plasma Krishna Rao Dara, Dr. Tushar N. Mehta, Asia Pacific Center of Excellence, Thermo Fisher Scientific, Ahmedabad, India Application

More information

Oasis HLB Cartridges and 96-Well Plates

Oasis HLB Cartridges and 96-Well Plates CONTENTS I. INTRODUCTION II. SAMPLE PRE-TREATMENT a. Biological Samples b. Solid Samples: Soil, Whole Foods, Tissue c. Aqueous Samples: Water, Beverages d. Non-Aqueous Liquid III. SOLID PHASE EXTRACTION

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Automated Method Development Utilizing Software-Based Optimization and Direct Instrument Control

Automated Method Development Utilizing Software-Based Optimization and Direct Instrument Control Automated Method Development Utilizing Software-Based Optimization and Direct Instrument Control Dr. Frank Steiner, 1 Andreas Brunner, 1 Fraser McLeod, 1 Dr. Sergey Galushko 2 1 Dionex Corporation, Germering,

More information

Fast, Reproducible LC-MS/MS Analysis of Dextromethorphan and Dextrorphan

Fast, Reproducible LC-MS/MS Analysis of Dextromethorphan and Dextrorphan Fast, Reproducible LC-MS/MS Analysis of and Kimberly Phipps, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 685 Key Words Accucore C18, dextromethorphan, dextrorphan, SOLA CX Abstract

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information