TaqMan Assays....not just Primers and Probes. Dr. Uta Möllers Support
|
|
- Derrick Potter
- 7 years ago
- Views:
Transcription
1 TaqMan Assays...not just Primers and Probes Dr. Uta Möllers Support
2 The Applera Genomic Initiative Integrating high value genomic content with state of the art technology solutions
3 Integrated Workflow # genes Whole Genome Survey Hypothesis ALL Data Interpretation RNA Extraction & RT reaction Biological validation or Candidate Gene Analysis Data interpretation Final Target List for Routine Testing 1-100
4 Real Time PCR Chemistry Basics Signal generation with TaqMan MGB Probes
5 5 Nuclease Assay using TaqMan probes 5 3 Forward Primer R TaqMan Probe p Q 5 5 Reverse Primer 3 5
6 Why short Amplicons? Recommendation: Assays with short Amplicons robust PCR-Reactions = high sensitivity! high efficiency = no standard curve necessary! but... Also long Amplicons can be used PCR-efficiency of longer Amplicons drops Quantification requires standard curves
7 5 Nuclease Assay using TaqMan probes 5 3 R p Q
8 5 Nuclease Assay using TaqMan probes 5 3 R p Q Strand Displacement
9 5 Nuclease Assay using TaqMan probes R 5 3 p Q Strand Displacement and Cleavage
10 5 Nuclease Assay using TaqMan probes R p Q Finishing Synthesis
11 TaqMan MGB probes R MGB NFQ MGB MGB: Minor Groove Binder NFQ: Non-Fluorescent Quencher Stabilization of last 5-6 bp on 3 end Short and more specific probes for a given Tm high signal intensity
12 TaqMan Assays How to get the assay for YOUR gene?
13 Manual Approach in the Past Gold Standard Quantitation Technology nm =?pmol =?µl but One-by-One Approach
14 TaqMan Assays remove Bottlenecks Gold Standard Quantitation Technology Effort and cost decreased TaqMan Assays Custom TaqMan Assays TaqMan Low Density Array Applied Biosystems 7900HT, 7500 and 7300 Real-time PCR Systems
15 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
16 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
17 TaqMan Assays Source of transcripts Start with NCBI Reference Sequence transcripts ( Best known, highly curated and nonredundant transcripts in the public domain Manually curated by NCBI scientist Good evidence available: cdna clones
18 TaqMan Assays Regularly updated data from upto 40 total databases, both proprietary and public Quality Quality Control Control
19 Value of the Celera Discovery System SM Platform in the Assay Pipeline PUBLIC PUBLIC plus proprietary
20 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
21 Transcript Pre-Processing 1 Design only in a region of unambiguous sequence > No repeats (poly-nucleotide repeats, ALU repeats etc) Mapping the masked transcripts to the Celera and Public Genome assembly Sequence discrepancies BLAST against Celera SNP database > Most comprehensive SNP database, integrates both public and Celera-proprietary SNPs > Over 4 million known human SNPs > More than 3 million mouse SNPs
22 Transcript Pre-Processing 2 Exon-Exon boundaries of multi-exon genes are marked Identification of single-exon transcripts cdna specific Assays!
23 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
24 Assay Design Long experience with probe and primer design of 5 nuclease assays TaqExpress Automated process Significant enhancement of the algorithms resident in AB Primer Express Software
25 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
26 In Silico Quality Scoring 1 Penalty score for Assay designs that are not highly specific for the gene of interest Assay designs that may not accurately report the quantitative expression results for a particular target
27 In Silico Quality Scoring 2 Transcript BLAST scoring Penalty is assigned if an assay detects any closely homologous transcript(s) Genome BLAST scoring Penalty is assigned if an assay hits a second location on the genome Intron Size scoring Penalty is assigned if an assay is designed across an exon-exon boundary that spans a small intron (<2kb)
28 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
29 TaqMan Assays Massive Bioinformatics Pipeline - High Content RefSeq GenBank Celera Data Mask Repeats, SNPs & discrepancies (CDS/Public Db) Map Gene to Genome (CDS/Public Db), mark Exons Genome QC BLAST Transcript QC BLAST Assay Design High-scoring Assays to Web Manufacturing QC Constant Remapping (CDS/Public Db)
30 Remapping Genomic information is still changing New transcripts are being discovered Constant remapping after a new transcript database is released (i.e. when RefSeq is updated, approx. Every 4 weeks)
31 TaqMan Assays Universal conditions, no optimization!
32 TaqMan Assays How to find the ones I need
33
34 LocusLink ID and Gene Symbol Panther Classification: Function and Process Public Location Celera Gene ID TaqMan Assays Gene Expression sirnas TaqMan Assays SNP Genotyping Public RefSeq and GenBank Trancripts
35 human Chromosome 20 Location displayed graphically Public RefSeq Public GenBank Gene Expression Assays available
36 Click on assay to see which sequences are interrogated Mouse over to get Assay information
37 Integrated Workflow # genes Whole Genome Survey Hypothesis ALL Data Interpretation RNA Extraction & RT reaction Biological validation or Candidate Gene Analysis Data interpretation Final Target List for Routine Testing 1-100
38 TaqMan Low Density Array TaqMan Assays pre-loaded 1 to to 8 Samples to to 380 Targets (per (perone one array) array) 384 spots No. of ofreplicates
39 Configuring my Custom Array Number of Genes Number of Replicates Number of Samples per Array A CTL CTL B CTL CTL C CTL CTL D CTL CTL E CTL CTL F CTL CTL G CTL CTL H CTL CTL I CTL CTL J CTL CTL K CTL CTL L CTL CTL M CTL CTL N CTL CTL O CTL CTL P CTL CTL A CTL B C CTL D E CTL F G CTL H I CTL J K CTL L M CTL N O CTL P A CTL CTL B CTL CTL C D E F G H I J K L M N O P
40 Trademarks For Research Use Only. Not for use in diagnostic procedures. Applied Biosystems and Celera are registered trademarks and AB (Design), Applera,Celera Discovery System, iscience, and iscience (Design) are trademarks of Applera Corporation or its subsidiaries in the US and/or certain other countries. TaqMan is a registered trademark of Roche Molecular Systems, Inc. SYBR is a registered trademark of Molecular Probes, Inc. All other trademarks are the sole property of their respective owners Applied Biosystems. All rights reserved.
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationReplacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin
User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin
More informationEssentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationGene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program
WHITE PAPER TaqMan Assays QPCR Guarantee Program Gene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program Real-Time PCR for the Quantification of Gene Expression Real-time
More informationCustom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide
Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in
More informationTaqMan Gene Expression Assays
Product Guide TaqMan Gene Expression Assay Products Product Guide TaqMan Gene Expression Assays Applied Biosystems TaqMan Gene Expression Assays Solutions Applied Biosystems offers the largest family of
More informationThe AB7900Fast and Principles of Real Time PCR
The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications
More informationQuantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
More informationGetting Started Guide
Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering
More informationPitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A.
Pitfalls in qpcr Primer and probe design and synthesis Mary Span Eurogentec S.A. Steps in qpcr assay Set up experiment statistical relevant # samples/experimental group controls Design and synthesis primers
More informationSeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationProtocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
More informationTaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationReal-time qpcr Assay Design Software www.qpcrdesign.com
Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationTaqMan Genotyper Software v1.0.1 TaqMan Genotyping Data Analysis Software
TaqMan Genotyper Software v1.0.1 TaqMan Genotyping Data Analysis Software March 2011 Product Overview TaqMan Genotyper Software TaqMan Genotyper Software Standalone data analysis software for Applied Biosystems
More informationFactors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
More informationCreating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards
More informationIntroduction to Quantitative PCR
Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770
More informationQPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
More informationTechnical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
More informationCo Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More informationReagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems
Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All
More informationAbsolute Quantitation Using Standard Curve Getting Started Guide
Applied Biosystems 7900HT Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started Guide Introduction Designing an AQ Experiment Preparing the Samples and Reaction Plate Creating
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationAbsolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
More informationReal time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed
Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationReconstituting and Diluting Primers and TaqMan Probes
Reconstituting and Diluting Primers and TaqMan Probes Introduction TaqMan primers are commonly shipped in a lyophilized state. TaqMan probes are sometimes shipped in the lyophilized state, but more often
More informationSUBJECT: New Features in Version 5.3
User Bulletin Sequencing Analysis Software v5.3 July 2007 SUBJECT: New Features in Version 5.3 This user bulletin includes the following topics: New Features in v5.3.....................................
More informationStepOne and StepOnePlus Real-Time PCR Systems
PRODUCT BROCHURE Real-Time PCR Systems StepOne and StepOnePlus Real-Time PCR Systems Remarkably Simple Systems. Simply Remarkable Results. Step Up To High Performance Real-Time PCR Remarkably Simple Systems
More informationSupplemental Information. McBrayer et al. Supplemental Data
1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationTaqMan Gene Expression Assay solutions. Proven performance for fast, reliable results
TaqMan Gene Expression Assay solutions Proven performance for fast, reliable results The leader in gene expression analysis Life Technologies is a leader in gene expression analysis, providing world-class
More informationReal-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems
Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Chemistry Guide Copyright 2004 Applied Biosystems. All rights reserved. For Research Use Only.
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationHepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use
More informationDescription: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
More informationReal-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems
Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Chemistry Guide Copyright 2005 Applied Biosystems. All rights reserved. For Research Use Only.
More informationQuantification of Hepatitis B Virus. Core Protein Region. 150 tests
Quantification of Hepatitis B Virus Core Protein Region For general laboratory and research use only 150 tests Introduction to Hepatitis B Virus Originally known as serum hepatitis, hepatitis B has only
More informationRelative Quantification Applied Biosystems 7300/7500 Real Time PCR System
5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing
More informationHighly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
More informationSNPbrowser Software v3.5
Product Bulletin SNP Genotyping SNPbrowser Software v3.5 A Free Software Tool for the Knowledge-Driven Selection of SNP Genotyping Assays Easily visualize SNPs integrated with a physical map, linkage disequilibrium
More informationAutomated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationUser Bulletin All PCR Instruments
User Bulletin All PCR Instruments May 26, 2000 SUBJECT: Primer Express Version 1.5 and TaqMan MGB Probes for Allelic Discrimination Release of Primer Express Version 1.5 Introducing TaqMan MGB Probes In
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationQuantification of Mycobacterium Tuberculosis. 150 tests
Quantification of Mycobacterium Tuberculosis rep 13E12 For general laboratory and research use only 150 tests Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium that
More informationSICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
More informationMethods and Application Guide. Introduction to Quantitative PCR
Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304
More informationMegaplex Pools For microrna Expression Analysis
Megaplex Pools For microrna Expression Analysis Protocol Copyright 2008, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document
More informationIntroduction to Gene Expression. Getting Started Guide
Introduction to Gene Expression Getting Started Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without
More informationData Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial
Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds Overview In order for accuracy and precision to be optimal, the assay must be properly evaluated and a few
More informationAdvances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationTaqMan MicroRNA Assays
TaqMan MicroRNA Assays Protocol December 23, 2005 11:22 am, mirna_title.fm Copyright 2005-6, Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information
More informationNext Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
More informationMystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationTargeted. sequencing solutions. Accurate, scalable, fast TARGETED
Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered
More informationqstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
More informationBiological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
More informationRelative Quantitation Using Comparative C T Getting Started Guide
Applied Biosystems 7900HT Fast Real-Time PCR System Relative Quantitation Using Comparative C T Getting Started Guide Introduction N Designing an RQ Experiment Preparing Samples and Reaction Plates Creating
More informationDengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory
More informationHuman Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...
TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...
More informationCopyCaller Software. User Guide
CopyCaller Software User Guide CopyCaller Software User Guide Information in this document is subject to change without notice. For Research Use Only. Not for use in diagnostic procedures. APPLIED BIOSYSTEMS
More informationA systematic guideline for developing the best real-time PCR primers
Scientific article Lessons learned from designing assays for more than 14, genes George Quellhorst and Sam Rulli QIAGEN, 6951 Executive Way, Frederick, Maryland 213, USA Abstract: Primer design is the
More informationRelative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
More informationQuantifiler Kits Quantifiler Human DNA Quantification Kit and Quantifiler Y Human Male DNA Quantification Kit
Quantifiler Kits Quantifiler Human DNA Quantification Kit and Quantifiler Y Human Male DNA Quantification Kit User s Manual Applied Biosystems Quantifiler Kits Quantifiler Human DNA Quantification Kit
More informationReal-Time Quantitative PCR Instruments and Consumables
Index Page Sequence Detection Systems 2 Sequence Detection Systems Accessories and Softwares 3 Sequence Detection PCR Reagent Kits 4 Sequence Detection PCR Reagents 9 Sequence Detection Systems Disposables
More informationAccurate and sensitive mutation detection and quantitation using TaqMan Mutation Detection Assays for disease research
PPLICTION NOTE Mutation Detection ssays ccurate and sensitive mutation detection and quantitation using Mutation Detection ssays for disease research In this research study, we addressed the feasibility
More informationExercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
More informationSMRT Analysis v2.2.0 Overview. 1. SMRT Analysis v2.2.0. 1.1 SMRT Analysis v2.2.0 Overview. Notes:
SMRT Analysis v2.2.0 Overview 100 338 400 01 1. SMRT Analysis v2.2.0 1.1 SMRT Analysis v2.2.0 Overview Welcome to Pacific Biosciences' SMRT Analysis v2.2.0 Overview 1.2 Contents This module will introduce
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationApplication Note. Single Cell PCR Preparation
Application Note Single Cell PCR Preparation From Automated Screening to the Molecular Analysis of Single Cells The AmpliGrid system is a highly sensitive tool for the analysis of single cells. In combination
More informationApplication Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
More informationMaterials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling
Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora
More informationQUALITY AND SAFETY TESTING
QUALITY AND SAFETY TESTING Large scale of solutions for the identification and rapid detection of micro-organisms. Easier investment in molecular techniques Frédéric BAR, Key Account Manager b2 b3b4 Quality
More informationValidating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
More informationAssays-on-Demand Gene Expression Products
Assays-on-Demand Gene Expression Products Protocol March 20, 2002 3:50 pm, AssaysOnDemand_Title.fm Copyright 2002, Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic
More informationMicroarray Technology
Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except
More informationTaqMan Copy Number Assays. Protocol
TaqMan Copy Number Assays Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. Life Technologies
More informationUser Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
More informationHuman Herpes Virus 4 (Epstein Barr)
Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein
More informationCompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
More informationStratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
More informationquantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
More informationQuantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
More informationIntroduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
More information