ndna Tim Hughes Avdeling for Medisinsk Oslo Universitets Sykehus (Ullevål)
|
|
- Samuel Stokes
- 8 years ago
- Views:
Transcription
1 ndna Utvikling av nasjonal analyse- og lagringspla3orm for DNA sekvensdata i helsevesenet Tim Hughes Avdeling for Medisinsk Gene@kk Oslo Universitets Sykehus (Ullevål)
2 My goal Present the ndna project and its underlying e- infrastructure (TSD) In the context of the issues of relevance to the proposed forum: data storage and challenges in our field areas of with other research legal and ethical aspects of data access Finally, present some opinions about the proposed forum
3 The data DNA sequence Total length of the 23 human chromosomes (genome) = 3 billion bases Sequencing involves reading of the sequence of bases
4 data: High Throughput Sequencing Similar to low throughput (Sanger) sequencing Orders of magnitude speed- up and cost through massive Billions of short reads in one run Sequencing one human genome can be done in hours instead of years research And more generally biology
5 Where is data generated in Norway? Core facility located at UiO and OUS Funded by: Producing trillions of bases of raw data per year Other labs with private HTS machines Radium Ski Bodø
6 E- infrastructure requirements Storage TBs just for the raw data And more for the downstream analyses high bandwidth between storage and CPU for mapping reads back to the genome for wide array of downstream analyses usually trivially parallelisable Why not use Notur and Norstore? Human data even meta- data that has been de- is considered cannot store data on user system with username/password access data requires: two part encrypted storage (?) control of data (REK) of sniffing through separate physical or virtual machines
7 The setup Sharing data is not straight forward No offsite backup All IT maintenance done ourselves (hardware and soiware) Others have similar problems >>
8 TSD: USIT s Tjeneste Sensi@ve Data Goal: store compute share, large sensi@ve data in a secure way Effec@vely a secure version of exis@ng non- secure services (Notur and Norstore) Ini@ated in 2009 with other users: Radium Hospitalet Psykologisk Ins@tuc (UiO) TSD 1.0: just storage >> complete 2011
9 TSD 2.0 Founding users lacked sharing (e.g. with collaborators) required secure user management Many other users appeared Notur and Norstore became involved and provided funding ndna project was funded by NFR through Verdikt
10 What is the ndna project? Nasjonal analyse- og lagringspla3orm for DNA sekvensdata i helsevesenet diagnos@c and not research Funded by NFR Verdikt program (bruker ini@ert forskning) Bruker: OUS Avdeling for Medisinsk Gene@kk Research partners Informa@kk Ins@@tuc UiO UiO HPC group OUS IT Project end date: summer 2015
11 Why ndna HTS makes rapid from research to searching for causal variant with instead of a pocket light in the not- too- distant- future sequencing will be performed up- front for future reference queriable by expert systems Expert system (Cardiology) Front- end DNA analysis sojware TSD 2.0 (USIT/Norstore/Notur) Expert system (immunology) Sequencing center Requires similar func@onality as research projects, plus: extra security more automa@on more reliability
12 TSD 2.0 progress USIT (UiO) currently requirements from users: OUS Medial as center (ndna) OUS Medical as research center epitwin Addison s disease Many other users (not all working on DNA data e.g. Department of Psychology) System design to start in spring 2012 Big challenge for the ndna project: can TSD 2.0 develop an architecture that will sa@sfy the legal requirements for diagnos@c DNA data?
13 The future for sequence data 168 babies born in Norway every day 55 norwegians diagnosed with cancer every day large needs
14 Opinions about the proposed forum Generally very to the forum We are (together with our partners) in the middle of many of the processes described in the forum proposal: system requirement on- going users of the infrastructure huge group of users understand legal and ethical aspects of research data plenty of this in the ndna project knowledge Norstore s "white paper requirement to USIT Has to be approved by Data@lsynet
15 Thanks for listening
Na#onal Asbestos Forum 2013: Advance in Medical Research on Asbestos- Related Diseases
Na#onal Asbestos Forum 2013: Advance in Medical Research on Asbestos- Related Diseases Professor Nico van Zandwijk Asbestos Diseases Research Ins#tute Content List of Asbestos- Related Diseases Epidemiology
More informationBalancing Usability and Security for Medical Devices
Balancing Usability and Security for Medical Devices Ken Hoyme Adven&um Labs ken.hoyme@adven8umlabs.com Robert North, LLC bnorth@humancenteredstrategies.com March 17, 2014 3/17/2014 2014 Adven8um Labs
More informationNCDS Leadership Summit " The Friday Center" Chapel Hill, North Carolina" April 23 & 24, 2013!
NCDS Leadership Summit " The Friday Center" Chapel Hill, North Carolina" April 23 & 24, 2013! Data Collection Scale of Problem Challenges v Research versus clinical contexts v Science versus medicine v
More informationHigh Performance Compu2ng Facility
High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,
More informationIMPACT OF THE NEW ICD- 10 CODING SYSTEM ON THE MEDICAL BILLING AND PAYMENT PROCESS
IMPACT OF THE NEW ICD- 10 CODING SYSTEM ON THE MEDICAL BILLING AND PAYMENT PROCESS ICD- 10 Acronym Interna(onal Classifica(on of Diseases Tenth Revision ICD- 10 Basic Facts Replaces ICD- 9 Five digit coding
More informationTSD: a Secure and Scalable Service for Sensitive Data and ebiobanks
TSD: a Secure and Scalable Service for Sensitive Data and ebiobanks Gard Thomassen, PhD Head of Research Support Services Group University Center for Information Technology (USIT) University of Oslo Outline
More informationAlcohol Brief Counseling in the United States Air Force: An Air Force- Penn State Clearinghouse Collabora;ve Project
Alcohol Brief Counseling in the United States Air Force: An Air Force- Penn State Clearinghouse Collabora;ve Project Partnership with the USAF Penn State Clearinghouse AFMOA Mental Health Clinic Staff ADAPT
More informationIT Change Management Process Training
IT Change Management Process Training Before you begin: This course was prepared for all IT professionals with the goal of promo9ng awareness of the process. Those taking this course will have varied knowledge
More informationNicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
More informationCSER & emerge Consor.a EHR Working Group Collabora.on on Display and Storage of Gene.c Informa.on in Electronic Health Records
electronic Medical Records and Genomics CSER & emerge Consor.a EHR Working Group Collabora.on on Display and Storage of Gene.c Informa.on in Electronic Health Records Brian Shirts, MD, PhD University of
More information10 Steps to Preparedness
10 Steps to Preparedness Key Take- Aways Review basics of disaster recovery and con2nuity of opera2ons. Understand what you can do to prepare your pool and its members for an unplanned interrup2on. Ini2ate
More informationData Management in the Cloud: Limitations and Opportunities. Annies Ductan
Data Management in the Cloud: Limitations and Opportunities Annies Ductan Discussion Outline: Introduc)on Overview Vision of Cloud Compu8ng Managing Data in The Cloud Cloud Characteris8cs Data Management
More informationUAB Cyber Security Ini1a1ve
UAB Cyber Security Ini1a1ve Purpose of the Cyber Security Ini1a1ve? To provide a secure Compu1ng Environment Individual Mechanisms Single Source for Inventory and Asset Management Current Repor1ng Environment
More informationMigrating to Hosted Telephony. Your ultimate guide to migrating from on premise to hosted telephony. www.ucandc.com
Migrating to Hosted Telephony Your ultimate guide to migrating from on premise to hosted telephony Intro What is covered in this guide? A professional and reliable business telephone system is a central
More informationMap- reduce, Hadoop and The communica3on bo5leneck. Yoav Freund UCSD / Computer Science and Engineering
Map- reduce, Hadoop and The communica3on bo5leneck Yoav Freund UCSD / Computer Science and Engineering Plan of the talk Why is Hadoop so popular? HDFS Map Reduce Word Count example using Hadoop streaming
More informationSome Security Challenges of Cloud Compu6ng. Kui Ren Associate Professor Department of Computer Science and Engineering SUNY at Buffalo
Some Security Challenges of Cloud Compu6ng Kui Ren Associate Professor Department of Computer Science and Engineering SUNY at Buffalo Cloud Compu6ng: the Next Big Thing Tremendous momentum ahead: Prediction
More informationSophos Ltd. All rights reserved.
Sophos Ltd. All rights reserved. 1 Sophos Approach to Unified Security Integrated Security for Be9er Protec;on James Burchell & Greg Iddon, Sales Engineers UK&I, Technology Services What we re going to
More informationSo#ware quality assurance - introduc4on. Dr Ana Magazinius
So#ware quality assurance - introduc4on Dr Ana Magazinius 1 What is quality? 2 What is a good quality car? 2 and 2 2 minutes 3 characteris4cs 3 What is quality? 4 What is quality? How good or bad something
More informationEcommerce Conference Umass Dartmouth April 19, 2013
Ecommerce Conference Umass Dartmouth April 19, 2013 As a seminar Special,for all who call and request additional information from 4/19 to 5/30/2013, you will receive: A. Free Consultation no charge to
More informationThis is the flow diagram of a hearing aid that is currently under inves8ga8on at Essex University. The purpose of this talk is to explain how the
1 This is the flow diagram of a hearing aid that is currently under inves8ga8on at Essex University. The purpose of this talk is to explain how the design is linked to research using computer models of
More informationWorkshop : Open and Big Data for Life Imaging
Workshop : Open and Big Data for Life Imaging Chris'an Barillot Michel Dojat March 2015 FLI- IAM 1 Many Good Reasons for Sharing Data and Tools in In Vivo Imaging Scien'fic At Least 3. «Power failure:
More informationChange Leadership A view from the front seat
Change Leadership A view from the front seat Bruce Burrell Consul,ng Incorporated What we will cover Building an Effec
More informationFINANCIAL SERVICES CASE STUDY COLLECTION. Broker Profile, Multrees Investor Services Ltd & Spayne Lindsay & Co. LLP
FINANCIAL SERVICES CASE STUDY COLLECTION Broker Profile, Multrees Investor Services Ltd & Spayne Lindsay & Co. LLP The Workbooks product offered greater functionality... We also felt that we would receive
More informationSAP HANA Enabling Genome Analysis
SAP HANA Enabling Genome Analysis Joanna L. Kelley, PhD Postdoctoral Scholar, Stanford University Enakshi Singh, MSc HANA Product Management, SAP Labs LLC Outline Use cases Genomics review Challenges in
More informationAn Introduc+on to CloudPrime
TM An Introduc+on to CloudPrime Secure messaging pla/orm to protect pa2ent privacy and uphold HIPAA/HITECH regula2on Mari Tangredi, CloudPrime 1 CloudPrime Company Overview! Headquartered in San Francisco,
More informationResearch Data Networks: Privacy- Preserving Sharing of Protected Health Informa>on
Research Data Networks: Privacy- Preserving Sharing of Protected Health Informa>on Lucila Ohno-Machado, MD, PhD Division of Biomedical Informatics University of California San Diego PCORI Workshop 7/2/12
More informationBig Data and Clouds: Challenges and Opportuni5es
Big Data and Clouds: Challenges and Opportuni5es NIST January 15 2013 Geoffrey Fox gcf@indiana.edu h"p://www.infomall.org h"p://www.futuregrid.org School of Informa;cs and Compu;ng Digital Science Center
More informationProblem: Genome Data Held in Silos, Unshared, not Standardized for Exchange
Problem: Genome Data Held in Silos, Unshared, not Standardized for Exchange No one institute has enough on its own to make progress. Every researcher and clinician should be able to compare their genome
More informationProvider Communica/on Interven/on at a Federally Qualified Health Center- based Farmers' Market: Implica/ons for Implementa/on Science
Provider Communica/on Interven/on at a Federally Qualified Health Center- based Farmers' Market: Implica/ons for Implementa/on Science Daniela B. Friedman, MSc, PhD Associate Professor, Department of Health
More informationHORIZON 2020 Work Programme 2016-2017. NMBP Draft list of topics
HORIZON 2020 Work Programme 2016- NMBP Draft list of topics Topic list - summary 76 topics (2016: 37 + : 39) 34 topics RIA (15+19) 24 topics IA (10+14) 15 topics (9+6) 3 topics ERANET (3+0) 3-5 9 topics
More informationLegacy Archiving How many lights do you leave on? September 14 th, 2015
Legacy Archiving How many lights do you leave on? September 14 th, 2015 1 Introductions Wendy Laposata, Himforma(cs Tom Chase, Cone Health 2 About Cone Health More than 100 loca=ons 6 hospitals, 3 ambulatory
More informationPut the Magic in Your Email Marke4ng
Put the Magic in Your Email Marke4ng April 8, 2015 Michelle Novak mnovak@presslaff.com Your Inland Wizards Put the Magic in Your Email Marke4ng Stop blas9ng messages and start crea9ng compelling engaging
More informationScalus A)ribute Workshop. Paris, April 14th 15th
Scalus A)ribute Workshop Paris, April 14th 15th Content Mo=va=on, objec=ves, and constraints Scalus strategy Scenario and architectural views How the architecture works Mo=va=on for this MCITN Storage
More informationWhite Paper The Numascale Solution: Extreme BIG DATA Computing
White Paper The Numascale Solution: Extreme BIG DATA Computing By: Einar Rustad ABOUT THE AUTHOR Einar Rustad is CTO of Numascale and has a background as CPU, Computer Systems and HPC Systems De-signer
More information«Shanoir : une solu/on pour la ges/on de données distribuées en imagerie in- vivo» Jus/ne Guillaumont Isabelle Corouge
«Shanoir : une solu/on pour la ges/on de données distribuées en imagerie in- vivo» Jus/ne Guillaumont Isabelle Corouge Shanoir: a solu-on for neuro- imaging data management Jus/ne Guillaumont, Isabelle
More informationTRANSLATING TECHNOLOGY INTO BUSINESS. Let s make money from Big Data!
TRANSLATING TECHNOLOGY INTO BUSINESS Let s make money from Big Data! JUNE, 2014 About Transla.ng Technology into Business B Spot helps clients transform technology ideas into business concepts. As part
More informationnumascale White Paper The Numascale Solution: Extreme BIG DATA Computing Hardware Accellerated Data Intensive Computing By: Einar Rustad ABSTRACT
numascale Hardware Accellerated Data Intensive Computing White Paper The Numascale Solution: Extreme BIG DATA Computing By: Einar Rustad www.numascale.com Supemicro delivers 108 node system with Numascale
More informationHelp Framework. Ticket Management Ticket Resolu/on Communica/ons. Ticket Assignment Follow up Customer - communica/on System updates Delay management
Help for JD Edwards Our Help Framework Ticket qualifica/on Ticket crea/on Ticket Rou/ng Closures L1 issues Resolu/on KG SOPs Co- ordinate Ticket Assignment Follow up Customer - communica/on System updates
More informationUNINETT Sigma2 AS: architecture and functionality of the future national data infrastructure
UNINETT Sigma2 AS: architecture and functionality of the future national data infrastructure Authors: A O Jaunsen, G S Dahiya, H A Eide, E Midttun Date: Dec 15, 2015 Summary Uninett Sigma2 provides High
More informationDesign considera-ons and Guiding Principles for Implemen-ng Cloud Security. William Stearns Security Analyst CloudPassage
Design considera-ons and Guiding Principles for Implemen-ng Cloud Security William Stearns Security Analyst CloudPassage In a nutshell How do Cloud Servers differ from Data Center Servers? How do the differences
More informationProcessing of Mix- Sensi0vity Video Surveillance Streams on Hybrid Clouds
Processing of Mix- Sensi0vity Video Surveillance Streams on Hybrid Clouds Chunwang Zhang, Ee- Chien Chang School of Compu2ng, Na2onal University of Singapore 28 th June, 2014 Outline 1. Mo0va0on 2. Hybrid
More informationShannon Rykaceski Director of Opera4ons CCFHCC
Shannon Rykaceski Director of Opera4ons CCFHCC PRESENTER BIO Shannon Salicce Rykaceski Director of Opera4ons for the Catholic Chari4es Free Health Care Center (CCFHCC), located in PiCsburgh, PA. Prior
More informationMission. To provide higher technological educa5on with quality, preparing. competent professionals, with sound founda5ons in science, technology
Mission To provide higher technological educa5on with quality, preparing competent professionals, with sound founda5ons in science, technology and innova5on, commi
More informationReali9es of Being PCI Compliant
Reali9es of Being PCI Compliant Miguel (Mike) O. Villegas CISA, CISSP, GSEC, CEH, QSA, PA- QSA, ASV Vice President- K3DES LLC Professional Strategies S23 CRISC CGEIT CISM CISA Abstract PCI DSS compliance
More informationPu#ng together a bioinforma1cs team: 2014 compared with 1997
Pu#ng together a bioinforma1cs team: 2014 compared with 1997 BIG DATA and Healthcare Analy3cs Melbourne, Thursday 3 rd April 2014 Terry Speed, Walter & Eliza Hall Ins3tute of Medical Research 1 Overview
More informationUpdate on the Cloud Demonstration Project
Update on the Cloud Demonstration Project Khalil Yazdi and Steven Wallace Spring Member Meeting April 19, 2011 Project Par4cipants BACKGROUND Eleven Universi1es: Caltech, Carnegie Mellon, George Mason,
More informationAllstate Benefits. Products
Allstate Benefits Products Voluntary Benefits The Value to Employers Mi,gates impact of health care reform with improved plan design and cost realloca,on Provides medical plan savings and bends the cost
More informationEffec%ve AX 2012 Upgrade Project Planning and Microso< Sure Step. Arbela Technologies
Effec%ve AX 2012 Upgrade Project Planning and Microso< Sure Step Arbela Technologies Why Upgrade? What to do? How to do it? Tools and templates Agenda Sure Step 2012 Ax2012 Upgrade specific steps Checklist
More informationUnderstanding and Detec.ng Real- World Performance Bugs
Understanding and Detec.ng Real- World Performance Bugs Gouliang Jin, Linhai Song, Xiaoming Shi, Joel Scherpelz, and Shan Lu Presented by Cindy Rubio- González Feb 10 th, 2015 Mo.va.on Performance bugs
More informationDisaster Recovery Planning and Implementa6on. Chris Russel Director, IT Infrastructure and ISO Compu6ng and Network Services York University
Disaster Recovery Planning and Implementa6on Chris Russel Director, IT Infrastructure and ISO Compu6ng and Network Services York University Agenda Background for York s I.T. Disaster Recovery Planning
More informationIV Automa*on Experience at Duke University Hospital. Udobi C. Campbell, PharmD, MBA Associate Chief Pharmacy Officer Duke University Hospital
IV Automa*on Experience at Duke University Hospital Udobi C. Campbell, PharmD, MBA Associate Chief Pharmacy Officer Duke University Hospital Duke Children s Hospital and Health Center Duke Children s
More informationFinancial Opera,ons Track: ROI vs. ROCE (Return on Customer Experience) Speaker: Robert Lane, Strategic Sourcing Manager, Premier Health Partners
Financial Opera,ons Track: ROI vs. ROCE (Return on Customer Experience) Speaker: Robert Lane, Strategic Sourcing Manager, Premier Health Partners INTEGRATION: Merging internal and external excellence into
More informationFirst Na)on Project Management Boot Camp
First Na)on Project Management Boot Camp Links to Learning - Ontario: Building a Sustainable Future Thunder Bay, Ontario What is a Project / Project Management? A project can be defined as a temporary
More informationDDC Sequencing and Redundancy
DDC Sequencing and Redundancy Presenter Sequencing Importance of sequencing Essen%al piece to designing and delivering a successful project Defines how disparate components interact to make up a system
More informationPrivacy- Preserving P2P Data Sharing with OneSwarm. Presented by. Adnan Malik
Privacy- Preserving P2P Data Sharing with OneSwarm Presented by Adnan Malik Privacy The protec?on of informa?on from unauthorized disclosure Centraliza?on and privacy threat Websites Facebook TwiFer Peer
More informationHEALTH SYSTEM PRIORITIES
2 3 Five Priorities for Health Systems OUR DISCUSSION TODAY Exchanges Data Analy0cs Market Posi0oning Pricing Efficiency 4 Exchanges Over 125,000 in 2014 and over 550,000 in 2019 Over 520,000 by 2017 Over
More informationData Center Evolu.on and the Cloud. Paul A. Strassmann George Mason University November 5, 2008, 7:20 to 10:00 PM
Data Center Evolu.on and the Cloud Paul A. Strassmann George Mason University November 5, 2008, 7:20 to 10:00 PM 1 Hardware Evolu.on 2 Where is hardware going? x86 con(nues to move upstream Massive compute
More informationSuppor&ng the Design of Safety Cri&cal Systems Using AADL
Suppor&ng the Design of Safety Cri&cal Systems Using AADL T. Correa, L. B. Becker, J.- M. Farines, J.- P. Bodeveix, M. Filali, F. Vernadat IRIT LAAS UFSC Agenda Introduc&on Proposed Approach Verifica&on
More informationInternet Storage Sync Problem Statement
Internet Storage Sync Problem Statement draft-cui-iss-problem Zeqi Lai Tsinghua University 1 Outline Background Problem Statement Service Usability Protocol Capabili?es Our Explora?on on Protocol Capabili?es
More informationPhone Systems Buyer s Guide
Phone Systems Buyer s Guide Contents How Cri(cal is Communica(on to Your Business? 3 Fundamental Issues 4 Phone Systems Basic Features 6 Features for Users with Advanced Needs 10 Key Ques(ons for All Buyers
More informationHuman Genome Sequencing Project: What Did We Learn? 02-223 How to Analyze Your Own Genome Fall 2013
Human Genome Sequencing Project: What Did We Learn? 02-223 How to Analyze Your Own Genome Fall 2013 Human Genome Sequencing Project Interna:onal Human Genome Sequencing Consor:um ( public project ) Ini$al
More informationAcceleration for Personalized Medicine Big Data Applications
Acceleration for Personalized Medicine Big Data Applications Zaid Al-Ars Computer Engineering (CE) Lab Delft Data Science Delft University of Technology 1" Introduction Definition & relevance Personalized
More informationOS/Run'me and Execu'on Time Produc'vity
OS/Run'me and Execu'on Time Produc'vity Ron Brightwell, Technical Manager Scalable System SoAware Department Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation,
More informationFounda'onal IT Governance A Founda'onal Framework for Governing Enterprise IT Adapted from the ISACA COBIT 5 Framework
Founda'onal IT Governance A Founda'onal Framework for Governing Enterprise IT Adapted from the ISACA COBIT 5 Framework Steven Hunt Enterprise IT Governance Strategist NASA Ames Research Center Michael
More informationKaseya Fundamentals Workshop DAY THREE. Developed by Kaseya University. Powered by IT Scholars
Kaseya Fundamentals Workshop DAY THREE Developed by Kaseya University Powered by IT Scholars Kaseya Version 6.5 Last updated March, 2014 Day Two Overview Day Two Lab Review Patch Management Configura;on
More informationThe Shi'ing Role of School Psychologists within a Mul7-7ered System of Support Framework. FASP Annual Conference October 29, 2015
The Shi'ing Role of School Psychologists within a Mul7-7ered System of Support Framework FASP Annual Conference October 29, 2015 Dr. Jayna Jenkins, Florida PS/RtI Project EARLY WARNING SYSTEMS AND THE
More informationUpdate on the Cloud Demonstration Project
Update on the Cloud Demonstration Project Steven Wallace Joint Techs Summer 2011 13- July- 2011 Project Par4cipants BACKGROUND Twelve Universi,es: Caltech, Carnegie Mellon,Cornell George Mason, Indiana
More informationCri$cal Infrastructure Security: The Emerging Smart Grid. Cyber Security Lecture 5: Assurance, Evalua$on, and Compliance Carl Hauser & Adam Hahn
Cri$cal Infrastructure Security: The Emerging Smart Grid Cyber Security Lecture 5: Assurance, Evalua$on, and Compliance Carl Hauser & Adam Hahn Overview Evalua$on Common Criteria Security Tes$ng Approaches
More informationProtec'ng Informa'on Assets - Week 8 - Business Continuity and Disaster Recovery Planning. MIS 5206 Protec/ng Informa/on Assets Greg Senko
Protec'ng Informa'on Assets - Week 8 - Business Continuity and Disaster Recovery Planning MIS5206 Week 8 In the News Readings In Class Case Study BCP/DRP Test Taking Tip Quiz In the News Discuss items
More informationPoten&al Impact of FDA Regula&on of EMRs. October 27, 2010
Poten&al Impact of FDA Regula&on of EMRs October 27, 2010 Agenda The case for regula&ng Impact on manufacturers Impact on providers Recommenda&ons and best prac&ces 2 A Medical Device Is an instrument,
More informationBreakout A: From Paper to EMR- Preparing for the Transi;on
Quality Counts! Breakout A: From Paper to EMR- Preparing for the Transi;on The Maine Regional Extension Center Forum Breakout Objec
More informationRetail Pharmacy Clinical Services: Influence of ACOs & Healthcare Financing Models
Retail Pharmacy Clinical Services: Influence of ACOs & Healthcare Financing Models Tim Kosty, R.Ph., MBA President Pharmacy Healthcare Solu
More informationBENCHMARKING V ISUALIZATION TOOL
Copyright 2014 Splunk Inc. BENCHMARKING V ISUALIZATION TOOL J. Green Computer Scien
More informationVA Pa&ent- Centered Community Care Provider Network Management Training Deck
VA Pa&ent- Centered Community Care Provider Network Management Training Deck Agenda Program Overview Provider Network Implementa&on Appointment Process Medical Documenta&on Care Coordina&on Claims Overview
More informationBest Prac*ces for Deploying Oracle So6ware on Virtual Compute Appliance
Best Prac*ces for Deploying Oracle So6ware on Virtual Compute Appliance CON7484 Jeff Savit Senior Technical Product Manager Oracle VM Product Management October 1, 2014 Safe Harbor Statement The following
More informationECIA RiSE Initiative. Risk Assessment Database
ECIA RiSE Initiative Risk Assessment Database Contents Background Planning Outcome Process (Training Slides) System in prac:ce Background BB audit & inspec:on process established differing approaches to
More informationPES Has The Sustainable Solu2on For Chronic Care Management
PES Has The Sustainable Solu2on For Chronic Care Management Empowering pa2ents to lead the management of their chronic diseases through a proven and effec2ve model of collabora2on with clinicians and caregivers.
More informationWhite Paper The Numascale Solution: Affordable BIG DATA Computing
White Paper The Numascale Solution: Affordable BIG DATA Computing By: John Russel PRODUCED BY: Tabor Custom Publishing IN CONJUNCTION WITH: ABSTRACT Big Data applications once limited to a few exotic disciplines
More informationMobile Applica,on and BYOD (Bring Your Own Device) Security Implica,ons to Your Business. Dmitry Dessiatnikov
Mobile Applica,on and BYOD (Bring Your Own Device) Security Implica,ons to Your Business Dmitry Dessiatnikov DISCLAIMER All informa,on in this presenta,on is provided for informa,on purposes only and in
More informationWelcome! Accelera'ng Pa'ent- Centered Outcomes Research and Methodological Research. Andrea Heckert, PhD, MPH Program Officer, Science
Accelera'ng Pa'ent- Centered Outcomes Research and Methodological Research Emily Evans, PhD, MPH Program Officer, Science Andrea Heckert, PhD, MPH Program Officer, Science June 22, 2015 Welcome! Emily
More informationCloud Compu)ng. Yeow Wei CHOONG Anne LAURENT
Cloud Compu)ng Yeow Wei CHOONG Anne LAURENT h-p://www.b- eye- network.com/blogs/eckerson/archives/cloud_compu)ng/ 2011 h-p://www.forbes.com/sites/tjmccue/2014/01/29/cloud- compu)ng- united- states- businesses-
More informationCancer patients needs for rehabilitation services - a cross-sectional study
Cancer patients needs for rehabilitation services - a cross-sectional study Lene Thorsen 1, Gunhild M. Gjerset 1, Jon Håvard Loge 1, Cecilie E. Kiserud 1, Eva Skovlund 2, Tone Fløtten 3 and Sophie D. Fosså
More informationHow To Use A Webmail On A Pc Or Macodeo.Com
Big data workloads and real-world data sets Gang Lu Institute of Computing Technology, Chinese Academy of Sciences BigDataBench Tutorial MICRO 2014 Cambridge, UK INSTITUTE OF COMPUTING TECHNOLOGY 1 Five
More informationAssessing and Treating Diabetes in Diverse Populations. Shirley Pue+, LCSW, LCAS
Assessing and Treating Diabetes in Diverse Populations Shirley Pue+, LCSW, LCAS Objectives The purpose of this ac9vity is to enable the learner to: - List cultural barriers that make diagnosing and trea5ng
More informationPa#ent Involvement in Clinical Research In Rela#onship with Biobanking BBMRI 15 December 2009
Pa#ent Involvement in Clinical Research In Rela#onship with Biobanking BBMRI 15 December 2009 Cor Oosterwijk Project Coordinator Pa;entPartner Dutch Gene;c Alliance VSOP European Gene;c Alliances Network
More informationSuppor&ng pa&ents in using their personal strengths in chronic illness management
Suppor&ng pa&ents in using their personal strengths in chronic illness management par$cipatory design approach Jelena Mirkovic, Ólöf Birna Kristjánsdo>r, Una Stenberg, Tonje Krogseth, Cornelia Ruland Center
More informationBIG DATA AND INVESTIGATIVE ANALYTICS
The New Fron+er BIG DATA AND INVESTIGATIVE ANALYTICS A Publication of Infobright Table of Contents Introduc+on 3 Chapter 1: What Is Inves+ga+ve Analy+cs?. 4 Chapter 2: Top Five Requirements for Inves+ga+ve
More informationPrac%cal Informa%cs Course 2009 Intersystem Communica%on and Computer Interfaces. Jeffrey Fine MD Magee Womens Hospital of UPMC
Prac%cal Informa%cs Course 2009 Intersystem Communica%on and Computer Interfaces Jeffrey Fine MD Magee Womens Hospital of UPMC Objec%ves Present a high level overview of what interfaces are and what they
More informationThe Pros and Cons of Organiza2on
Remain Independent or Align? A Guide To Manage Through This Cri2cal Decision Sponsored By: TRG Healthcare October 12, 2010 1 Welcome Remain Independent or Align? A Guide To Manage Through This Cri=cal
More informationTransla6ng from Clinical Care to Research: Integra6ng i2b2 and OpenClinica
Transla6ng from Clinical Care to : Integra6ng i2b2 and OpenClinica Aaron Abend Managing Director, Recombinant Data Corp May 13, 2011 Copyright 2011 Recombinant Data Corp. All rights reserved. 1 About Recombinant
More informationSan Jacinto College Banner & Enterprise Applica5on Review Task Force Report. November 01, 2011 FINAL
San Jacinto College Banner & Enterprise Applica5on Review Task Force Report November 01, 2011 FINAL 1 Content Review goal and approach 3 Barriers to effec5ve use of Banner: Consultant observa5ons 10 Consultant
More informationOnline Enrollment Op>ons - Sales Training. 2011. Benefi+ocus.com, Inc. All rights reserved. Confiden>al and Proprietary 1
Online Enrollment Op>ons - Sales Training 2011. Benefi+ocus.com, Inc. All rights reserved. Confiden>al and Proprietary 1 Agenda Understand Why This is Important Enrollment Op>ons Available EDI Blues Enroll
More informationNodes, Ties and Influence
Nodes, Ties and Influence Chapter 2 Chapter 2, Community Detec:on and Mining in Social Media. Lei Tang and Huan Liu, Morgan & Claypool, September, 2010. 1 IMPORTANCE OF NODES 2 Importance of Nodes Not
More informationLicensing++ for Clouds. Mark Perry
Licensing++ for Clouds Mark Perry Plan* 1. Cloud? 2. Survey 3. Some ques@ons 4. Some ideas 5. Some sugges@ons (that would be you) * Plan 9 future events such as these will affect you in the future Clouds
More informationHelping Consumers Understand How to Use Their Private Health Insurance
Helping Consumers Understand How to Use Their Private Health Insurance Adam Fox Director of Strategic Engagement Colorado Consumer Health Ini;a;ve Shelby Chapman Health Literacy Program Manager Children
More informationBig Data Challenges. technology basics for data scientists. Spring - 2014. Jordi Torres, UPC - BSC www.jorditorres.
Big Data Challenges technology basics for data scientists Spring - 2014 Jordi Torres, UPC - BSC www.jorditorres.eu @JordiTorresBCN Data Deluge: Due to the changes in big data generation Example: Biomedicine
More informationSpondylolysis Update on Diagnosis & Management
Spondylolysis Update on Diagnosis & Management David W. Kruse, M.D. Orthopaedic Specialty Ins@tute Team Physician - University of California, Irvine Team Physician & Medical Task Force Member - USA Gymnas@cs
More informationHow Integrated Case Management Helps Individuals with Complex Substance Use
Toronto Community Addic/on Team St. Stephen s Community House How Integrated Case Management Helps Individuals with Complex Substance Use Na/onal Case Management Conference September 27, 2013 Funded By:
More informationTRACKS GENETIC EPIDEMIOLOGY
Dr. Priya Duggal, Director In the post-genomic era where larger amounts of genetic data are now readily available, it has become increasingly important to design studies and use analytical techniques that
More informationHigh Performance Compu2ng and High Performance Data: exploring the growing use of Supercomputers in Oil and Gas Explora2on & Produc2on
High Performance Compu2ng and High Performance Data: exploring the growing use of Supercomputers in Oil and Gas Explora2on & Produc2on Lesley Wyborn1, Ben Evans1, David Lescinsky2 and Clinton Foster2 16
More information