The UCSC Genome Browser Introduction. Osvaldo Graña Bioinformatics Unit, CNIO

Size: px
Start display at page:

Download "The UCSC Genome Browser Introduction. Osvaldo Graña Bioinformatics Unit, CNIO"

Transcription

1 The UCSC Genome Browser Introduction Osvaldo Graña Bioinformatics Unit, CNIO 1

2 Organization of genomic data sequence Annotation Tracks Genome backbone: base position number chromosome band sts sites gap locations known genes predicted genes microarray/expression data evolutionary conservation SNPs repeated regions more Links out to more data 2

3 A sample of what we will find: gene details Annotation Tracks official sequence comparisons SNPs 3

4 UCSC Genome Browser Agenda Introduction Basic Searches Understanding Displays Get Details or Sequences Sequence Searches (BLAT) in silico PCR Proteome Browser VisiGene Browser Exercises UCSC Genome Browser: 4

5 The UCSC Homepage: navigate navigate General information Specific information new features, current status, etc. 5

6 The Genome Browser Gateway start page, basic search text/id searches Helpful search examples, suggestions below Use this Gateway to search by: Gene names, symbols Chromosome number: chr7, or region: chr11: Keywords: kinase, receptor IDs: NP, NM, OMIM, and more See lower part of page for help with format 6

7 The Genome Browser Gateway start page choices, April Make your Gateway choices: Select Clade Select genome = species: search 1 species at a time Assembly: the official backbone DNA sequence Position: location in the genome to examine Image width: how many pixels in display window; 5000 max Configure: make fonts bigger + other choices 7

8 The Genome Browser Gateway sample search for Human TP53 Sample search: human, March 2006 assembly, tp53 select Select from results list ID search may go right to a viewer page, if unique 8

9 Overview of the whole Genome Browser page } (mature release) Genome viewer section Groups of data Mapping and Sequencing Tracks Phenotype and Disease Tracks Genes and Gene Prediction Tracks mrna and EST Tracks Expression and Regulation Comparative Genomics Variation and Repeats ENCODE Tracks 9

10 Different species, different tracks, same software Species may have different data tracks Layout, software, functions the same 10

11 Sample Genome Viewer image, TP53 region base position STS markers UCSC genes RefSeq genes MGC clones ESTs 17 species compared single species compared SNPs repeats 11

12 Visual Cues on the Genome Browser Tick marks; a single location (STS, SNP) 3' UTR exon < < < exon < exon < < < <ex 5' UTR Intron, and direction of transcription <<< or >>> Track colors may have meaning for example, UCSC Gene track: If there is a corresponding PDB entry, = black If there is a corresponding reviewed/validated seq, = dark blue If there is a non-refseq seq, = lightest blue For some tracks, the height of a bar is increased likelihood of an evolutionary relationship (conservation track) 12

13 Options for Changing Images: Upper Section Walk left or right Zoom in Zoom out click to zoom 3x and re-center Specify a position fonts, window, more Change your view or location with controls at the top Use base to get right down to the nucleotides Configure: to change font, window size, more 13

14 Annotation Track display options enforce changes Links to info and/or filters Some data is ON or OFF by default Menu links to info about the tracks: content, methods You change the view with pulldown menus Change track view After making changes, REFRESH to enforce the change 14

15 Annotation Track options, defined Hide: removes a track from view Dense: all items collapsed into a single line Squish: each item = separate line, but 50% height + packed Pack: each item separate, but efficiently stacked (full height) Full: each item on separate line 15

16 Reset, Hide, Configure or Refresh to change settings enforce any changes (hide, full, squish ) reset, back to defaults start from scratch You control the views Use pulldown menus Configure options page 16

17 Annotation Track options, if altered. important point: the browser remembers! Session information (the position you were examining) Track choices (squish, pack, full, etc) Filter parameters (if you changed the colors of any items, or the subset to be displayed) are all saved on your computer. When you come back in a couple of days to use it again, these will still be set. You may or may not intend this. To clear your cart or parameters, click default tracks OR 17

18 Click Any Viewer Object for Details Click the item New web page opens Many details and links to more data about TP53 Example: click your mouse anywhere on the TP53 line 18

19 informative description other resource links links to sequences Not all genes have This much detail. Click annotation track item for details pages microarray data Different annotation tracks carry different data. mrna secondary structure protein domains/structure homologs in other species Gene Ontology descriptions mrna descriptions pathways 19

20 Get DNA, with Extended Case/Color Options Use the DNA link at the top Plain or Extended options Change colors, fonts, etc. 20

21 Get Sequence from Details Pages Click a track, go to Sequence section of details page Click the item sequence section on detail page 21

22 UCSC Genome Browser Agenda Introduction and Credits Basic Searches Understanding Displays Get Details or Sequences Sequence Searches (BLAT) in silico PCR Proteome Browser VisiGene Browser Exercises UCSC Genome Browser: 22

23 Accessing the BLAT tool BLAT = BLAST-like Alignment Tool Rapid searches by INDEXING the entire genome Works best with high similarity matches See documentation and publication for details Kent, WJ. Genome Res :656 23

24 BLAT tool overview: Make choices Paste one or more sequences DNA limit bases Protein limit aa 25 total sequences submit Or upload 24

25 BLAT results, with links go to browser/viewer go to alignment detail Results with demo sequences, settings default; sort = Query, Score Score is a count of matches higher number, better match Click browser to go to Genome Browser image location (next slide) Click details to see the alignment to genomic sequence (2 nd slide) 25

26 BLAT results, browser link click to flip frame query From browser click in BLAT results A new line with your Sequence from BLAT Search appears! Watch out for reading frame! Click > to flip frame Base position = full and zoomed in enough to see amino acids 26

27 BLAT results, alignment details Your query Genomic match, color cues Side-by-side alignment yours genomic 27

28 UCSC Genome Browser Agenda Introduction and Credits Basic Searches Understanding Displays Get Details or Sequences Sequence Searches (BLAT) in silico PCR Proteome Browser VisiGene Browser Exercises UCSC Genome Browser: 28

29 In-Silico PCR: find genomic sequence using primers Select genome Enter primers Minimum 15 bases Flip reverse primer? Submit (note: the tool does not handle ambiguous bases at this time don t use Ns) 29

30 In Silico PCR: results location size your primers Tm for primers Genomic location shown, links to Genome Viewer Product size shown Your primers displayed, flipped if necessary Predicted genomic sequence shown Primer melting temperatures provided 30

31 Proteome Browser Access from homepage or UCSC Gene pages Exon diagram, amino acids Many protein properties (pi, mw, composition, 3D ) more data 31

32 VisiGene Image Browser VisiGene: Biological image data Expression in cells and tissues; mrna or protein Search by symbol, author, body parts, IDs, stages 32

33 UCSC Genome Browser Agenda Introduction and Credits Basic Searches Understanding Displays Get Details or Sequences Sequence Searches (BLAT) in silico PCR Proteome Browser VisiGene Browser Exercises UCSC Genome Browser: 33

34 Notice: The materials and slides offered are for non-commercial use only. Reproduction, distribution and/or use for commercial purposes is strictly prohibited. Copyright 2006, OpenHelix, LLC 34

35 Overview of the whole Genome Browser page (first day, new human release) }Genome viewer section Tracks are added to an assembly over time Not all are present in a new release at first Track and image controls (day 1 = 40 tracks) 35

Exercises for the UCSC Genome Browser Introduction

Exercises for the UCSC Genome Browser Introduction Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

IGV Hands-on Exercise: UI basics and data integration

IGV Hands-on Exercise: UI basics and data integration IGV Hands-on Exercise: UI basics and data integration Verhaak, R.G. et al. Integrated Genomic Analysis Identifies Clinically Relevant Subtypes of Glioblastoma Characterized by Abnormalities in PDGFRA,

More information

The Galaxy workflow. George Magklaras PhD RHCE

The Galaxy workflow. George Magklaras PhD RHCE The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org

More information

Hierarchical Clustering Analysis

Hierarchical Clustering Analysis Hierarchical Clustering Analysis What is Hierarchical Clustering? Hierarchical clustering is used to group similar objects into clusters. In the beginning, each row and/or column is considered a cluster.

More information

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker

Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to

More information

Super Resellers // Getting Started Guide. Getting Started Guide. Super Resellers. AKJZNAzsqknsxxkjnsjx Getting Started Guide Page 1

Super Resellers // Getting Started Guide. Getting Started Guide. Super Resellers. AKJZNAzsqknsxxkjnsjx Getting Started Guide Page 1 Getting Started Guide Super Resellers Getting Started Guide Page 1 Getting Started Guide: Super Resellers Version 2.1 (1.6.2012) Copyright 2012 All rights reserved. Distribution of this work or derivative

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

BIOC351: Proteins. PyMOL Laboratory #1. Installing and Using

BIOC351: Proteins. PyMOL Laboratory #1. Installing and Using BIOC351: Proteins PyMOL Laboratory #1 Installing and Using Information and figures for this handout was obtained from the following sources: Introduction to PyMOL (2009) DeLano Scientific LLC. Installing

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl

More information

Molecule Shapes. support@ingenuity.com www.ingenuity.com 1

Molecule Shapes. support@ingenuity.com www.ingenuity.com 1 IPA 8 Legend This legend provides a key of the main features of Network Explorer and Canonical Pathways, including molecule shapes and colors as well as relationship labels and types. For a high-resolution

More information

SWAN 15.1 Advance user information What s new in SWAN? Introduction of the new user interface. Last update: 28th April 2015

SWAN 15.1 Advance user information What s new in SWAN? Introduction of the new user interface. Last update: 28th April 2015 SWAN 15.1 Advance user information What s new in SWAN? Introduction of the new user interface Last update: 28th April 2015 Daimler SWAN 15.1 - New GUI - Version April 28th, 2015 2 Content Highlights of

More information

Module 10: Bioinformatics

Module 10: Bioinformatics Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior

More information

Technical document. Section 1 Using the website to investigate a specific B. rapa BAC.

Technical document. Section 1 Using the website to investigate a specific B. rapa BAC. Technical document The purpose of this document is to help navigate through the major features of this website and act as a basic training manual to enable you to interpret and use the resources and tools

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS

BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction

Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs

More information

Analysis of ChIP-seq data in Galaxy

Analysis of ChIP-seq data in Galaxy Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Molecular Databases and Tools

Molecular Databases and Tools NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton

More information

NAVIGATION TIPS. Special Tabs

NAVIGATION TIPS. Special Tabs rp`=j~êëü~ää=påüççä=çñ=_ìëáåéëë Academic Information Services Excel 2007 Cheat Sheet Find Excel 2003 Commands in Excel 2007 Use this handout to find where Excel 2003 commands are located in Excel 2007.

More information

AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):

AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO): Replaces 260806 Page 1 of 50 ATF Software for DNA Sequencing Operators Manual Replaces 260806 Page 2 of 50 1 About ATF...5 1.1 Compatibility...5 1.1.1 Computer Operator Systems...5 1.1.2 DNA Sequencing

More information

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian

More information

NDSU Technology Learning & Media Center. Introduction to Google Sites

NDSU Technology Learning & Media Center. Introduction to Google Sites NDSU Technology Learning & Media Center QBB 150C 231-5130 www.ndsu.edu/its/tlmc Introduction to Google Sites Get Help at the TLMC 1. Get help with class projects on a walk-in basis; student learning assistants

More information

Creating Personal Web Sites Using SharePoint Designer 2007

Creating Personal Web Sites Using SharePoint Designer 2007 Creating Personal Web Sites Using SharePoint Designer 2007 Faculty Workshop May 12 th & 13 th, 2009 Overview Create Pictures Home Page: INDEX.htm Other Pages Links from Home Page to Other Pages Prepare

More information

Teaching Bioinformatics to Undergraduates

Teaching Bioinformatics to Undergraduates Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

A) What Web Browser do I need? B) Why I cannot view the most updated content? C) What can we find on the school website? Index Page Layout:

A) What Web Browser do I need? B) Why I cannot view the most updated content? C) What can we find on the school website? Index Page Layout: A) What Web Browser do I need? - Window 7 / Window 8.1 => Internet Explorer Version 9 or above (Best in Version 11+) Download Link: http://windows.microsoft.com/zh-hk/internet-explorer/download-ie - Window

More information

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac. Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.uk Introduc.on Genome browsing The Ensembl gene set Guided examples

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Manual for Demo Data

Manual for Demo Data Manual for Demo Data SEQUENCE Pilot module SeqPatient developed by JSI medical systems GmbH JSI medical systems Corp. Tullastr. 18 One Boston Place, Suite 2600 77975 Ettenheim Boston, MA 02108 GERMANY

More information

Excel 2007: Basics Learning Guide

Excel 2007: Basics Learning Guide Excel 2007: Basics Learning Guide Exploring Excel At first glance, the new Excel 2007 interface may seem a bit unsettling, with fat bands called Ribbons replacing cascading text menus and task bars. This

More information

efiletexas.gov Review Queue User Guide

efiletexas.gov Review Queue User Guide efiletexas.gov Review Queue User Guide EFS-TF-200-3194 v.4 February 2014 Copyright and Confidentiality Copyright 2014 Tyler Technologies, Inc. All rights reserved. All documentation, source programs, object

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

DNA Sequencing Overview

DNA Sequencing Overview DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

User Manual. Transcriptome Analysis Console (TAC) Software. For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev.

User Manual. Transcriptome Analysis Console (TAC) Software. For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev. User Manual Transcriptome Analysis Console (TAC) Software For Research Use Only. Not for use in diagnostic procedures. P/N 703150 Rev. 1 Trademarks Affymetrix, Axiom, Command Console, DMET, GeneAtlas,

More information

Tutorial for proteome data analysis using the Perseus software platform

Tutorial for proteome data analysis using the Perseus software platform Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information

More information

Frequently Asked Questions Next Generation Sequencing

Frequently Asked Questions Next Generation Sequencing Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in

More information

Google Docs Basics Website: http://etc.usf.edu/te/

Google Docs Basics Website: http://etc.usf.edu/te/ Website: http://etc.usf.edu/te/ Google Docs is a free web-based office suite that allows you to store documents online so you can access them from any computer with an internet connection. With Google

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Information Server Documentation SIMATIC. Information Server V8.0 Update 1 Information Server Documentation. Introduction 1. Web application basics 2

Information Server Documentation SIMATIC. Information Server V8.0 Update 1 Information Server Documentation. Introduction 1. Web application basics 2 Introduction 1 Web application basics 2 SIMATIC Information Server V8.0 Update 1 System Manual Office add-ins basics 3 Time specifications 4 Report templates 5 Working with the Web application 6 Working

More information

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis

SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis SeattleSNPs Interactive Tutorial: Web Tools for Site Selection, Linkage Disequilibrium and Haplotype Analysis Goal: This tutorial introduces several websites and tools useful for determining linkage disequilibrium

More information

Biological Sequence Data Formats

Biological Sequence Data Formats Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly DANIEL BLANKENBERG, JAMES TAYLOR, IAN SCHENCK, JIANBIN HE, YI ZHANG, MATTHEW

More information

Real-time qpcr Assay Design Software www.qpcrdesign.com

Real-time qpcr Assay Design Software www.qpcrdesign.com Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488

More information

WEB MAPPING TOOL DOCUMENTATION

WEB MAPPING TOOL DOCUMENTATION ENTERPRISE ZONES RE DESIGNATION WEB MAPPING TOOL DOCUMENTATION January 26, 2015 COVER PAGE TABLE OF CONTENTS INTRODUCTION 1 APPLICATION LAYOUT 2 WEB MAP NAVIGATION 3 LOCATION SEARCH 4 MAP LEGEND 5 BASEMAP

More information

Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006

Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell

More information

Google Sites From the Ground Up

Google Sites From the Ground Up Table of Contents Web Publishing Basics...3 Parental Permission...3 Protection...3 Creating a Google Site...4 Basic Page Content...6 Update Content...6 Previewing the Page...6 Email Contact Link...7 Sidebar

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

DataPA OpenAnalytics End User Training

DataPA OpenAnalytics End User Training DataPA OpenAnalytics End User Training DataPA End User Training Lesson 1 Course Overview DataPA Chapter 1 Course Overview Introduction This course covers the skills required to use DataPA OpenAnalytics

More information

Trigger. Perform this procedure when using the CRM Worklist. Helpful Hints

Trigger. Perform this procedure when using the CRM Worklist. Helpful Hints Purpose The purpose of this Work Instruction is to navigate the CRM Worklist and identify tools required to process and complete workflow tasks and alerts. Trigger Perform this procedure when using the

More information

Enter your User Id and Password and click the Log In button to launch the application.

Enter your User Id and Password and click the Log In button to launch the application. Working with CECAS How to Log In to CECAS Training Site In your internet browser, go to the following IP address: training.nccecas.org/cecas Enter your User Id and Password and click the Log In button

More information

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

Focusing on results not data comprehensive data analysis for targeted next generation sequencing Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

PE Content and Methods Create a Website Portfolio using MS Word

PE Content and Methods Create a Website Portfolio using MS Word PE Content and Methods Create a Website Portfolio using MS Word Contents Here s what you will be creating:... 2 Before you start, do this first:... 2 Creating a Home Page... 3 Adding a Background Color

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms

SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms W548 W552 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki483 SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms Steven

More information

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/

CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/ CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Web Portal User Guide. Version 6.0

Web Portal User Guide. Version 6.0 Web Portal User Guide Version 6.0 2013 Pitney Bowes Software Inc. All rights reserved. This document may contain confidential and proprietary information belonging to Pitney Bowes Inc. and/or its subsidiaries

More information

GENE CONSTRUCTION KIT 4

GENE CONSTRUCTION KIT 4 GENE CONSTRUCTION KIT 4 Tutorials & User Manual from Textco BioSoftware, Inc. September 2012, First Edition Gene Construction Kit 4 Manual is Copyright Textco Bio- Software, Inc. 2003-2012. All rights

More information

ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3

ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3 ACAAGGGACTAGAGAAACCAAAA AGAAACCAAAACGAAAGGTGCAGAA AACGAAAGGTGCAGAAGGGGAAACAGATGCAGA CHAPTER 3 GAAGGGGAAACAGATGCAGAAAGCATC AGAAAGCATC ACAAGGGACTAGAGAAACCAAAACGAAAGGTGCAGAAGGGGAAACAGATGCAGAAAGCATC Introduction

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Upon Installation, Soda

Upon Installation, Soda Upon Installation, Soda Prompts you to create your user profile to register for a new profile Note: Asks your for your particulars Prompts you to select a password. You would need to provide this password

More information

PowerPoint 2007 Basics Website: http://etc.usf.edu/te/

PowerPoint 2007 Basics Website: http://etc.usf.edu/te/ Website: http://etc.usf.edu/te/ PowerPoint is the presentation program included in the Microsoft Office suite. With PowerPoint, you can create engaging presentations that can be presented in person, online,

More information

Quick Guide. WebNow. Description. Logging on to WebNow. Document Management System

Quick Guide. WebNow. Description. Logging on to WebNow. Document Management System WebNow Description WebNow is an online, browser-based companion to the ImageNow document imaging, management and workflow software. WebNow shares some of the functionality of ImageNow searching, viewing,

More information

Smoke Density Monitor application documentation

Smoke Density Monitor application documentation Smoke Density Monitor application documentation Navigating the User interface Fig. 1 Screen shot of the application layout. Description Graphical Monitor Data Browser Trending Graph Alarm View Create Report

More information

BT CONTENT SHOWCASE. JOOMLA EXTENSION User guide Version 2.1. Copyright 2013 Bowthemes Inc. support@bowthemes.com

BT CONTENT SHOWCASE. JOOMLA EXTENSION User guide Version 2.1. Copyright 2013 Bowthemes Inc. support@bowthemes.com BT CONTENT SHOWCASE JOOMLA EXTENSION User guide Version 2.1 Copyright 2013 Bowthemes Inc. support@bowthemes.com 1 Table of Contents Introduction...2 Installing and Upgrading...4 System Requirement...4

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information