Journal of Clinical Virology

Transcription

1 Journal of Clinical Virology 52 (2011) Contents lists available at ScienceDirect Journal of Clinical Virology jo u r n al hom epage: Mutations in hepatitis B virus DNA from patients with coexisting HBsAg and anti-hbs Yu Chen a, Fuchu Qian b, Quan Yuan c, Xuefen Li d, Wei Wu a, Xichao Guo d, Lanjuan Li a, a State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, First Affiliated Hospital, School of Medicine, Zhejiang University, 79 Qingchun Road, Hangzhou , China b Department of Laboratory Medicine, Huzhou Central Hospital, Huzhou, China c National Institute of Diagnostics and Vaccine Development of Infectious Diseases, School of Life Science, Xiamen University, China d Department of Laboratory Medicine, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China a r t i c l e i n f o Article history: Received 25 February 2011 Received in revised form 6 May 2011 Accepted 8 July 2011 Keywords: Hepatitis B virus Hepatitis B surface antigen (HBsAg) Antibody to HBsAg (anti-hbs) Genome Variation a b s t r a c t Background: The serological markers with coexistence of hepatitis B surface antigen (HBsAg) and antibody to HBsAg (anti-hbs) of hepatitis B virus (HBV) infection were rare pattern. The virological significance, immune response and clinical outcome of these patients remain largely unknown. Objectives: This research explores the relationship between this serological profile and HBV genome variants. Study design: We studied 35 patients both carrying HBsAg and anti-hbs (group I), and 70 patients with HBsAg positive but anti-hbs negative (group II, served as control). The HBV genome sequences were obtained by direct sequencing of polymerase chain reaction (PCR) products. Results: The amino acid (aa) variation within major hydrophilic region (MHR), especially in the first loop (aa ) of a determinant in group I is significantly higher than those in group II. The aa variation of cytotoxic lymphocyte (CTL) epitope in HBsAg (aa87 aa95) in group I is also significantly higher than that in group II. Interestingly, the basal core promoter (BCP) double mutations (A1762T/G1764A) in group I is significantly higher than those in group II as well. Conclusions: In patients with HBV infection, the coexistence of HBsAg and anti-hbs is associated with an increased aa variability in several key areas of HBV genome. The molecular characteristic of HBV in HBsAg and anti-hbs positive patients is distinct and worth further studies Elsevier B.V. All rights reserved. 1. Background In serological markers of hepatitis B virus (HBV) infection, general theory consider that the antibody to HBsAg (anti-hbs) can neutralize HBsAg, so it is generally agreed that there will be no simultaneous positive for both HBsAg and anti-hbs in routine clinical practice. However, there were concurrent HBsAg and anti-hbs in chronic HBV carriers that had been reported in previous studies. 1 4 There may be three important situations leading to coexisting HBsAg and anti-hbs: (i) chronic carriage with existing but ineffective anti-hbs response, (ii) brerakthrough of HBV in vaccinated people and (iii) reactivation of HBV in immune patients who undergo immunosuppression. So far, the virological significance, immune response and clinical outcome of these patients remain largely unknown. Corresponding author. Tel.: ; fax: addresses: ljli@zju.edu.cn, ahmuysg@sina.com (L. Li). Several reports showed that the pattern of concurrent HBsAg and anti-hbs might be associated with accumulative HBsAg mutants, especially in the a determinant within the major hydrophilic region (MHR). 5 7 A number of mutants within or around the a determinant of HBsAg had been reported in previous studies. Some mutants reduce the binding affinity of HBsAg to specific antibodies and enable HBV to escape the neutralization by anti-hbs A later report suggested that the phenomenon of concurrent HBsAg and anti-hbs was not associated with the specific amnio acid (aa) substitution in HBsAg, but with the incapability of binding of anti-hbs and HBsAg. 13 So the viewpoints were controversial and the mechanism underlying these serological pattern remained not quite clear. 2. Objectives In order to elucidate the relationship between viral gene variant and the pattern of concurrent HBsAg and anti-hbs in Chinese chronic HBV carriers, we conducted this study /$ see front matter 2011 Elsevier B.V. All rights reserved. doi: /j.jcv

2 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Study design 3.1. Objects of study Between October 2008 and December 2009, 35 patients with simultaneous positive for HBsAg and anti-hbs recruited from First Affiliated Hospital, School of Medicine, Zhejiang University were prospectively enrolled for the study. At the same time, 70 patients with HBsAg positive and anti-hbs negative were enrolled as the control group. The diagnosis of chronic HBV infection was made according to the Chinese consensus criteria. 14 All patients with previous anti-virus therapy, coinfection with hepatitis C virus, hepatitis D virus, or HIV were excluded. All individuals provided written informed consent before participating this study. Serum were collected before treatment and stored at 70 C Serologic markers assessments Routine serologic markers for HBsAg, anti-hbs, and HBeAg were determined with the Architect-i2000 system (Abbott Laboratories, USA). The quantitative determination of HBsAg concentration values <0.05 IU/mL are considered negative and >0.05 IU/mL are considered positive by the criteria of ARCHITECT HBsAg. Specimens are flagged with the code > IU/mL may be diluted with the Manual Dilution Procedure. The threshold level of anti-hbs was defined as 10 miu/ml. Serum alanine aminotransferase (ALT) level was performed with routine automated techniques (HITACHI 7600, Japan) Quantification of serum HBV DNA level Serum HBV DNA level was quantified using the Cobas HBV Amplicor Monitor assay (Roche Diagnostics, USA), and the detection limit of the assay was 300 viral genomes copies/ml Serum DNA extraction Viral DNA was extracted from 200 L serum using QIAamp DNA blood mini kit (Qiagen, Germany) Nest PCR amplified full-length HBV genome HBV genome was divided into two fragments for amplification, fragment I (nt ) and fragment II (nt ) according to the previously protocol. 15 Nest PCR primers were designed as described, 16,17 and listed in Table 1. For amplification of fragment I, 25 L reaction mixture including 5 L DNA template, 2U primestar high fidelity DNA polymerase (Takara, China), and the outer primer P3/AR1 were submitted to the first round of amplification in the following steps: hot start and denaturation at 94 C for 4 min, 35 cycles of 94 C for 30 s, 58 C for 30 s, and 72 C for 2.5 min, then incubate at 72 C for 5 min. Two microlitres aliquot of the first-round PCR products was used as the template of the second-round PCR, and the reaction mixture was the same as the first-round except that the inner primer P3/AR2 was used. The steps were also same except the second-round PCR only 25 cycles instead of 35. For amplification of fragment II, the first-round and secondround PCR primers were AF1/P4 and AF2/P4, respectively. The methods were the same as other in fragment I amplification DNA sequencing and sequence analysis Following the PCR amplification and consequent electrophoresis, the PCR products were recovered and purified from agarose gel, using a QIAquick gel extraction kit (Qiagen, Germany). All products were directly sequenced with a BigDye termination V3.1 cycle sequencing kit (Applied Biosystems, USA) and run on an ABI Prism 3130X automatic genetic analyzer (Applied Biosystems, USA). The primers used for sequencing are summarized in Table 2. HBV genome sequences obtained were compared with the reference sequences in the Genbank for HBV genotyping and genosubtyping. Phylogenetic analysis was performed using the neighbor-joining method (MEGA software, version 4.1) Statistical analysis Statistical analyses were performed by the Student s test for quantitative data, and the 2 analysis test for categorical variables. The differences were considered statistically significant at P < Results 4.1. Characteristics of patients both carrying HBsAg and anti-hbs A total of patients were tested for HBV serum markers, and 1985 (13.7%) were HBsAg-positive. Among these HBsAgpositive patients, 72 (3.6%) were both carrying HBsAg and anti-hbs. And 35 of them were selected as the test group (group I) for positive results of HBV DNA. Seventy newly diagnosed patients with HBsAg-positive and anti-hbs-negative were enrolled as control group (group II), whose age, sex and genotypes were matched with the group I. Table 3 shows the clinical characteristics of the two groups. There was no significant difference between patients with and without anti-hbs in HBeAg positive rate and serum ALT level (P > 0.05). The patients with coexistence of HBsAg and anti-hbs had lower HBsAg level and HBV DNA concentration compared with those of the patients whose HBsAg soly were positive (P < 0.05) HBV genotypes and subgenotypes The complete genome sequences for both group I and group II were compared with the reference sequences from GenBank for HBV genotypes and subgenotypes. The major subgenotype in group I was B2 (n = 21, 60%) and C1 (n = 14, 40%). In group II, the predominant subgenotype also was B2 (n = 41, 58.6%), then the subgenotype C1 (n = 26, 37.1%), C2 (n = 2, 2.9%) and B4 (n = 1, 1.4%). There was no significant difference in subgenotypes distribution between the two groups Nucleotide deletions and insertions In this study, deletions and insertions were observed in 5 patients in group I and 9 patients in group II (Table 4). Of note, most of the deletions and insertions occurred in pres and X gene regions. There were no significant difference between group I and group II (P > 0.05) Amino acid substitution of HBV Amino acid (aa) substitution of strains from group I were compared with those in group II (Table 5). Significant aa substitution diversity was observed within S gene of HBV between group I and group II (1.83 vs. 1.18, for substitution per 100 aa, the same below, P < 0.05). Moreover, the aa variability of group I in the MHR (1.37 vs. 0.48, P < 0.05) and a determinant (2.38 vs. 0.77, P < 0.05) were higher than group II. Furthermore, the aa variability in the first loop (aa ) of a determinant was more variable in group I than in group II (4.00 vs. 1.33, P < 0.05), but that was not occurred in the second loop (aa ) (0.29 vs. 0.14, P > 0.05). In addition, the

3 200 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Table 1 HBV DNA amplification primers. Primers set and type Primer name Sequence (5 3 ) Position (nt a ) Product length (bp) Fragment I 1st primer set Sense P3 5 -CTCGCTCGCCCAAATTTTTCACCTCTGCCTAATCA Antisense AR1 5 -ACAGTGGGGGAAAGC nd primer set Sense P3 5 -CTCGCTCGCCCAAATTTTTCACCTCTGCCTAATCA Antisense AR2 5 -AGAAACGGRCTGAGGC Fragment II 1st primer set Sense AF1 5 -GTCTGCGGCGTTTTATC Antisense P4 5 -CTGGTTCGGCCCAAAAAGTTGCATGGTGCTGG nd primer set Sense AF2 5 -TGCCCGTTTGTCCTCTA Antisense P4 5 -CTGGTTCGGCCCAAAAAGTTGCATGGTGCTGG a nt, number of nucleotides. Table 2 Sequencing primers. Primer name Sequence (5 3 ) Position (nt a ) Domain AR2 5 -AGAAACGGRCTGAGGC S gene P14 5 -CTGTAACACGAGAAGGGGTCCTAG S gene P13 5 -TTGGGATTGAAGTCCCAATCTGG PreS1 gene PP2 5 -TACTAACATTGRGATTCCCGAGA C gene CTGACTACTAATTCCCTGGATGCTGGGTCT C gene S3 5 -GCGGGGTTTTTCTTGTTGAC S gene AF2 5 -TGCCCGTTTGTCCTCTA S gene 970F 5 -CCTATTGATTGGAAAGTATGTCA P gene P10 5 -CCATACTGCGGAACTCCTAGC P gene P24 5 -GAGACCACCGTGAACGCCCA X gene S4 5 -GGGACTCAAGATGTTGTACAG S gene a nt, number of nucleotides. Table 3 Characterization of HBV infected patients with or without anti-hbs. Group I (n = 35) Group II (n = 70) P Age (mean ± SD) 42 ± ± 15 >0.05 Male:Female 21:14 42:28 >0.05 Genotype (B:C) 21:14 42:28 >0.05 BCP double mutations, no (%) 20 (57.1) 23 (32.9) <0.05 HBsAg level (log 10 IU/mL, mean ± SD) 2.67 ± ± * HBeAg (no. positive) HBV DNA (log 10 copies/ml, mean ± SD) 4.83 ± ± * Serum ALT level (IU/L, mean ± SD) 295 ± ± Abbreviations: HBsAg, hepatitis B surface antigen; HBeAg, hepatitis B e antigen; HBV, hepatitis B virus; ALT, alanine aminotransferase; BCP, basal core promoter. * Statistically significant difference (P < 0.05). Table 4 Deletions and insertions of HBV infected patients with or without anti-hbs. ID Group HBV genotype Mutation pattern Position (nt) I 6 I C1 pres/pol deletion, 18 bp I 9 I B2 pres/pol deletion, 125 bp I 11 I B2 S/pol insertion, 24 bp I 27 I C1 pres/pol deletion, 52 bp 7 57 I 31 I C1 pres/pol deletion, 46 bp S/pol insertion, 12 bp II2 II B2 pres/pol deletion, 147 bp II5 II C1 pres/pol deletion, 90 bp II29 II C1 X deletion, 55 bp II39 II B2 pres/pol deletion, 49 bp 8 55 II43 II C1 pres/pol deletion, 10 bp II50 II C1 pres/pol deletion, 16 bp X deletion, 3 bp II53 II C1 S/pol deletion, 3 bp II57 II C1 pres/pol deletion, 21 bp 1 21 II68 II C1 X insertion, 9 bp

4 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Table 5 Number of amino acid substitution (per 100 amino acid). Genotype B Genotype C All genotypes I a II a P I a II a P I a II a P S protein <0.001 * <0.001 * MHR * * <0.001 * A epitope (aa124 aa147) * * <0.001 * 1st loop (aa124 aa137) * <0.001 * 2nd loop (aa139 aa148) Pre a (aa99 aa123) Post a (aa149 aa169) * CTL epitope S A (aa19 aa28) CTL epitope S B (aa87 aa95) * * CTL epitope S C (aa97 aa106) CTL epitope S D (aa172 aa180) * CTL epitope S E (aa185 aa194) CTL epitope S F (aa207 aa216) CTL epitope S G(aa215 aa223) PreS protein * HBx protein K130M/V131I (A1762T/G1764A) * * HBc protein CTL epitope C A (aa1 aa20) CTL epitope C B (aa18 aa27) CTL epitope C C (aa28 aa47) CTL epitope C D (aa50 aa69) CTL epitope C E (aa111 aa125) CTL epitope C F (aa117 aa131) CTL epitope C G (aa120 aa139) CTL epitope C H (aa141 aa151) PreCore region W28stop (G1896A) Polymerase Abbreviations: MHR, major hydrophilic region; CTL, cytotoxic T lymphocyte. a Group. * Statistically significant difference (P < 0.05). aa variability of the cytotoxic T lymphocyte (CTL) epitope of HBsAg (aa87 aa95) in group I was found higher than those in group II (2.22 vs. 0.16, P < 0.05). The difference of residue substitution in remain regions of HBV genomes was not significant between two groups (P > 0.05). The percentage of MHR variants in patients was significantly different between the two groups [65.7% (23/35) vs. 44.3% (31/70), P < 0.05]. The most frequent sites observed in group I were s126, s129 and s130, but the G145R/A amino acid change which was popular in previous reports was only found in one patient with coexistence of HBsAg and anti-hbs (Fig. 1). It is worth noting that the incidence of basal core promoter (BCP) double mutations (A1762T/G1764A) in group I was higher than that of group II (20/35 vs. 23/70, P < 0.05). 5. Discussion In this study, 3.6% of chronic HBV carriers were both carrying HBsAg and anti-hbs. The percentage is close to the previous reports, 7,13,18 but is lower than the other study. 6 The difference might be not only due to demographic, ethnic and geographical diversion, but also due to diagnosis criteria. Furthermore, in previous studies the numbers of patients with coexistence of HBsAg and anti-hbs for analysis was limited, and the criterion of choosing patients was inconsistent among different studies. 7,13,18 In our study, the threshold level of anti-hbs was defined as 10 miu/ml, an anti-hbs titer >10 miu/ml, which is commonly considered protective according to the Chinese consensus criteria. 14 The previous study suggested that pres deletion might be associate with the coexistence of HBsAg and anti-hbs in chronically HBV infected patients. 2,4,18 In this study, no significant difference between the two groups was detected concerning the incidence of pres deletions. This may be due to the diversity of case number and other characteristics of the subjects, such as age, ethnic or genotypes. The difference methods may also contribute to the inconsistency for the previous study adopt cloning analysis instead of direct sequencing. 2,4 Though the mechanism of concurrent HBsAg and anti-hbs in serum remains unclear, one possible interpretation might be the selection of HBsAg immune escape variants. It is reported that the incidence of aa substitution in MHR, especially in a determinant, is higher in patients carrying both HBsAg and anti-hbs than those carrying HBsAg. 6,7 In this study, we also found statistical significance in the incidence of a determinant mutations between the two groups, which accord with previous conclusion. In addition, we found that it is the first loop, but not the second loop of a determinant region that responsible for the higher mutations incidence, for the second loop shows no significant difference in the mutations incidence comparison of the two groups. Most of the patients carrying HBsAg and anti-hbs in previous studies have received antiviral treatment. 6,7,19 Interferon treatments may stimulate immune selection pressure and induce viral genome mutation acceleration, and nucleoside or nucleotide analogs may induce mutation in viral S proteins as well due to the overlapped cording sequence with the RT of polymerase. In other reports, the patients with concurrent HBsAg and anti-hbs were predominant immunosuppression, 7,20 which might also influence the immunological status and selection of HBV mutant. These data suggest that the mutation site of naturally occurring S gene variants is mostly located in the first loop of a determinant in patients with coexistence of HBsAg and anti-hbs. Moreover, the most frequent changes occurred in group I were located at positions s126, s129 and s130, which accord with the previous studies. 2 4 The G145R/A was also described in many studies, which is one of the most common immune-escape mutants are responsible for immune prophylaxis failure, but only one G145R was observed in group I patients in

5 202 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Fig. 1. Amino acid variability of MHR (aa99 169) in group I and group II. The reference amino acid sequences of genotypes B and C were deduced from the following GenBank sequences: genotype B: AB073826; Genotype C: AF this study. Accordingly, the s145 point mutation showed no statistical difference in patients with and without HBsAg and anti-hbs coexsitence. This result is also in accordance with another recent study, 18 which suggests the s145 point mutation is not common in HBV genotype B and C infected patients with coexisting HBsAg and anti-hbs. The most important finding of our study is that the incidence of BCP double mutations (A1762T/G1764A) in group I was significantly higher than those in group II. Many studies have revealed that these double mutations are associated with an increased risk of severe of liver diseases including HCC, and can be used as a prediagnostic biomarker of HCC In a long-term followup study of HBV carriers, which has shown the presence of BCP (A1762T/G1764A) mutations is an independent predicator for progression to HCC. 29 A meta-analysis has yielded a summary OR of 3.79 (95% CI = ) for development of HCC in patients with BCP double mutations. 30 Taking these evidence, we suggested that the chronically HBV infected patients with coexistence of HBsAg and anti-hbs, might have increased risk of HCC. As this study is a cross-section analysis, further follow-up investigation is imperative to corroborate this presumption. In summary, our study showed a higher aa variability in the first loop of a determinant and a more frequent of BCP double mutations in patients with concurrent HBsAg and anti-hbs serological markers pattern. Further large-scale, multi-center studies are needed to clarify the clinical implications of this serological pattern, including ability of specific T cell immune responses, efficacy of antiviral agents, and clinical course. Funding This work was supported by a grant from the Major national S&T Projects for infectious diseases (2008ZX , 2009ZX ) and the Foundation Project for Medical Science and Technology of Zhejiang Province (No. 2009B056). Competing interests We have no financial conflicts of interest to this manuscript. Ethical approval The study was approved by Ethics Review Committee of the First Affiliated Hospital, School of Medicine, Zhejiang University. Acknowledgments We would like to thank Dr. Ningshao Xia for technical supporting of this study.

6 Y. Chen et al. / Journal of Clinical Virology 52 (2011) References 1. Tabor E, Gerety RJ, Smallwood LA, Barker LF. Coincident hepatitis B surface antigen and antibodies of different subtypes in human serum. J Immunol 1977;118: Yamamoto K, Horikita M, Tsuda F, Itoh K, Akahane Y, Yotsumoto S, et al. Naturally occurring escape mutants of hepatitis B virus with various mutations in the S gene in carriers seropositive for antibody to hepatitis B surface antigen. J Virol 1994;68: Kohno H, Inoue T, Tsuda F, Okamoto H, Akahane Y. Mutations in the envelope gene of hepatitis B virus variants co-occurring with antibody to surface antigen in sera from patients with chronic hepatitis B. J Gen Virol 1996;77: Wang YM, Ng WC, Lo SK. Detection of pre-s/s mutants in chronic hepatitis B carriers with concurrent hepatitis B surface antibody and hepatitis B suface antigen. J Gastroenterol 1999;34: Mathet VL, Feld M, Espinola L, Sánchez DO, Ruiz V, Mandó O, et al. Hepatitis B virus S gene mutants in a patient with chronic active hepatitis with circulating anti-hbs antibodies. J Med Virol 2003;69: Lada O, Benhamou Y, Poynard T, Thibault V. Coexistence of hepatitis B surface antigen (HBsAg) and anti-hbs antibodies in chronic hepatitis B virus carriers: influence of a determinant variants. J Virol 2006;80: Colson P, Borentain P, Motte A, Henry M, Moal V, Botta-Fridlund D, et al. Clinical and virological significance of the co-existence of HBsAg and anti-hbs antibodies in hepatitis B chronic carriers. Virology 2007;367: Carman WF. The clinical significance of surface antigen variants of hepatitis B virus. J Viral Hepat 1997;4(Suppl 1): Chen WN, Oon CJ, Toh I. Altered antigenicities of hepatitis B virus surface antigen carrying mutations outside the common a determinant. Am J Gastroenterol 2000;95: Cooreman MP, Leroux-Roels G, Paulij WP. Vaccine- and hepatitis B immune globulin-induced escape mutations of hepatitis B virus surface antigen. J Biomed Sci 2001;8: Lu M, Lorentz T. De novo infection in a renal transplant recipient caused by novel mutants of hepatitis B virus despite the presence of protective anti-hepatitis B surface antibody. J Infect Dis 2003;187: Seddigh-Tonekaboni S, Waters JA, Jeffers S, Gehrke R, Ofenloch B, Horsch A, et al. Effect of variation in the common a determinant on the antigenicity of hepatitis B surface antigen. J Med Virol 2000;60: Zhang JM, Xu Y, Wang XY, Yin YK, Wu XH, Weng XH, et al. Coexistence of hepatitis B surface antigen (HBsAg) and heterologous subtype-specific antibodies to HBsAg among patients with chronic hepatitis B virus infection. Clin Infect Dis 2007;44: Chinese Society of Hepatology, Chinese Medical Association, Chinese Society of Infectious Diseases, Chinese Medical Association. Guideline on prevention and treatment of chronic hepatitis B in China (2005). Chin Med J (Engl) 2007;120: Galibert F, Mandart E, Fitoussi F, Tiollais P, Charnay P. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 1979;281: Gunther S, Li BC, Miska S, Krüger DH, Meisel H, Will H. A novel method for efficient amplification of whole hepatitis B virus genomes permits rapid functional analysis and reveals deletion mutant in immunosuppressed patients. J Virol 1995;69: Yuan Q, Ou SH, Chen CR, Ge SX, Pei B, Chen QR, et al. Molecular characteristics of occult hepatitis B virus from blood donors in southeast China. J Clin Microbiol 2010;48: Huang X, Qin Y, Zhang P, Tang G, Shi Q, Xu J, et al. PreS deletion mutations of hepatitis B virus in chronically infected patients with simultaneous seropositivity for hepatitis B surface antigen and anti-hbs antibodies. J Med Virol 2010;82: Awerkiew S, Däumer M, Reiser M, Wend UC, Pfister H, Kaiser R, et al. Reactivation of an occult hepatitis B virus escape mutant in an anti-hbs positive, anti-hbc negative lymphoma patient. J Clin Virol 2007;38: Westhoff TH, Jochimsen F, Schmittel A, Stoffler-Meilicke M, Schafer JH, Zidek W, et al. Fatal hepatitis B virus reactivation by an escape mutant following rituximab therapy. Blood 2003;102: Terrault NA, Zhou S, McCory RW, Pruett TL, Lake JR, Roberts JP, et al. Incidence and clinical consequences of surface and polymerase gene mutations in liver transplant recipients on hepatitis B immunoglobulin. Hepatology 1998;28: Shinji T, Koide N, Hanafusa T, Hada H, Oka T, Takayama N, et al. Point mutations in the S and pre-s2 genes observed in two hepatitis B virus carriers positive for antibody to hepatitis B surface antigen. Hepatogastroenterology 1998;45: Kajiwara E, Tanaka Y, Ohashi T, Uchimura K, Sadoshima S, Kinjo M, et al. Hepatitis B caused by a hepatitis B surface antigen escape mutant. J Gastroenterol 2008;43: Liu SL, Dong Y, Zhang L, Li MW, Wo JE, Lu LW, et al. Influence of HBV gene heterogeneity on the failure of immunization with HBV vaccines in eastern China. Arch Virol 2009;154: Kao JH, Chen PJ, Lai MY, Chen DS. Basal core promoter mutations of hepatitis B virus increase the risk of hepatocellular carcinoma in hepatitis B carriers. Gastroenterology 2003;124: Lin CL, Liao LY, Wang CS, Chen PJ, Lai MY, Chen DS, et al. Basal core-promoter mutant of hepatitis B virus and progression of liver disease in hepatitis B e antigen-negative chronic hepatitis B. Liver Int 2005;25: Liu CJ, Chen BF, Chen PJ, Lai MY, Huang WL, Kao JH, et al. Role of hepatitis B viral load and basal core promoter mutation in hepatocellular carcinoma in hepatitis B carriers. J Infect Dis 2006;193: Kuang SY, Jackson PE, Wang JB, Lu PX, Muñoz A, Qian GS, et al. Specific mutations of hepatitis B virus in plasma predict liver cancer development. Proc Natl Acad Sci USA 2004;101: Yang HI, Yeh SH, Chen PJ, Iloeje UH, Jen CL, Su J, et al. Associations between hepatitis B virus genotype and mutants and the risk of hepatocellular carcinoma. J Natl Cancer Inst 2008;100: Liu S, Zhang H, Gu C, Yin J, He Y, Xie J, et al. Associations between hepatitis B virus mutations and the risk of hepatocellular carcinoma: a meta-analysis. J Natl Cancer Inst 2009;101: