Journal of Clinical Virology
|
|
- Shana Watts
- 8 years ago
- Views:
Transcription
1 Journal of Clinical Virology 52 (2011) Contents lists available at ScienceDirect Journal of Clinical Virology jo u r n al hom epage: Mutations in hepatitis B virus DNA from patients with coexisting HBsAg and anti-hbs Yu Chen a, Fuchu Qian b, Quan Yuan c, Xuefen Li d, Wei Wu a, Xichao Guo d, Lanjuan Li a, a State Key Laboratory for Diagnosis and Treatment of Infectious Diseases, First Affiliated Hospital, School of Medicine, Zhejiang University, 79 Qingchun Road, Hangzhou , China b Department of Laboratory Medicine, Huzhou Central Hospital, Huzhou, China c National Institute of Diagnostics and Vaccine Development of Infectious Diseases, School of Life Science, Xiamen University, China d Department of Laboratory Medicine, First Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, China a r t i c l e i n f o Article history: Received 25 February 2011 Received in revised form 6 May 2011 Accepted 8 July 2011 Keywords: Hepatitis B virus Hepatitis B surface antigen (HBsAg) Antibody to HBsAg (anti-hbs) Genome Variation a b s t r a c t Background: The serological markers with coexistence of hepatitis B surface antigen (HBsAg) and antibody to HBsAg (anti-hbs) of hepatitis B virus (HBV) infection were rare pattern. The virological significance, immune response and clinical outcome of these patients remain largely unknown. Objectives: This research explores the relationship between this serological profile and HBV genome variants. Study design: We studied 35 patients both carrying HBsAg and anti-hbs (group I), and 70 patients with HBsAg positive but anti-hbs negative (group II, served as control). The HBV genome sequences were obtained by direct sequencing of polymerase chain reaction (PCR) products. Results: The amino acid (aa) variation within major hydrophilic region (MHR), especially in the first loop (aa ) of a determinant in group I is significantly higher than those in group II. The aa variation of cytotoxic lymphocyte (CTL) epitope in HBsAg (aa87 aa95) in group I is also significantly higher than that in group II. Interestingly, the basal core promoter (BCP) double mutations (A1762T/G1764A) in group I is significantly higher than those in group II as well. Conclusions: In patients with HBV infection, the coexistence of HBsAg and anti-hbs is associated with an increased aa variability in several key areas of HBV genome. The molecular characteristic of HBV in HBsAg and anti-hbs positive patients is distinct and worth further studies Elsevier B.V. All rights reserved. 1. Background In serological markers of hepatitis B virus (HBV) infection, general theory consider that the antibody to HBsAg (anti-hbs) can neutralize HBsAg, so it is generally agreed that there will be no simultaneous positive for both HBsAg and anti-hbs in routine clinical practice. However, there were concurrent HBsAg and anti-hbs in chronic HBV carriers that had been reported in previous studies. 1 4 There may be three important situations leading to coexisting HBsAg and anti-hbs: (i) chronic carriage with existing but ineffective anti-hbs response, (ii) brerakthrough of HBV in vaccinated people and (iii) reactivation of HBV in immune patients who undergo immunosuppression. So far, the virological significance, immune response and clinical outcome of these patients remain largely unknown. Corresponding author. Tel.: ; fax: addresses: ljli@zju.edu.cn, ahmuysg@sina.com (L. Li). Several reports showed that the pattern of concurrent HBsAg and anti-hbs might be associated with accumulative HBsAg mutants, especially in the a determinant within the major hydrophilic region (MHR). 5 7 A number of mutants within or around the a determinant of HBsAg had been reported in previous studies. Some mutants reduce the binding affinity of HBsAg to specific antibodies and enable HBV to escape the neutralization by anti-hbs A later report suggested that the phenomenon of concurrent HBsAg and anti-hbs was not associated with the specific amnio acid (aa) substitution in HBsAg, but with the incapability of binding of anti-hbs and HBsAg. 13 So the viewpoints were controversial and the mechanism underlying these serological pattern remained not quite clear. 2. Objectives In order to elucidate the relationship between viral gene variant and the pattern of concurrent HBsAg and anti-hbs in Chinese chronic HBV carriers, we conducted this study /$ see front matter 2011 Elsevier B.V. All rights reserved. doi: /j.jcv
2 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Study design 3.1. Objects of study Between October 2008 and December 2009, 35 patients with simultaneous positive for HBsAg and anti-hbs recruited from First Affiliated Hospital, School of Medicine, Zhejiang University were prospectively enrolled for the study. At the same time, 70 patients with HBsAg positive and anti-hbs negative were enrolled as the control group. The diagnosis of chronic HBV infection was made according to the Chinese consensus criteria. 14 All patients with previous anti-virus therapy, coinfection with hepatitis C virus, hepatitis D virus, or HIV were excluded. All individuals provided written informed consent before participating this study. Serum were collected before treatment and stored at 70 C Serologic markers assessments Routine serologic markers for HBsAg, anti-hbs, and HBeAg were determined with the Architect-i2000 system (Abbott Laboratories, USA). The quantitative determination of HBsAg concentration values <0.05 IU/mL are considered negative and >0.05 IU/mL are considered positive by the criteria of ARCHITECT HBsAg. Specimens are flagged with the code > IU/mL may be diluted with the Manual Dilution Procedure. The threshold level of anti-hbs was defined as 10 miu/ml. Serum alanine aminotransferase (ALT) level was performed with routine automated techniques (HITACHI 7600, Japan) Quantification of serum HBV DNA level Serum HBV DNA level was quantified using the Cobas HBV Amplicor Monitor assay (Roche Diagnostics, USA), and the detection limit of the assay was 300 viral genomes copies/ml Serum DNA extraction Viral DNA was extracted from 200 L serum using QIAamp DNA blood mini kit (Qiagen, Germany) Nest PCR amplified full-length HBV genome HBV genome was divided into two fragments for amplification, fragment I (nt ) and fragment II (nt ) according to the previously protocol. 15 Nest PCR primers were designed as described, 16,17 and listed in Table 1. For amplification of fragment I, 25 L reaction mixture including 5 L DNA template, 2U primestar high fidelity DNA polymerase (Takara, China), and the outer primer P3/AR1 were submitted to the first round of amplification in the following steps: hot start and denaturation at 94 C for 4 min, 35 cycles of 94 C for 30 s, 58 C for 30 s, and 72 C for 2.5 min, then incubate at 72 C for 5 min. Two microlitres aliquot of the first-round PCR products was used as the template of the second-round PCR, and the reaction mixture was the same as the first-round except that the inner primer P3/AR2 was used. The steps were also same except the second-round PCR only 25 cycles instead of 35. For amplification of fragment II, the first-round and secondround PCR primers were AF1/P4 and AF2/P4, respectively. The methods were the same as other in fragment I amplification DNA sequencing and sequence analysis Following the PCR amplification and consequent electrophoresis, the PCR products were recovered and purified from agarose gel, using a QIAquick gel extraction kit (Qiagen, Germany). All products were directly sequenced with a BigDye termination V3.1 cycle sequencing kit (Applied Biosystems, USA) and run on an ABI Prism 3130X automatic genetic analyzer (Applied Biosystems, USA). The primers used for sequencing are summarized in Table 2. HBV genome sequences obtained were compared with the reference sequences in the Genbank for HBV genotyping and genosubtyping. Phylogenetic analysis was performed using the neighbor-joining method (MEGA software, version 4.1) Statistical analysis Statistical analyses were performed by the Student s test for quantitative data, and the 2 analysis test for categorical variables. The differences were considered statistically significant at P < Results 4.1. Characteristics of patients both carrying HBsAg and anti-hbs A total of patients were tested for HBV serum markers, and 1985 (13.7%) were HBsAg-positive. Among these HBsAgpositive patients, 72 (3.6%) were both carrying HBsAg and anti-hbs. And 35 of them were selected as the test group (group I) for positive results of HBV DNA. Seventy newly diagnosed patients with HBsAg-positive and anti-hbs-negative were enrolled as control group (group II), whose age, sex and genotypes were matched with the group I. Table 3 shows the clinical characteristics of the two groups. There was no significant difference between patients with and without anti-hbs in HBeAg positive rate and serum ALT level (P > 0.05). The patients with coexistence of HBsAg and anti-hbs had lower HBsAg level and HBV DNA concentration compared with those of the patients whose HBsAg soly were positive (P < 0.05) HBV genotypes and subgenotypes The complete genome sequences for both group I and group II were compared with the reference sequences from GenBank for HBV genotypes and subgenotypes. The major subgenotype in group I was B2 (n = 21, 60%) and C1 (n = 14, 40%). In group II, the predominant subgenotype also was B2 (n = 41, 58.6%), then the subgenotype C1 (n = 26, 37.1%), C2 (n = 2, 2.9%) and B4 (n = 1, 1.4%). There was no significant difference in subgenotypes distribution between the two groups Nucleotide deletions and insertions In this study, deletions and insertions were observed in 5 patients in group I and 9 patients in group II (Table 4). Of note, most of the deletions and insertions occurred in pres and X gene regions. There were no significant difference between group I and group II (P > 0.05) Amino acid substitution of HBV Amino acid (aa) substitution of strains from group I were compared with those in group II (Table 5). Significant aa substitution diversity was observed within S gene of HBV between group I and group II (1.83 vs. 1.18, for substitution per 100 aa, the same below, P < 0.05). Moreover, the aa variability of group I in the MHR (1.37 vs. 0.48, P < 0.05) and a determinant (2.38 vs. 0.77, P < 0.05) were higher than group II. Furthermore, the aa variability in the first loop (aa ) of a determinant was more variable in group I than in group II (4.00 vs. 1.33, P < 0.05), but that was not occurred in the second loop (aa ) (0.29 vs. 0.14, P > 0.05). In addition, the
3 200 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Table 1 HBV DNA amplification primers. Primers set and type Primer name Sequence (5 3 ) Position (nt a ) Product length (bp) Fragment I 1st primer set Sense P3 5 -CTCGCTCGCCCAAATTTTTCACCTCTGCCTAATCA Antisense AR1 5 -ACAGTGGGGGAAAGC nd primer set Sense P3 5 -CTCGCTCGCCCAAATTTTTCACCTCTGCCTAATCA Antisense AR2 5 -AGAAACGGRCTGAGGC Fragment II 1st primer set Sense AF1 5 -GTCTGCGGCGTTTTATC Antisense P4 5 -CTGGTTCGGCCCAAAAAGTTGCATGGTGCTGG nd primer set Sense AF2 5 -TGCCCGTTTGTCCTCTA Antisense P4 5 -CTGGTTCGGCCCAAAAAGTTGCATGGTGCTGG a nt, number of nucleotides. Table 2 Sequencing primers. Primer name Sequence (5 3 ) Position (nt a ) Domain AR2 5 -AGAAACGGRCTGAGGC S gene P14 5 -CTGTAACACGAGAAGGGGTCCTAG S gene P13 5 -TTGGGATTGAAGTCCCAATCTGG PreS1 gene PP2 5 -TACTAACATTGRGATTCCCGAGA C gene CTGACTACTAATTCCCTGGATGCTGGGTCT C gene S3 5 -GCGGGGTTTTTCTTGTTGAC S gene AF2 5 -TGCCCGTTTGTCCTCTA S gene 970F 5 -CCTATTGATTGGAAAGTATGTCA P gene P10 5 -CCATACTGCGGAACTCCTAGC P gene P24 5 -GAGACCACCGTGAACGCCCA X gene S4 5 -GGGACTCAAGATGTTGTACAG S gene a nt, number of nucleotides. Table 3 Characterization of HBV infected patients with or without anti-hbs. Group I (n = 35) Group II (n = 70) P Age (mean ± SD) 42 ± ± 15 >0.05 Male:Female 21:14 42:28 >0.05 Genotype (B:C) 21:14 42:28 >0.05 BCP double mutations, no (%) 20 (57.1) 23 (32.9) <0.05 HBsAg level (log 10 IU/mL, mean ± SD) 2.67 ± ± * HBeAg (no. positive) HBV DNA (log 10 copies/ml, mean ± SD) 4.83 ± ± * Serum ALT level (IU/L, mean ± SD) 295 ± ± Abbreviations: HBsAg, hepatitis B surface antigen; HBeAg, hepatitis B e antigen; HBV, hepatitis B virus; ALT, alanine aminotransferase; BCP, basal core promoter. * Statistically significant difference (P < 0.05). Table 4 Deletions and insertions of HBV infected patients with or without anti-hbs. ID Group HBV genotype Mutation pattern Position (nt) I 6 I C1 pres/pol deletion, 18 bp I 9 I B2 pres/pol deletion, 125 bp I 11 I B2 S/pol insertion, 24 bp I 27 I C1 pres/pol deletion, 52 bp 7 57 I 31 I C1 pres/pol deletion, 46 bp S/pol insertion, 12 bp II2 II B2 pres/pol deletion, 147 bp II5 II C1 pres/pol deletion, 90 bp II29 II C1 X deletion, 55 bp II39 II B2 pres/pol deletion, 49 bp 8 55 II43 II C1 pres/pol deletion, 10 bp II50 II C1 pres/pol deletion, 16 bp X deletion, 3 bp II53 II C1 S/pol deletion, 3 bp II57 II C1 pres/pol deletion, 21 bp 1 21 II68 II C1 X insertion, 9 bp
4 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Table 5 Number of amino acid substitution (per 100 amino acid). Genotype B Genotype C All genotypes I a II a P I a II a P I a II a P S protein <0.001 * <0.001 * MHR * * <0.001 * A epitope (aa124 aa147) * * <0.001 * 1st loop (aa124 aa137) * <0.001 * 2nd loop (aa139 aa148) Pre a (aa99 aa123) Post a (aa149 aa169) * CTL epitope S A (aa19 aa28) CTL epitope S B (aa87 aa95) * * CTL epitope S C (aa97 aa106) CTL epitope S D (aa172 aa180) * CTL epitope S E (aa185 aa194) CTL epitope S F (aa207 aa216) CTL epitope S G(aa215 aa223) PreS protein * HBx protein K130M/V131I (A1762T/G1764A) * * HBc protein CTL epitope C A (aa1 aa20) CTL epitope C B (aa18 aa27) CTL epitope C C (aa28 aa47) CTL epitope C D (aa50 aa69) CTL epitope C E (aa111 aa125) CTL epitope C F (aa117 aa131) CTL epitope C G (aa120 aa139) CTL epitope C H (aa141 aa151) PreCore region W28stop (G1896A) Polymerase Abbreviations: MHR, major hydrophilic region; CTL, cytotoxic T lymphocyte. a Group. * Statistically significant difference (P < 0.05). aa variability of the cytotoxic T lymphocyte (CTL) epitope of HBsAg (aa87 aa95) in group I was found higher than those in group II (2.22 vs. 0.16, P < 0.05). The difference of residue substitution in remain regions of HBV genomes was not significant between two groups (P > 0.05). The percentage of MHR variants in patients was significantly different between the two groups [65.7% (23/35) vs. 44.3% (31/70), P < 0.05]. The most frequent sites observed in group I were s126, s129 and s130, but the G145R/A amino acid change which was popular in previous reports was only found in one patient with coexistence of HBsAg and anti-hbs (Fig. 1). It is worth noting that the incidence of basal core promoter (BCP) double mutations (A1762T/G1764A) in group I was higher than that of group II (20/35 vs. 23/70, P < 0.05). 5. Discussion In this study, 3.6% of chronic HBV carriers were both carrying HBsAg and anti-hbs. The percentage is close to the previous reports, 7,13,18 but is lower than the other study. 6 The difference might be not only due to demographic, ethnic and geographical diversion, but also due to diagnosis criteria. Furthermore, in previous studies the numbers of patients with coexistence of HBsAg and anti-hbs for analysis was limited, and the criterion of choosing patients was inconsistent among different studies. 7,13,18 In our study, the threshold level of anti-hbs was defined as 10 miu/ml, an anti-hbs titer >10 miu/ml, which is commonly considered protective according to the Chinese consensus criteria. 14 The previous study suggested that pres deletion might be associate with the coexistence of HBsAg and anti-hbs in chronically HBV infected patients. 2,4,18 In this study, no significant difference between the two groups was detected concerning the incidence of pres deletions. This may be due to the diversity of case number and other characteristics of the subjects, such as age, ethnic or genotypes. The difference methods may also contribute to the inconsistency for the previous study adopt cloning analysis instead of direct sequencing. 2,4 Though the mechanism of concurrent HBsAg and anti-hbs in serum remains unclear, one possible interpretation might be the selection of HBsAg immune escape variants. It is reported that the incidence of aa substitution in MHR, especially in a determinant, is higher in patients carrying both HBsAg and anti-hbs than those carrying HBsAg. 6,7 In this study, we also found statistical significance in the incidence of a determinant mutations between the two groups, which accord with previous conclusion. In addition, we found that it is the first loop, but not the second loop of a determinant region that responsible for the higher mutations incidence, for the second loop shows no significant difference in the mutations incidence comparison of the two groups. Most of the patients carrying HBsAg and anti-hbs in previous studies have received antiviral treatment. 6,7,19 Interferon treatments may stimulate immune selection pressure and induce viral genome mutation acceleration, and nucleoside or nucleotide analogs may induce mutation in viral S proteins as well due to the overlapped cording sequence with the RT of polymerase. In other reports, the patients with concurrent HBsAg and anti-hbs were predominant immunosuppression, 7,20 which might also influence the immunological status and selection of HBV mutant. These data suggest that the mutation site of naturally occurring S gene variants is mostly located in the first loop of a determinant in patients with coexistence of HBsAg and anti-hbs. Moreover, the most frequent changes occurred in group I were located at positions s126, s129 and s130, which accord with the previous studies. 2 4 The G145R/A was also described in many studies, which is one of the most common immune-escape mutants are responsible for immune prophylaxis failure, but only one G145R was observed in group I patients in
5 202 Y. Chen et al. / Journal of Clinical Virology 52 (2011) Fig. 1. Amino acid variability of MHR (aa99 169) in group I and group II. The reference amino acid sequences of genotypes B and C were deduced from the following GenBank sequences: genotype B: AB073826; Genotype C: AF this study. Accordingly, the s145 point mutation showed no statistical difference in patients with and without HBsAg and anti-hbs coexsitence. This result is also in accordance with another recent study, 18 which suggests the s145 point mutation is not common in HBV genotype B and C infected patients with coexisting HBsAg and anti-hbs. The most important finding of our study is that the incidence of BCP double mutations (A1762T/G1764A) in group I was significantly higher than those in group II. Many studies have revealed that these double mutations are associated with an increased risk of severe of liver diseases including HCC, and can be used as a prediagnostic biomarker of HCC In a long-term followup study of HBV carriers, which has shown the presence of BCP (A1762T/G1764A) mutations is an independent predicator for progression to HCC. 29 A meta-analysis has yielded a summary OR of 3.79 (95% CI = ) for development of HCC in patients with BCP double mutations. 30 Taking these evidence, we suggested that the chronically HBV infected patients with coexistence of HBsAg and anti-hbs, might have increased risk of HCC. As this study is a cross-section analysis, further follow-up investigation is imperative to corroborate this presumption. In summary, our study showed a higher aa variability in the first loop of a determinant and a more frequent of BCP double mutations in patients with concurrent HBsAg and anti-hbs serological markers pattern. Further large-scale, multi-center studies are needed to clarify the clinical implications of this serological pattern, including ability of specific T cell immune responses, efficacy of antiviral agents, and clinical course. Funding This work was supported by a grant from the Major national S&T Projects for infectious diseases (2008ZX , 2009ZX ) and the Foundation Project for Medical Science and Technology of Zhejiang Province (No. 2009B056). Competing interests We have no financial conflicts of interest to this manuscript. Ethical approval The study was approved by Ethics Review Committee of the First Affiliated Hospital, School of Medicine, Zhejiang University. Acknowledgments We would like to thank Dr. Ningshao Xia for technical supporting of this study.
6 Y. Chen et al. / Journal of Clinical Virology 52 (2011) References 1. Tabor E, Gerety RJ, Smallwood LA, Barker LF. Coincident hepatitis B surface antigen and antibodies of different subtypes in human serum. J Immunol 1977;118: Yamamoto K, Horikita M, Tsuda F, Itoh K, Akahane Y, Yotsumoto S, et al. Naturally occurring escape mutants of hepatitis B virus with various mutations in the S gene in carriers seropositive for antibody to hepatitis B surface antigen. J Virol 1994;68: Kohno H, Inoue T, Tsuda F, Okamoto H, Akahane Y. Mutations in the envelope gene of hepatitis B virus variants co-occurring with antibody to surface antigen in sera from patients with chronic hepatitis B. J Gen Virol 1996;77: Wang YM, Ng WC, Lo SK. Detection of pre-s/s mutants in chronic hepatitis B carriers with concurrent hepatitis B surface antibody and hepatitis B suface antigen. J Gastroenterol 1999;34: Mathet VL, Feld M, Espinola L, Sánchez DO, Ruiz V, Mandó O, et al. Hepatitis B virus S gene mutants in a patient with chronic active hepatitis with circulating anti-hbs antibodies. J Med Virol 2003;69: Lada O, Benhamou Y, Poynard T, Thibault V. Coexistence of hepatitis B surface antigen (HBsAg) and anti-hbs antibodies in chronic hepatitis B virus carriers: influence of a determinant variants. J Virol 2006;80: Colson P, Borentain P, Motte A, Henry M, Moal V, Botta-Fridlund D, et al. Clinical and virological significance of the co-existence of HBsAg and anti-hbs antibodies in hepatitis B chronic carriers. Virology 2007;367: Carman WF. The clinical significance of surface antigen variants of hepatitis B virus. J Viral Hepat 1997;4(Suppl 1): Chen WN, Oon CJ, Toh I. Altered antigenicities of hepatitis B virus surface antigen carrying mutations outside the common a determinant. Am J Gastroenterol 2000;95: Cooreman MP, Leroux-Roels G, Paulij WP. Vaccine- and hepatitis B immune globulin-induced escape mutations of hepatitis B virus surface antigen. J Biomed Sci 2001;8: Lu M, Lorentz T. De novo infection in a renal transplant recipient caused by novel mutants of hepatitis B virus despite the presence of protective anti-hepatitis B surface antibody. J Infect Dis 2003;187: Seddigh-Tonekaboni S, Waters JA, Jeffers S, Gehrke R, Ofenloch B, Horsch A, et al. Effect of variation in the common a determinant on the antigenicity of hepatitis B surface antigen. J Med Virol 2000;60: Zhang JM, Xu Y, Wang XY, Yin YK, Wu XH, Weng XH, et al. Coexistence of hepatitis B surface antigen (HBsAg) and heterologous subtype-specific antibodies to HBsAg among patients with chronic hepatitis B virus infection. Clin Infect Dis 2007;44: Chinese Society of Hepatology, Chinese Medical Association, Chinese Society of Infectious Diseases, Chinese Medical Association. Guideline on prevention and treatment of chronic hepatitis B in China (2005). Chin Med J (Engl) 2007;120: Galibert F, Mandart E, Fitoussi F, Tiollais P, Charnay P. Nucleotide sequence of the hepatitis B virus genome (subtype ayw) cloned in E. coli. Nature 1979;281: Gunther S, Li BC, Miska S, Krüger DH, Meisel H, Will H. A novel method for efficient amplification of whole hepatitis B virus genomes permits rapid functional analysis and reveals deletion mutant in immunosuppressed patients. J Virol 1995;69: Yuan Q, Ou SH, Chen CR, Ge SX, Pei B, Chen QR, et al. Molecular characteristics of occult hepatitis B virus from blood donors in southeast China. J Clin Microbiol 2010;48: Huang X, Qin Y, Zhang P, Tang G, Shi Q, Xu J, et al. PreS deletion mutations of hepatitis B virus in chronically infected patients with simultaneous seropositivity for hepatitis B surface antigen and anti-hbs antibodies. J Med Virol 2010;82: Awerkiew S, Däumer M, Reiser M, Wend UC, Pfister H, Kaiser R, et al. Reactivation of an occult hepatitis B virus escape mutant in an anti-hbs positive, anti-hbc negative lymphoma patient. J Clin Virol 2007;38: Westhoff TH, Jochimsen F, Schmittel A, Stoffler-Meilicke M, Schafer JH, Zidek W, et al. Fatal hepatitis B virus reactivation by an escape mutant following rituximab therapy. Blood 2003;102: Terrault NA, Zhou S, McCory RW, Pruett TL, Lake JR, Roberts JP, et al. Incidence and clinical consequences of surface and polymerase gene mutations in liver transplant recipients on hepatitis B immunoglobulin. Hepatology 1998;28: Shinji T, Koide N, Hanafusa T, Hada H, Oka T, Takayama N, et al. Point mutations in the S and pre-s2 genes observed in two hepatitis B virus carriers positive for antibody to hepatitis B surface antigen. Hepatogastroenterology 1998;45: Kajiwara E, Tanaka Y, Ohashi T, Uchimura K, Sadoshima S, Kinjo M, et al. Hepatitis B caused by a hepatitis B surface antigen escape mutant. J Gastroenterol 2008;43: Liu SL, Dong Y, Zhang L, Li MW, Wo JE, Lu LW, et al. Influence of HBV gene heterogeneity on the failure of immunization with HBV vaccines in eastern China. Arch Virol 2009;154: Kao JH, Chen PJ, Lai MY, Chen DS. Basal core promoter mutations of hepatitis B virus increase the risk of hepatocellular carcinoma in hepatitis B carriers. Gastroenterology 2003;124: Lin CL, Liao LY, Wang CS, Chen PJ, Lai MY, Chen DS, et al. Basal core-promoter mutant of hepatitis B virus and progression of liver disease in hepatitis B e antigen-negative chronic hepatitis B. Liver Int 2005;25: Liu CJ, Chen BF, Chen PJ, Lai MY, Huang WL, Kao JH, et al. Role of hepatitis B viral load and basal core promoter mutation in hepatocellular carcinoma in hepatitis B carriers. J Infect Dis 2006;193: Kuang SY, Jackson PE, Wang JB, Lu PX, Muñoz A, Qian GS, et al. Specific mutations of hepatitis B virus in plasma predict liver cancer development. Proc Natl Acad Sci USA 2004;101: Yang HI, Yeh SH, Chen PJ, Iloeje UH, Jen CL, Su J, et al. Associations between hepatitis B virus genotype and mutants and the risk of hepatocellular carcinoma. J Natl Cancer Inst 2008;100: Liu S, Zhang H, Gu C, Yin J, He Y, Xie J, et al. Associations between hepatitis B virus mutations and the risk of hepatocellular carcinoma: a meta-analysis. J Natl Cancer Inst 2009;101:
Molecular Diagnosis of Hepatitis B and Hepatitis D infections
Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication
More informationHBV DNA < monitoring interferon Rx
Hepatitis B Virus Suspected acute hepatitis >>Order: Acute Unknown hepatitis screen Suspected chronic hepatitis >>Order: Chronic unknown hepatitis screen Acute HBV or Delayed Anti HBs response after acute
More informationD Candotti. Institut National de la Transfusion Sanguine Dept. Agents Transmissibles par le Sang Paris, France
Molecular characterization of hepatitis B virus strains infecting blood donors with high HBsAg and undetectable HBV DNA levels: implications for blood safety and screening policy D Candotti Institut National
More informationCASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma
CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma Occult HBV Infection: Assessment and Clinical Significance D. Lorne Tyrrell Director, Li Ka Shing Institute of Virology University of Alberta
More informationThe Natural History of Chronic Hepatitis B Virus Infection
The Natural History of Chronic Hepatitis B Virus Infection Brian J. McMahon, M.D. 1 ABSTRACT Three stages of chronic hepatitis B virus (HBV) infection are recognized: the immune tolerant phase, the chronic
More informationThe natural history of chronic HBV infection
Hepatitis B Viral Factors in HBeAg-Negative Carriers with Persistently Normal Serum Alanine Aminotransferase Levels Chih-Lin Lin, 1* Li-Ying Liao, 1* Chun-Jen Liu, 2 Ming-Whei Yu, 3 Pei-Jer Chen, 2,4 Ming-Yang
More informationLiver Disease and Therapy of Hepatitis B Virus Infections
Liver Disease and Therapy of Hepatitis B Virus Infections University of Adelaide Catherine Scougall Arend Grosse Huey-Chi Low Allison Jilbert Fox Chase Cancer Center Chunxiao Xu Carol Aldrich Sam Litwin
More informationDetection of diagnosis escape variants of Hepatitis B virus by in house polymerase chain reaction assay
Journal of General and Molecular Virology Vol.3 (3), pp. 043-048, July 2011 Available online at http://www.academicjournals.org/jgmv ISSN 2141-6648 2011 Academic Journals Full Length Research Paper Detection
More informationPerformance of a New-Generation Chemiluminescent Assay for Hepatitis B Surface Antigen
Clinical Chemistry 52:8 1592 1598 (2006) Other Areas of Clinical Chemistry Performance of a New-Generation Chemiluminescent Assay for Hepatitis B Surface Antigen Dan Chen 1* and Lawrence A. Kaplan 1 Background:
More informationQuantitative HBV DNA measurements and the management of infected health care workers
Quantitative HBV DNA measurements and the management of infected health care workers A.A. van der Eijk Department of Virology, Erasmus MC, Rotterdam, the Netherlands Introduction Worldwide since 1970s,
More informationViral Hepatitis. 2009 APHL survey report
Issues in Brief: viral hepatitis testing Association of Public Health Laboratories May Viral Hepatitis Testing 9 APHL survey report In order to characterize the role that the nation s public health laboratories
More information2015 Outpatient Chronic Hepatitis B Management
2015 Outpatient Chronic Hepatitis B Management Hepatitis B Hepatitis B Info 70% of acute infections are subclinical More severe symptoms when in addition to other liver disease Fulminant Hepatitis
More informationSupplementary Online Content
Supplementary Online Content Huang H, Li X, Zhu J, et al. Entecavir vs lamivudine for prevention of hepatitis B virus reactivation among patients with untreated diffuse large B-cell lymphoma receiving
More informationKnowledge about Post-exposure Prophylaxis for Hepatitis B Virus among Dentists and Dental Students in Pakistan
{189} ORIGINAL RESEARCH Knowledge about Post-exposure Prophylaxis for Hepatitis B Virus among Dentists and Dental Students in Pakistan Zohaib Ahmed 1 Umber Zahra 2 Nasir Saleem 3 1,2 BDS. House Officer.
More informationCo-infected health-care workers
Co-infected health-care workers Y.Yazdanpanah Service Universitaire des Maladies Infectieuses et du Voyageur C.H. Tourcoing, Faculté de Médecine de Lille CNRS U362, Lille, France Co-infected health-care
More informationFull length genome characterisation of Hepatitis B virus isolates at Dr George Mukhari hospital in Pretoria, South Africa. Rindidzani Edith Magobo
Full length genome characterisation of Hepatitis B virus isolates at Dr George Mukhari hospital in Pretoria, South Africa. By Rindidzani Edith Magobo Submitted in fulfilment of the requirement for the
More informationManagement of Chronic Hepatitis B: 2012 Update
Management of Chronic Hepatitis B: 2012 Update Brian J McMahon MD, Liver Disease and Hepatitis Program Alaska Native Medical Center and Arctic Investigations Program, CDC Conflicts of Interest The Liver
More informationJ Clin Oncol 26:177-182. 2008 by American Society of Clinical Oncology INTRODUCTION
VOLUME 26 NUMBER 2 JANUARY 10 2008 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T High Viral Load and Hepatitis B Virus Subgenotype Ce Are Associated With Increased Risk of Hepatocellular Carcinoma
More informationHBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
More informationHepatitis B Virus Variants in Patients with Acute Hepatitis in whom Various Clinical Forms Develop
Hepatitis B Virus Variants in Patients with Acute Hepatitis in whom Various Clinical Forms Develop Kiyotaka FUJISE1), Kenji SUZUKI1), Yoshihiko NAITO1), Minoru NIIYA1), Tomohisa ISHIKAWAI1), Hiroki TAKAHASHI1),
More informationTAQMAN (CAP/CTM) REAL-TIME POLYMERASE CHAIN REACTION ASSAY FOR HEPATITIS B VIRUS DNA QUANTIFICATION
PERFORMANCE OF VERSION 2.0 OF THE COBAS AMPLIPREP/COBAS TAQMAN (CAP/CTM) REAL-TIME POLYMERASE CHAIN REACTION ASSAY FOR HEPATITIS B VIRUS DNA QUANTIFICATION Stéphane Chevaliez, 1,2 * Magali Bouvier-Alias,
More informationMOLECULAR DIAGNOSIS OF HEPATITIS B INFECTION IN THE TRANSFUSIONAL SETTING. Dra. Emma Castro and Dra. Rocío González
MOLECULAR DIAGNOSIS OF HEPATITIS B INFECTION IN THE TRANSFUSIONAL SETTING Dra. Emma Castro and Dra. Rocío González HBV Blood Donor Testing in Spain Mandatory: HBsAg Not mandatory: HBc-Ab; ALT. NAT-HBV
More informationIdentification of T-cell epitopes of SARS-coronavirus for development of peptide-based vaccines and cellular immunity assessment methods
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES PKS Chan 陳 基 湘 S Ma 文 子 光 SM Ngai 倪 世 明 Key Messages 1. Subjects recovered from SARS-CoV infection retain memory of cellular immune response to epitopes
More informationViral Hepatitis Case Report
Page 1 of 9 Viral Hepatitis Case Report Perinatal Hepatitis B Virus Infection Michigan Department of Community Health Communicable Disease Division Investigation Information Investigation ID Onset Date
More informationPATIENTS AND METHODS RESULTS
ORIGINAL ARTICLE SEN Virus Infection in Patients on Maintenance Hemodialysis in Eastern Taiwan Tso-Tsai Liu 1, Hans-Hsienhong Lin 1,2,7, Li-Yu Wang 2,5, Shih-Yen Lo 2,6, Teng-Yi Lin 3, Chi-Tan Hu 1,2,7,
More informationLIAISON XL HBsAg Quant
Hepatitis and Retrovirus LIAISON XL HBsAg Quant Reliable detection of HBsAg mutants and genotypes for accurate differential diagnosis of the stage of infection FOR OUTSIDE THE US AND CANADA ONLY LIAISON
More informationNS5B Sequencing and Phenotypic Resistance Assays for HCV Subtypes 1a and 1b
NS5B Sequencing and Phenotypic Resistance Assays for HCV Subtypes 1a and 1b 5th Intl. Workshop on Hepatitis C Resistance & New Compounds Jacqueline Reeves NS5B Resistance Assays for HCV Subtypes 1a and
More information2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
More informationA white paper for consideration by the NIAID Microbial Sequencing Program
Hepatitis C Virus Sequencing: Viral evolution, immune recognition and vaccine development. A white paper for consideration by the NIAID Microbial Sequencing Program Todd M. Allen, Ph.D. Assistant Professor
More informationChronic hepatitis B (CHB) remains an important public SPECIAL REPORT
CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2008;6:1315 1341 SPECIAL REPORT A Treatment Algorithm for the Management of Chronic Hepatitis B Virus Infection in the United States: 2008 Update EMMET B. KEEFFE,*
More informationHepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
More informationof HBsAg beyond six months after acute infection is accepted as evidence of chronic infection 5.
Bangladesh Med Res Counc Bull 2008; 34: 39-43 Copyright 2008 by Bangladesh Medical Research Council HBeAg/anti-HBe, alanine aminotransferase and HBV DNA levels in HBsAg positive chronic carriers Fareha
More informationThe availability of newer antiviral agents, as
TREATMENT OF HEPATITIS B VIRUS INFECTION * Norman L. Sussman, MD ABSTRACT In treating chronic hepatitis B virus (HBV) infection, the primary goal of therapy is to achieve sustained suppression of HBV replication,
More informationMedical publications on HBV and HCV Coinfection
Recent advances of HBV and HCV co-infection 台 中 榮 總 內 科 部 胃 腸 肝 膽 科 呂 宜 達 醫 師 2013.03.28 Outline Epidemiology of HBV and HCV coinfection Clinical significance of HBV and HCV coinfection Interplay between
More informationKaohsiung Medical University; 5 Department of Occupational and Environmental Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan.
COMPARISON OF CLINICAL APPLICATION OF THE ABBOTT HBV PCR KIT AND THE VERSANT HBV DNA 3.0 TEST TO MEASURE SERUM HEPATITIS B VIRUS DNA IN TAIWANESE PATIENTS Jeng-Fu Yang, 1,2 Ya-Yun Lin, 1 Jee-Fu Huang,
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationPURPOSE: To define the criteria to be used to determine the medical necessity of antiviral therapy in the treatment of Chronic Hepatitis B.
COVENTRY Health Care Guidelines for Hepatitis B Therapy SUBJECT: Chronic Hepatitis B Therapy: a. Interferons - Intron A (interferon alfa-2b) and Pegasys (peginterferon alfa-2a) b. Nucleoside analogues
More informationHBsAg level and hepatitis B viral load correlation with focus on pregnancy
ORIGINAL ARTICLE Annals of Gastroenterology (2015) 28, 1-6 HBsAg level and hepatitis B viral load correlation with focus on pregnancy Maria Belopolskaya a, Viktor Avrutin b, Sergey Firsov a, Alexey Yakovlev
More informationProspects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS
Prospects for Vaccines against Hepatitis C Viruses T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS HCV Vaccine Prevention strategies Protective immunity Barriers and solutions Vaccine candidates
More informationVLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
More informationQuickTiter Hepatitis B Surface Antigen (HBsAg) ELISA Kit
Product Manual QuickTiter Hepatitis B Surface Antigen (HBsAg) ELISA Kit Catalog Numbers VPK-5004 VPK-5004-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction
More informationGenolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
More informationWhen an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII)
XI. OCCUPATIONAL EXPOSURES TO HEPATITIS B AND C RECOMMENDATION: When an occupational exposure occurs, the source patient should be evaluated for both hepatitis B and hepatitis C. (AII) The risk of transmission
More informationThe role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015
The role of IBV proteins in protection: cellular immune responses COST meeting WG2 + WG3 Budapest, Hungary, 2015 1 Presentation include: Laboratory results Literature summary Role of T cells in response
More informationHepatitis C Monitoring and Complications (and Treatment!) Dr Mark Douglas
Hepatitis C Monitoring and Complications (and Treatment!) Dr Mark Douglas Hepatitis C Virus Shimizu et al., 1996 Positive single strand RNA virus Flaviviridae family, Hepacivirus genus 9.6 kbp genome ~3000
More informationLong-term Results of Pegylated Interferon alfa-2a and Tenofovir for Hepatitis B
Long-term Results of Pegylated Interferon alfa-2a and Tenofovir for Hepatitis B Patrick Marcellin Viral Hepatitis Research Center Hôpital Beaujon, University of Paris France OBJECTIVES OF THERAPY IN CHRONIC
More informationHBV screening and management in HIV-infected children and adolescents
HBV screening and management in HIV-infected children and adolescents Linda Aurpibul M.D. Research Institute for Health Sciences, Chiang Mai University 8% HIV and Hepatitis B Co-infection Among Perinatally
More informationCase Finding for Hepatitis B and Hepatitis C
Case Finding for Hepatitis B and Hepatitis C John W. Ward, M.D. Division of Viral Hepatitis Centers for Disease Control and Prevention Atlanta, Georgia, USA Division of Viral Hepatitis National Center
More informationRealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
More informationData Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
More informationReal Time PCR Usage in the Quantification of Hepatitis B Virus DNA-Clinical Applications in Disease Management
Review Article Real Time PCR Usage in the Quantification of Hepatitis B Virus DNA-Clinical Applications in Disease Management *Narotam Sharma 1, Jagdish Kandpal 1, Satish C Nautiyal 1, Shweta Rawat 2,
More informationOptimising therapy in chronic hepatitis B: Switch or add treatment
Optimising therapy in chronic hepatitis B: Switch or add treatment Teerha Piratvisuth NKC Institute of Gastroenterology and Hepatology Prince of Songkla University,Thailand NA + NA Percent with resistance
More informationA SNaPshot assay for the rapid and simple detection of hepatitis B virus genotypes
MOLEULR MEIINE REPORTS 10: 1245-1251, 2014 SNaPshot assay for the rapid and simple detection of hepatitis virus genotypes GUOQI LI 1,2*, WENLU ZHNG 2*, HONG TNG 2, TINGTING ZHO 1, LIWEN WEI 2, YING TO
More informationOffering Testing for Hepatitis B and C in Primary Care
Offering Testing for Hepatitis B and C in Primary Care Presentation 3 January 2014 Quality Education for a Healthier Scotland 1 Learning Outcomes Participants will be able to:- Undertake a pre-test discussion
More informationComparison of the AdvanSure HBV Real-time PCR Test with Three Other HBV DNA Quantification Assays
230 Available online at www.annclinlabsci.org Annals of Clinical & Laboratory Science, vol. 43, no. 2, 2013 Comparison of the AdvanSure HBV Real-time PCR Test with Three Other HBV DNA Quantification Assays
More informationPhase: IV. Study Period: 20 Jan. 2006-17 Sep. 2008
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More informationNew HLA class I epitopes defined by murine monoclonal antibodies
Human Immunology 71 (2010) 456 461 Contents lists available at ScienceDirect New HLA class I epitopes defined by murine monoclonal antibodies Nadim El-Awar a, *, Paul I. Terasaki b, Anh Nguyen a, Mamie
More informationEPIDEMIOLOGY OF HEPATITIS B IN IRELAND
EPIDEMIOLOGY OF HEPATITIS B IN IRELAND Table of Contents Acknowledgements 3 Summary 4 Introduction 5 Case Definitions 6 Materials and Methods 7 Results 8 Discussion 11 References 12 Epidemiology of Hepatitis
More informationHepatitis B Virus Genotyping Among Chronic Hepatitis B Individuals With Resistance to Lamivudine in Shahrekord, Iran
Jundishapur J Microbiol. 2014 April; 7(4): e196. Published online 2014 April 1. DOI:.812/jjm.196 Research Article Hepatitis B Virus Genotyping Among Chronic Hepatitis B Individuals With Resistance to Lamivudine
More informationAbout Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR
About Our Products Purified Infectious/Inactivated Agents ABI produces a variety of specialized reagents, allowing researchers to choose the best preparations for their studies. Available reagents include
More informationEfficacy of Prophylactic Entecavir for Hepatitis B Virus- Related Hepatocellular Carcinoma Receiving Transcatheter Arterial Chemoembolization
DOI:http://dx.doi.org/10.7314/APJCP.2015.16.18.8659 Efficacy of Prophylactic Entecavir for Hepatitis B Virus Related HCC Receiving Transcatheter Arterial Chemoembolization RESEARCH ARTICLE Efficacy of
More informationHepatitis C. Laboratory Tests and Hepatitis C
Hepatitis C Laboratory Tests and Hepatitis C If you have hepatitis C, your doctor will use laboratory tests to check your health. This handout will help you understand what the major tests are and what
More informationBEIPH Final Report. QCMD 2010 Hepatitis B Virus DNA (HBVDNA10A) EQA Programme. William G MacKay on behalf of QCMD and its Scientific Council July 2010
QUALITY CONTROL for MOLECULAR DIAGNOSTICS The Altum Building, Todd Campus, West of Scotland Science Park, Glasgow, G20 0XA Scotland Tel: +44 (0) 141 945 6474 Fax: +44 (0) 141 945 5795 www.qcmd.org info@qcmd.org
More informationHepatitis B Virus DNA Levels and Outcomes in Chronic Hepatitis B
Hepatitis B Virus DNA Levels and Outcomes in Chronic Hepatitis B Chien-Jen Chen, 1,2 Hwai-I Yang, 1 and Uchenna H. Iloeje 3 for The REVEAL-HBV Study Group 4 Serum hepatitis B virus (HBV) DNA levels can
More informationTreatment of Acute Hepatitis C
Management of Patients with Viral Hepatitis, Paris, 2004 Treatment of Acute Hepatitis C Michael P. Manns, Andrej Potthoff, Elmar Jaeckel, Heiner Wedemeyer Hepatitis C Virus (HCV) infection is a common
More informationHEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis
HEPATITIS WEB STUDY Acute C Virus Infection: Epidemiology, Clinical Features, and Diagnosis H. Nina Kim, MD Assistant Professor of Medicine Division of Infectious Diseases University of Washington School
More informationTG1050, A NOVEL IMMUNOTHERAPEUTIC TO TREAT CHRONIC HEPATITIS B, CAN CONTROL HBsAg AND PROVOKE HBsAg SEROCONVERSION IN HBV-PERSISTENT MOUSE MODELS
TG1050, A NOVEL IMMUNOTHERAPEUTIC TO TREAT CHRONIC HEPATITIS B, CAN CONTROL HBsAg AND PROVOKE HBsAg SEROCONVERSION IN HBV-PERSISTENT MOUSE MODELS Karine Lélu 1, Alexei Evlachev 1, Roland Kratzer 1, Sarah
More informationHepatitis B virus surface protein mutations clustered mainly in CTL immune epitopes in chronic carriers: results of an Iranian nationwide study
Journal of Viral Hepatitis, 2013, 20, 494 501 doi:10.1111/jvh.12045 Hepatitis B virus surface protein mutations clustered mainly in CTL immune epitopes in chronic carriers: results of an Iranian nationwide
More informationHepatitis B reactivation. Geoffrey Dusheiko UCL Institute for Liver and Digestive Health Royal Free Hospital London, UK
Hepatitis B reactivation Geoffrey Dusheiko UCL Institute for Liver and Digestive Health Royal Free Hospital London, UK HBV reactivation Defined as abrupt rise in HBV replication (> 1 log) Followed by lab
More informationBeginner's guide to Hepatitis C testing and immunisation against hepatitis A+B in general practice
Beginner's guide to Hepatitis C testing and immunisation against hepatitis A+B in general practice Dr Chris Ford GP & SMMGP Clinical Lead Kate Halliday Telford & Wrekin Shared Care Coordinator Aims Discuss:
More informationAcute viral hepatitis B (AVH-B) is successfully. A Randomized Controlled Trial of Lamivudine to Treat Acute Hepatitis B. Patients and Methods
A Randomized Controlled Trial of Lamivudine to Treat Acute Hepatitis B M. Kumar, S. Satapathy, R. Monga, K. Das, S. Hissar, C. Pande, B. C. Sharma, and S. K. Sarin The role of antivirals in patients with
More informationHepatitis C Glossary of Terms
Acute Hepatitis C A short-term illness that usually occurs within the first six months after someone is exposed to the hepatitis C virus (HCV). 1 Antibodies Proteins produced as part of the body s immune
More information2011 Update on the ECIL-3 guidelines for EBV management in patients with leukemia and other hematological disorders
UPDATE ECIL-4 2011 2011 Update on the ECIL-3 guidelines for EBV management in patients with leukemia and other hematological disorders Jan Styczynski, Hermann Einsele, Rafael de la Camara, Catherine Cordonnier,
More informationHepatitis B and C Co-infection. Mark Hull MHSc, FRCPC Clinical Assistant Professor Division of AIDS
Hepatitis B and C Co-infection Mark Hull MHSc, FRCPC Clinical Assistant Professor Division of AIDS Objectives Review natural history of hepatitis coinfection Brief overview of treatment indications for
More informationDetection of HBV DNA in Serum Using a PCR-Based Assay
2 Detection of HBV DNA in Serum Using a PCR-Based Assay Hau Tim Chung 1. Introduction Detection of minute amounts of hepatitis B virus (HBV) DNA in the serum using polymerase chain reaction (PCR) based
More informationHepatitis C Vaccines: Are we making progress?
Hepatitis C Vaccines: Are we making progress? Second International Hepatitis Cure and Eradication Meeting. Vancouver November, 2015 Objectives: Review the need for a preventive vaccine in 2015. Identify
More information02/08/2010. 1. Background. Outline
Identification of immunodominant T-cell eptitopes in matrix protein of highly pathogenic porcine reproductive and respiratory syndrome virus Ya-Xin Wang, PhD Student Outline 1. Background 2. Research Contents
More informationTreatment of Hepatitis B
Treatment of Hepatitis B Paul Y Kwo, MD Professor of Medicine Gastroenterology/Hepatology Division Medical Director, Liver Transplantation Indiana University Health Indiana University School of Medicine
More informationHIV and Hepatitis B CoInfection
HIV and Hepatitis B CoInfection Douglas G. Fish, MD June 3, 2014 44 yo male with AIDS who had fallen out of care and returned in October 2013 Last seen in November 2012 CD4 at that time 340 cells/cmm HIV
More informationREVIEW HEPATITIS B AND HEPATITIS C VIRUS IN THAI BLOOD DONORS
REVIEW HEPATITIS B AND HEPATITIS C VIRUS IN THAI BLOOD DONORS Nitinan Chimparlee 1, Sineenart Oota 2, Soisaang Phikulsod 2, Pisit Tangkijvanich 3 and Yong Poovorawan 1 1 Center of Excellence in Clinical
More informationROYAL HOSPITAL FOR WOMEN
HEPATITIS B POSITIVE MOTHERS AND THEIR BABIES This LOP is developed to guide clinical practice at the Royal Hospital for Women. Individual patient circumstances may mean that practice diverges from this
More informationPERINATAL AND CHILDHOOD HEPATITIS.. WHAT ABOUT THE CHILDREN?
PERINATAL AND CHILDHOOD HEPATITIS.. WHAT ABOUT THE CHILDREN? John T. Stutts, MD, MPH University of Louisville School of Medicine Department of Pediatrics Division of Pediatric Gastroenterology, Hepatology
More informationDosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI. Ombretta Turriziani Dipartimento di Medicina Molecolare
Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI Ombretta Turriziani Dipartimento di Medicina Molecolare Dosaggi Sierologici e Molecolari nelle Epatiti B e C Molecular Methods Key
More informationTreatment Strategies of Hepatitis B in China
Treatment Strategies of Hepatitis B in China Guangbi Yao MD Shanghai Jing-An Qu Central Hospital 200040 Characteristic features of CHB in China Huge amount of patients Infection during early life Maternal
More informationINTERPRETATION INFORMATION SHEET
Creative Testing Solutions 2424 West Erie Dr. 2205 Highway 121 10100 Martin Luther King Jr. St. No. Tempe, AZ 85282 Bedford, TX 76021 St. Petersburg, FL 33716 INTERPRETATION INFORMATION SHEET Human Immunodeficiency
More informationAASLD PRACTICE GUIDELINES Chronic Hepatitis B
AASLD PRACTICE GUIDELINES Chronic Hepatitis B Anna S. F. Lok 1 and Brian J. McMahon 2 This guideline has been approved by the American Association for the Study of Liver Diseases and represents the position
More informationDIAGNOSIS AND MANAGEMENT OF OCCULT HEPATITIS B VIRUS INFECTION: A SHORT REVIEW
DIAGNOSIS AND MANAGEMENT OF OCCULT HEPATITIS B VIRUS INFECTION: A SHORT REVIEW Javier Martínez González, *José Luis Lledó Navarro, Enrique Rodríguez de Santiago, Agustín Albillos Martínez Gastroenterology
More informationViral Safety of Plasma-Derived Products
Viral Safety of Plasma-Derived Products SLIDE 1 This presentation will cover viral validation studies for plasma-derived products. FDA requires that the manufacturing process for biopharmaceutical products
More informationAASLD PRACTICE GUIDELINES Chronic Hepatitis B: Update 2009
AASLD PRACTICE GUIDELINES Chronic Hepatitis B: Update 2009 Anna S. F. Lok 1 and Brian J. McMahon 2 This guideline has been approved by the American Association for the Study of Liver Diseases and represents
More informationA comparison of molecular methods for hepatitis B virus (HBV) DNA detection from oral fluid samples
Journal of Medical Microbiology (2012), 61, 844 851 DOI 10.1099/jmm.0.040238-0 A comparison of molecular methods for hepatitis B virus (HBV) DNA detection from oral fluid samples Moyra Machado Portilho,
More information(EMEA/CHMP/BWP/298390/2005)
9 February 2006 Reference: EMEA 06004 PPTA s comments on the proposed Guidelines on Validation of immunoassays for the detection of Hepatitis B Virus surface antigen (HBsAg) (EMEA/CHMP/BWP/298390/2005)
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationPNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
More informationIKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex
More informationBloodborne Pathogens (HIV, HBV, and HCV) Exposure Management
Bloodborne Pathogens Exposure Policy and Procedures Employees of the State of South Dakota Department of Health Bloodborne Pathogens (HIV, HBV, and HCV) Exposure Management PEP Hotline 1-888-448-4911 DOH
More informationLessons from the Stanford HIV Drug Resistance Database
1 Lessons from the Stanford HIV Drug Resistance Database Bob Shafer, MD Department of Medicine and by Courtesy Pathology (Infectious Diseases) Stanford University Outline 2 Goals and rationale for HIVDB
More informationIndian J Med Res 141, May 2015, pp 653-661. Haimanti Bhattacharya *, Debdutta Bhattacharya *,**, S.R. Ghosal *, Subarna Roy *,** & A.P.
Indian J Med Res 141, May 2015, pp 653-661 Status of hepatitis B infection - a decade after hepatitis B vaccination of susceptible Nicobarese, an indigenous tribe of Andaman & Nicobar (A&N) islands with
More informationApplication Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
More informationTypes, production of antibodies and Antibody/antigen interaction
Types, production of antibodies and Antibody/antigen interaction Antibodies Secreted by B lymphocytes Great diversity and specificity: >109 different antibodies; can distinguish between very similar molecules
More informationChapter 18: Applications of Immunology
Chapter 18: Applications of Immunology 1. Vaccinations 2. Monoclonal vs Polyclonal Ab 3. Diagnostic Immunology 1. Vaccinations What is Vaccination? A method of inducing artificial immunity by exposing
More information