J Clin Oncol 26: by American Society of Clinical Oncology INTRODUCTION

Save this PDF as:

Size: px
Start display at page:

Download "J Clin Oncol 26:177-182. 2008 by American Society of Clinical Oncology INTRODUCTION"


1 VOLUME 26 NUMBER 2 JANUARY JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T High Viral Load and Hepatitis B Virus Subgenotype Ce Are Associated With Increased Risk of Hepatocellular Carcinoma Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Jane Koh, Vincent Wai-Sun Wong, Grace Lai-Hung Wong, Stephen Lam Chan, Winnie Yeo, Joseph Jao-Yiu Sung, and Tony Shu-Kam Mok From the Department of Medicine and Therapeutics, Institute of Digestive Disease; and the Department of Clinical Oncology, The Chinese University of Hong Kong, Shatin, Hong Kong. Submitted July 9, 2007; accepted October 5, Supported by Michael Kadoorie Cancer Genetics Research Programme and Research Fund for the Control of Infectious Diseases (RFCID; application number ; H.L.-Y.C); and Hong Kong Cancer Fund. Authors disclosures of potential conflicts of interest and author contributions are found at the end of this article. Corresponding author: Tony S.-K. Mok, MD, Department of Clinical Oncology, Sir YK Pao Center for Cancer, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, Hong Kong; or 2008 by American Society of Clinical Oncology X/08/ /$20.00 DOI: /JCO A B S T R A C T Purpose We aimed to investigate the impact of hepatitis B virus (HBV) DNA and HBV genotypes/ subgenotypes on the risk of hepatocellular carcinoma (HCC). Patients and Methods A prospective cohort of patients infected with chronic HBV in a surveillance program for HCC since 1997 was studied. Ultrasound and alpha-fetoprotein evaluation were regularly performed to detect HCC. Risk factors for HCC and the relationship between HBV DNA and HBV genotypes were determined. Results Among 1,006 patients with a median follow-up of 7.7 years, 86 patients (8.5%) developed HCC. With reference to the low HBV DNA stratum (log HBV DNA 4.5 copies/ml), the hazard ratio for HCC of the intermediate HBV DNA stratum (log HBV DNA 4.5 to 6.5 copies/ml) was 1.62 (95% CI, 1.05 to 2.48; P.027) and that of the high HBV DNA stratum (log HBV DNA 6.5 copies/ml) was 2.73 (95% CI, 1.76 to 4.25; P.001). Among patients with genotyping results, 330 patients had HBV genotype B and 439 patients had HBV genotype C (94 subgenotype Ce and 345 subgenotype Cs). With reference to HBV genotype B, HBV subgenotype Ce has the highest risk of HCC (hazard ratio 2.75; 95% CI, 1.66 to 4.56; P.0001) and HBV subgenotype Cs has intermediate risk (hazard ratio 1.70; 95% CI, 1.09 to 2.64; P.020). On multivariate analysis, HBV DNA, HBV genotypes, liver cirrhosis, male sex, older age, and lower serum albumin were independent risk factors of HCC. Conclusion High HBV DNA level and HBV genotype C, particularly subgenotype Ce, increased the risk of HCC in chronic hepatitis B. J Clin Oncol 26: by American Society of Clinical Oncology INTRODUCTION Chronic hepatitis B virus (HBV) infection is the most common cause of hepatocellular carcinoma (HCC) in Asia. 1 To reduce the mortality related to HCC, regular surveillance with abdominal ultrasonography and alpha-fetoprotein evaluation is needed to detect early and operable HCC. 2,3 With the huge demand of HCC surveillance in Asian countries, where the prevalence of HBV infection is high, risk stratification of patients is important to guide resource allocation. Older age, male sex, and liver cirrhosis are well recognized factors associated with increased risk of HCC. 4 Recent large-scale population-based studies have shown that patients with higher HBV DNA levels tend to have higher risk of HCC in the subsequent years of follow-up. 5,6 In Asia, HBV genotype C infection is associated with a higher risk of HCC compared with HBV genotype B infection. 7,8 A case control study in Taiwanese men suggested that HBV genotypes and HBV DNA might have independent effects on increasing the risk of HCC. 9 Confirmatory data on the female sex is lacking. Subgenotypes of HBV genotypes B (Ba and Bj) and C (Ce and Cs) have been identified on the basis of 4% to 8% heterogeneity of the entire HBV genome. 10,11 These HBV subgenotypes may have different clinical and virologic characteristics. 12,13 In a previous case controlled study including 172 patients from Japan and 156 patients from Hong Kong infected by HBV genotype C, HBV subgenotype Ce (v Cs) was found to be an independent risk factor of HCC in addition to male sex, older age, and positive hepatitis B e antigen (HBeAg) status. 14 The study was limited by the potential confounding effect of patient ethnicity because majority (82%) of patients 177

2 Chan et al infected by HBV genotype Ce were recruited in Japan, whereas all patients infected by HBV subgenotype Cs were recruited in Hong Kong. Moreover, the status of liver cirrhosis, which may be the most important risk factor for HCC, was not evaluated. Therefore, we aimed to investigate the independent impact of HBV DNA and HBV genotypes/subgenotypes on the risk of HCC based on the follow-up of a large cohort of Chinese chronic hepatitis B patients in a HCC surveillance program. PATIENTS AND METHODS Patients This study was based on a prospective cohort of chronic hepatitis B patients recruited from the Hepatology Clinic, Prince of Wales Hospital (Shatin, Hong Kong) from October 1997 to November The study was approved by the Clinical Research Ethics Committee of the Chinese University of Hong Kong, and written informed consent was obtained from all patients before entry into the program. The Hepatology Clinic received referrals from community screening programs as well as family doctors and specialists, with a catchments area of approximately one sixth of the Hong Kong population. 16 At the time of recruitment, all patients were age 40 to 70 with life expectancy of more than 2 years. Regular abdominal ultrasound examination was performed and serum alpha-fetoprotein levels monitored every 6 months in the initial 2 years, and patients underwent intensive surveillance with lipiodol computed tomography and/or liver biopsy if there was any suspicious abnormality on ultrasound or the alpha-fetoprotein level was greater than 20 g/l. 15 After the initial 2 years, patients were followed up every 6 months, or more frequently if clinically indicated, with monitoring of liver biochemistry as well as alphafetoprotein levels in the Hepatology Clinic. Ultrasound abdomen and other investigations including computed tomography, hepatic angiogram and/or liver biopsy would be performed whenever alpha-fetoprotein level was on a rising trend greater than 20 g/l to confirm the diagnosis of HCC. 8 For patients with normal alpha-fetoprotein levels, ultrasound abdomen was performed every 1 to 2 years. Laboratory Tests Residual serum samples were stored in a 80 C freezer. HBV DNA and genotyping were performed in the initial serum sample at patient enrollment. HBV DNA was extracted by QIAamp DNA Mini Kit (Qiagen Inc, Chatsworth, CA) according to manufacturer instructions. HBV DNA HBV DNA was quantified by TaqMan real-time polymerase chain reaction (PCR) assay as described previously (Applied Biosystems, Foster City, CA). 17,18 This assay was standardized by serial dilution of EuroHEP ( genotype D HBV standard, which contained viral copies/ml. The range of HBV DNA detection was 10 2 to 10 9 copies/ml with correlation coefficient of the standard curve routinely greater than HBV Genotyping Five microliters of extracted HBV DNA was amplified by the PicoMaxx High Fidelity PCR (polymerase chain reaction) System (Stratagene, La Jolla, CA) using primers 5 TTTTTCACCTCTGCCTAATCA3 (sense ) and 5 AAAAAGTTGCATGGTGCTGG3 (antisense ). PCR amplification was conducted with initial denaturation at 94 C for 3 minutes, followed by 40 cycles of amplification (94 C for 1 minute, 60 C for 30 second and 72 C for 4 minutes) and final extension at 72 C for 7 minutes. PCR products were purified using ExoSAP-IT (USB, Cleveland, OH) following the manufacturer s protocol. The purified PCR products at the S gene were directly sequenced on ABI PRISM 3100 Genetic Analyzer using BigDye Terminator 3.1 cycle sequencing kit (Applied Biosystems). The HBV sequences were submitted to the comparative sequence program BLAST ( blast/) for searching other sequences with the highest degree of similarity to identify the genotype. The distance tree was calculated based on pairwise alignment on the BLAST server. Statistical Analysis Statistical analysis was performed by SAS version 8.2 (SAS Institute, Cary, NC). Continuous variables were expressed as mean with standard deviation or median with range as appropriate. Baseline continuous variables were compared by t test or Mann-Whitney U test as appropriate, and categoric variables were compared by 2 test. Time to HCC diagnosis was defined as the date of recruitment from screening project to the date of HCC diagnosis or excluded at the date of last follow-up if patients were still alive without disease at the time of analysis. The database was frozen in August We used the Cox proportional hazards model to determine the relationship of HBV DNA, HBV genotypes and other clinical variables with the development of HCC. Stepwise multivariate analysis was performed to determine the independent risk factors associated with HCC among factors with P value less than.05 on univariate analysis. All statistical tests were two sided, and P values less than.05 were considered statistically significant. RESULTS Patients One thousand six patients had residual serum samples for HBV DNA measurement. After a median follow-up of 4.3 years, we last reported 56 cases of HCC. 15 Now, after a median follow-up of 7.7 (95% CI, 7.6 to 7.8) years, an additional of 30 patients (total 86 patients, 8.5%) developed HCC. The clinical characteristics of patients at baseline were shown in Table 1. Majority of patients had compensated liver disease with unremarkable serum bilirubin, serum albumin, and clotting profile. Eight hundred fifty-one patients (84.6%) had ALT levels below 1.5 the upper limit of normal (ULN), and the mean log HBV DNA was copies/ml. During the follow-up period, 144 patients (14.3%) have received nucleoside/nucleotide analogs, six (0.6%) have received interferon alfa, and two (0.2%) patients have received both modalities as antiviral treatment. HBV DNA and HCC Higher HBV DNA was associated with increased risk of HCC. The hazard ratio of each log step increase in HBV DNA was 1.38 (95% CI, 1.23 to 1.55; P.0001). On univariate analysis, older age, male sex, elevated ALT, low serum albumin, presence of ascites, ultrasonic features of liver cirrhosis, use of antiviral treatment and high HBV DNA were associated with increased risk of HCC (Table 1). When we divided the patients into three strata, 500 patients had low HBV DNA (log HBV DNA 4.5 copies/ml), 313 patients had intermediate HBV DNA (log HBV DNA 4.5 to 6.5 copies/ml), and 193 patients had high HBV DNA (log HBV DNA 6.5 copies/ml). During the follow-up period, 19 (3.8%), 36 (11.5%), and 31 (16.1%) patients developed HCC among patients in the low HBV DNA, intermediate HBV DNA, and high HBV DNA strata, respectively (Fig 1). With reference to the low HBV DNA stratum, the hazard ratio for HCC of the intermediate HBV DNA stratum was 1.62 (95% CI, 1.05 to 2.48; P.027), and that of the high HBV DNA stratum was 2.73 (95% CI, 1.76 to 4.25; P.001). On multivariate analysis, higher HBV DNA stratum remained an independent risk factor associated with HCC with a hazard ratio of 2.01 (95% CI, 1.49 to 2.71; Table 2). Presence of liver cirrhosis was the most important risk factor associated with HCC. Other independent factors of HCC included low serum albumin, older age, and male sex. HBV Genotypes and HCC Seven hundred seventy (77%) patients had positive PCR for HBV genotyping. One patient had genotype A HBV, 330 patients 178 JOURNAL OF CLINICAL ONCOLOGY

3 HBV DNA, genotypes and HCC Table 1. Clinical Characteristics of Patients at Baseline. Total (n 1006) HCC (n 86) Non-HCC (n 920) Variable No. % No. % No. % Hazard Ratio 95% CI P Male sex to Age, years to Bilirubin 2 ULN to Alanine aminotransferase to x ULN Albumin normal to INR 4 sec prolonged Ascites to Encephalopathy Ultrasonic feature of cirrhosis to Log HBV DNA (copies/ml) to Antiviral treatment to NOTE. The Cox proportional hazards model was used to determine the hazard ratio of different factors for HCC at baseline. Abbreviations: HCC, hepatocellular carcinoma; ULN, upper limit of normal; INR, international normalized ratio; HBV, hepatitis B virus. (42%) had HBV genotype B (all belonged to subgenotype Ba), and 439 patients (57%) had HBV genotype C (94 subgenotype Ce and 345 subgenotype Cs). Only patients infected by genotypes B and C HBV were included in the subsequent analysis. The clinical characteristics of 769 patients infected by genotype B and C HBV were shown in Table 3. Compared with patients infected by HBV genotype B, a larger proportion of patients infected by HBV genotype C were female; had elevated ALT levels, lower serum albumin, and ultrasonic features of liver cirrhosis; and received antiviral treatment. Patients infected by HBV genotype C also had higher HBV DNA levels than did those infected by HBV genotype B. Comparing patients infected by the two HBV subgenotypes C, patients infected by HBV subgenotype Ce were older, had lower albumin levels, and had a higher proportion of antiviral treatment (Table 3). HBV genotype C was associated with a higher risk of HCC than HBV genotype B (hazard ratio 3.83; 95% CI, 2.15 to 6.81; P.0001). With referent to HBV genotype B, HBV subgenotype Ce has the highest risk of HCC (hazard ratio 2.75; 95% CI, 1.66 to 4.56; P.0001) and HBV subgenotype Cs has the intermediate risk (hazard ratio 1.70; 95% CI, 1.09 to 2.64; P.020; Fig 2). Patients infected by HBV subgenotype Ce also had significantly higher risk of developing HCC than did those infected by HBV subgenotype Cs (hazard ratio 1.78; 95% CI, 1.06 to 3.02; P.031). On multivariate analysis of the 769 patients with available genotyping results, HBV genotype and HBV DNA strata were independent risk factors for HCC (Table 2). Other risk factors of HCC remained liver cirrhosis, low serum albumin, older age, and male sex. Using HBV genotype B and low HBV DNA stratum as the reference, patients infected by HBV genotype Cs with intermediate and high HBV DNA strata had increased risk of HCC, and patients infected by HBV genotype Ce had the highest risk of HCC (Table 4). Among patients infected by HBV subgenotypes Cs and Ce, the risk of HCC was higher among those with high HBV DNA stratum than those with intermediate HBV DNA stratum. DISCUSSION In this large longitudinal cohort of chronic hepatitis B patients followed up for more than 7 years, we have demonstrated that higher serum HBV DNA level at enrollment into the screening program was associated with increased risk of HCC, and this effect was independent of the presence of liver cirrhosis as well as other demographic characteristics. HBV genotype C, particularly subgenotype Ce, was associated with higher risk of HCC than was HBV genotype B. Patients who Table 2. Multivariate Analysis of Factors Associated With Hepatocellular Carcinoma in All Patients and Patients With HBV Genotyping Results Available All Patients (n 1,006) Patients With HBV Genotyping Results Available (n 769) Variable Hazard Ratio 95% CI P Hazard Ratio 95% CI P Cirrhosis on ultrasound to to Albumin normal to to HBV DNA to to Male sex to to Age to to HBV genotyper to Abbreviation: HBV, hepatitis B virus. HBV DNA was divided into three strata ( 4.5, 4.5 to 6.5, and 6.5 logs). HBV genotypes was divided to B, Cs, and Ce

4 Chan et al Proportion of Patients Without HCC log HBVDNA 4.5 log HBVDNA log HBVDNA > Time to Diagnosis of HCC (years) No. of patients at risk log HBVDNA log HBVDNA log HBVDNA > Fig 1. Cumulative probability of hepatocellular carcinoma (HCC) among patients in the three hepatitis B virus (HBV) DNA strata. Proportion of Patients Without HCC Genotype B Genotype Cs Genotype Ce Time to Diagnosis of HCC (years) No. of patients at risk Genotype B Genotype Cs Genotype Ce Fig 2. Cumulative probability of hepatocellular carcinoma (HCC) among patients infected by different hepatitis B virus genotypes/subgenotypes. were infected by HBV genotype C with high HBV DNA ( 6.5 logs copies/ml) had the highest risk of developing HCC. HBV DNA has become the most important clinical criterion for the decision of antiviral treatment in chronic hepatitis B. The latest US guidelines recommend for treatment HBV DNA greater than 6 log copies/ml in patients with chronic active hepatitis and even lower HBV DNA levels among patients with liver cirrhosis. 4,19 Because the ultimate goal of treatment is to reduce HBV-related complications, including HCC, evidence on the association of higher HBV DNA and risk of HCC is important to support these guidelines. In line with the findings of previous large-scald population-based studies in Taiwan and Haimen, HBV DNA greater than 4 to 5 logs was associated with higher risks of HCC and mortality regardless of the ALT levels. 5,6 Although HBV DNA may fluctuate with time, a single high HBV DNA can already predict a higher future risk of HCC. Patients who have persistently high HBV DNA are expected to have the highest cancer risk. 5 Our study population was composed of higher-risk patients followed up in a hospital clinic. One of the major strengths of our study was the availability of more detailed assessment of the liver function and the cirrhotic status at patient entry. In fact, ultrasonic evidence of liver cirrhosis stood out as the most important risk factor of HCC in our patient cohort. Although ultrasound might have bias to diagnose liver cirrhosis compared with liver biopsy, it tends to underestimate rather than overestimate. 20 Low serum albumin, which reflected more advanced liver cirrhosis, was also found to be an independent risk factor of HCC. Previously, we have also shown that low serum albumin is an important predictor of mortality among patients with HBV-related liver cirrhosis. 21 Therefore, our study has provided supporting evidence that higher HBV DNA is an independent risk factor of HCC in addition to liver cirrhosis. In our cohort, only 15.6% of patients had ALT levels higher than 1.5 ULN. Although higher ALT was associated with HCC on univariate analysis, the proportion of patients who had ALT greater than 1.5 ULN and subsequently developed HCC was only 25.6%. This finding concurs with previous observations that high ALT level is not a prerequisite for liver-related complications, including HCC. 5 In chronic hepatitis B, low ALT levels cannot be equated to mild liver histology. In 652 patients recruited in a therapeutic trial with ALT less HBV Genotype Table 3. Clinical Characteristics of 769 Patients Infected by Genotype B and C HBV Total (n 769) B (n 330) C (n 439) Ce (n 94) Cs (n 345) No. % No. % No. % No. % No. % P for B v C P for Ce v CS Sex ratio (M:F) 534: :96 290:149 59:35 231: Age, years Bilirubin 2x ULN ALT 1.5x ULN Albumin normal INR 4 sec prolonged Ascites Encephalopathy Ultrasonic feature of cirrhosis Log HBV DNA (copies/ml) Antiviral treatment Abbreviations: HCC, hepatocellular carcinoma; ULN, upper limit of normal; INR, international normalized ratio; HBV, hepatitis B virus. 180 JOURNAL OF CLINICAL ONCOLOGY

5 HBV DNA, genotypes and HCC HBV Genotype Table 4. Relationship Between HBV Genotype and HBV DNA HBV DNA (copies/ml) 4.5 Logs 4.5 Logs Logs 6.5 Logs No. HR 95% CI P No. HR 95% CI P No. HR 95% CI P No. HR 95% CI P Model 1 B Cs to Ce to Model 2 B Cs to to Ce to to NOTE. We compared HRs and 95% CIs of hepatocellular carcinoma of patients infected by different HBV genotype at different HBV DNA levels. HBV genotype B plus HBV genotypes Cs and Ce with HBV DNA 4.5 logs as reference group (n 457) adjusted for the prognostic factors. Abbreviations: HBV, hepatitis B virus; HR, hazard ratio. than 2 the upper limit of laboratory normal, approximately 70% of patients had significant histologic necroinflammation, and 15% of patients had severe liver fibrosis. 22 In the REVEAL study cohort, patients with normal ALT levels still have significant high risks of developing liver cirrhosis if the HBV DNA was high. 20 We believe that ALT assessment is not important in the risk estimation of HCC as far as the level of HBV DNA and the presence of liver cirrhosis have been taken into consideration. On the other hand, it becomes important to determine the presence of liver cirrhosis among patients who have high HBV DNA but low ALT levels. 4 There is increasing evidence that HBV genotype C is associated with higher risk of HCC than is HBV genotype B. 7-9 This is probably related to the more aggressive disease activity and delayed HBeAg seroconversion among patients infected by HBV genotype C In line with the results of a previously conducted case control study, our longitudinal follow-up data also suggested that HBV subgenotype Ce was associated with a higher risk of HCC than was HBV subgenotype Cs. 14 In fact, HBV genotype/subgenotype, HBV DNA and liver cirrhosis have independent impacts on the risk of development of HCC. 9 The higher proportion of patients infected by HBV subgenotype Ce on antiviral treatment during the follow-up period in our study supported more active liver disease among these patients. Basal core promoter mutations have been suggested to associate with hepatocarcinogenesis, but they are less often found in HBV subgenotype Ce than HBV subgenotype Cs. 11,26 On the other hand, T1653 mutation located at the alpha box, which is more associated with HBV subgenotype Ce, has been reported to increase the risk of HCC among Japanese patients. 14,27 One limitation of our study is the lack of data on HBeAg status. In a population-based study in Taiwan, a single positive HBeAg was associated with dramatic increased risk of HCC in the subsequent 12 years of follow-up. 28 This observation could be explained by the higher HBV DNA levels among patients with positive HBeAg. In this study, there was no information on the change of HBeAg status during the follow-up. In fact, HCC is less common among patients who have sustained HBeAg seroconversion. 29 On the other hand, some patients may have fluctuating HBeAg status or active liver disease after HBeAg seroconversion as a result of persistent viremia, and these patients have increased risk of liver cirrhosis and HCC. 30,31 Therefore, HBV DNA is probably a more important marker for HCC risk stratification than is the HBeAg status. In conclusion, we have shown that viral factors have a important impact on the risk of HCC development compared with other factors. Higher serum HBV DNA and HBV subgenotype Ce are associated with higher risk of HCC in a follow-up of more than 7 years. HBV DNA higher than 4.5 log copies/ml starts to have increased risk of HCC and HBV DNA higher than 6.5 logs has a further incremental risk of HCC. Patients with HBV subgenotype Ce and/or high HBV DNA stratum should undergo vigorous HCC surveillance to detect early, potentially resectable HCC, particularly if other clinical factors including older age, male sex, and liver cirrhosis are also present. In the current treatment guidelines, antiviral treatments should be started among cirrhotic patients despite lower HBV DNA levels. 4,19 Future studies focusing on the need to lower the threshold of commencing antiviral treatment based on HBV subgenotype are warranted. AUTHORS DISCLOSURES OF POTENTIAL CONFLICTS OF INTEREST The author(s) indicated no potential conflicts of interest. AUTHOR CONTRIBUTIONS Conception and design: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Tony S.-K. Mok Financial support: Joseph Jao-Yiu Sung Administrative support: Jane Koh, Tony S.-K. Mok Provision of study materials or patients: Henry Lik-Yuen Chan, Vincent Wai-Sun Wong, Grace Lai-Hung Wong, Stephen Lam Chan Collection and assembly of data: Henry Lik-Yuen Chan, Chi-Hang Tse, Jane Koh, Vincent Wai-Sun Wong, Grace Lai-Hung Wong, Stephen Lam Chan, Winnie Yeo Data analysis and interpretation: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Winnie Yeo, Joseph Jao-Yiu Sung, Tony S.-K. Mok Manuscript writing: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Tony S.-K. Mok Final approval of manuscript: Henry Lik-Yuen Chan, Chi-Hang Tse, Frankie Mo, Joseph Jao-Yiu Sung, Tony S.-K. Mok 181

6 Chan et al REFERENCES 1. Chan HLY, Sung JJY: Hepatocellular carcinoma and hepatitis B virus. Semin Liver Dis 26: , McMahon BJ, Bulkow L, Harspter A, et al: Screening for hepatocellular carcinoma in Alaska Natives infected with chronic hepatitis B: A 16-year population-based study. Hepatology 32: , Wong GLH, Ip KI, Kwan LW, et al: Screening program for hepatocellular carcinoma can improve survival in patients with chronic viral hepatitis. Hepatology 44:496A, 2006 (supp 1; abstr 827) 4. Lok ASF, McMahon BJ: Chronic hepatitis B. Hepatology 45: , Chen CJ, Yang HI, Su J, et al: Risk of hepatocellular carcinoma across a biological gradient of serum hepatitis B virus DNA level. JAMA 295:65-73, Chen G, Lin W, Shen F, et al: Past HBV viral load as predictor of mortality and morbidity from HCC and chronic liver disease in a prospective study. Am J Gastroenterol 101: , Kao JH, Chen PJ, Lai MY, et al: Basal core promoter mutations of hepatitis B virus increase the risk of hepatocellular carcinoma in hepatitis B carriers. Gastroenterology 124: , Chan HLY, Hui AY, Wong ML, et al: Genotype C hepatitis B virus infection is associated with increased risk of hepatocellular carcinoma. Gut 53: , Yu MW, Yeh SH, Chan PJ, et al: Hepatitis B virus genotype and DNA level and hepatocellular carcinoma: A prospective study in men. J Natl Cancer Inst 97: , Sugauchi F, Orito E, Ichida T, et al: Hepatitis B virus of genotype B with or without recombination with genotype C over the precore region plus the core gene. J Virol 76: , Chan HLY, Tsui SKW, Tse CH, et al: Epidemiological and virological characteristics of two subgroups of genotype C hepatitis C virus. J Infect Dis 191: , Sugauchi F, Orito E, Ichida T, et al: Epidemiologic and virologic characteristics of hepatitis B virus genotype B having the recombination with genotype C. Gastroenterology 124: , Chan HLY, Tse CH, Ng EYT, et al: Phylogenetic, virological and clinical characteristics of genotype C hepatitis B virus with TCC at codon 15 of the precore region. J Clin Microbiol 44: , Tanaka Y, Mukaide M, Orito E, et al: Specific mutations in enhancer II/core promoter of hepatitis B virus subgenotypes C1/2 increase the risk of hepatocellular carcinoma. J Hepatol 45: , Mok TSK, Yeo W, Yu S, et al: An intensive surveillance program detected a high incidence of hepatocellular carcinoma amongst hepatitis B virus carriers with abnormal alpha-fetoprotein or abdominal ultrasonography. J Clin Oncol 23: , Chan HLY, Hui Y, Leung NWY, et al: Risk factors for active liver disease in HBeAg-negative chronic hepatitis B virus (HBV) infected patients. Am J Gastroenterol 95: , Loeb KR, Jerome KR, Goddard J, et al: Highthroughput quantitative analysis of hepatitis B virus DNA in serum using the TaqMan fluorogenic detection system. Hepatology 32: , Chan HLY, Chui AKK, Lau WY, et al: Factors associated with viral breakthrough in lamivudine monoprophylaxis of hepatitis B virus recurrence after liver transplantation. J Med Virol 68: , Keeffe EB, Dieterich DT, Han SH, et al: A treatment of algorithm for the management of chronic hepatitis B virus infection in the United States: An update. Clin Gastroenterol Hepatol 4: , Iloeje UH, Yang HI, Su J, et al: Predicting cirrhosis risk based on the level of circulating hepatitis viral load. Gastroenterology 130: , Hui AY, Chan HLY, Leung NWY, et al: Survival and prognostic indicators in patients with hepatitis B virus-related cirrhosis after onset of hepatic decompensation. J Clin Gastroenterol 34: , Terrault N, Kin R, Schalm S, et al: Presence of biopsy-proven histologic damage (necroinflammation and fibrosis) is common even when ALT is less than 2 x ULN in patients with chronic hepatitis B (CHB). J Hepatol 46:S184 (supp 1; abstr 483) 23. Chu CJ, Hussain M, Lok ASF: Hepatitis B virus genotype B is associated with earlier HBeAg seroconversion compared with hepatitis B virus genotype C. Gastroenterology 122: , Chan HLY, Tsang SWC, Liew CT, et al: Viral genotype and hepatitis B virus DNA levels are correlated with histological liver damage in HBeAgnegative chronic hepatitis B virus infection. Am J Gastroenterol 97: , Chan HLY, Wong ML, Hui AY, et al: Genotype C hepatitis B virus takes a more aggressive disease course before hepatitis B e antigen seroconversion as compared to genotype B hepatitis B virus. J Clin Microbiol 41: , Kuang SY, Jackson PE, Wang JB, et al: Specific mutations of hepatitis B virus in plasma predict liver cancer development. Proc Natl Acad Sci U S A 101: , Ito K, Tanaka Y, Orito E, et al: T1653 mutation in the box alpha increases the risk of hepatocellular carcinoma in patients with chronic hepatitis B virus genotype C infection. Clin Infect Dis 42:1-7, Yang HI, Lu SN, Liaw YF, et al: Hepatitis B e antigen and the risk of hepatocellular carcinoma. N Engl J Med 347: , Hsu YS, Chien RN, Yeh CT, et al: Long-term outcome after spontaneous HBeAg seroconversion in patients with chronic hepatitis B. Hepatology 35: , Di Marco V, Iacono OL, Camma C, et al: The long-term course of chronic hepatitis B. Hepatology 30: , McMahon BJ, Holck P, Bulkow L, et al: Serologic and clinical outcome of 1536 Alaska natives chronically infected with hepatitis B virus. Ann Intern Med 135: , JOURNAL OF CLINICAL ONCOLOGY

Molecular Diagnosis of Hepatitis B and Hepatitis D infections

Molecular Diagnosis of Hepatitis B and Hepatitis D infections Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication

More information

The Natural History of Chronic Hepatitis B Virus Infection

The Natural History of Chronic Hepatitis B Virus Infection The Natural History of Chronic Hepatitis B Virus Infection Brian J. McMahon, M.D. 1 ABSTRACT Three stages of chronic hepatitis B virus (HBV) infection are recognized: the immune tolerant phase, the chronic

More information

Lamivudine for Patients with hronic Hepatitis B and Advanced Liver Disease. From : New England Journal of Medicine

Lamivudine for Patients with hronic Hepatitis B and Advanced Liver Disease. From : New England Journal of Medicine Lamivudine for Patients with hronic Hepatitis B and Advanced Liver Disease From : New England Journal of Medicine Volume 351:1521-1531, Number 15, Oct 7, 2004 馬 偕 紀 念 醫 院 一 般 內 科, 肝 膽 腸 胃 科 新 竹 分 院 陳 重

More information

The natural history of chronic HBV infection

The natural history of chronic HBV infection Hepatitis B Viral Factors in HBeAg-Negative Carriers with Persistently Normal Serum Alanine Aminotransferase Levels Chih-Lin Lin, 1* Li-Ying Liao, 1* Chun-Jen Liu, 2 Ming-Whei Yu, 3 Pei-Jer Chen, 2,4 Ming-Yang

More information

PURPOSE: To define the criteria to be used to determine the medical necessity of antiviral therapy in the treatment of Chronic Hepatitis B.

PURPOSE: To define the criteria to be used to determine the medical necessity of antiviral therapy in the treatment of Chronic Hepatitis B. COVENTRY Health Care Guidelines for Hepatitis B Therapy SUBJECT: Chronic Hepatitis B Therapy: a. Interferons - Intron A (interferon alfa-2b) and Pegasys (peginterferon alfa-2a) b. Nucleoside analogues

More information

Management of Chronic Hepatitis B: 2012 Update

Management of Chronic Hepatitis B: 2012 Update Management of Chronic Hepatitis B: 2012 Update Brian J McMahon MD, Liver Disease and Hepatitis Program Alaska Native Medical Center and Arctic Investigations Program, CDC Conflicts of Interest The Liver

More information

Cirrhosis and HCV. Jonathan Israel M.D.

Cirrhosis and HCV. Jonathan Israel M.D. Cirrhosis and HCV Jonathan Israel M.D. Outline Relationship of fibrosis and cirrhosisprevalence and epidemiology. Sequelae of cirrhosis Diagnosis of cirrhosis Effect of cirrhosis on efficacy of treatment

More information

Long-term Results of Pegylated Interferon alfa-2a and Tenofovir for Hepatitis B

Long-term Results of Pegylated Interferon alfa-2a and Tenofovir for Hepatitis B Long-term Results of Pegylated Interferon alfa-2a and Tenofovir for Hepatitis B Patrick Marcellin Viral Hepatitis Research Center Hôpital Beaujon, University of Paris France OBJECTIVES OF THERAPY IN CHRONIC

More information

Executive summary of recommendations

Executive summary of recommendations MOH CLINICAL PRACTICE GUIDELINES 2/2011 Chronic Hepatitis B Infection College of Family Physicians, Singapore Academy of Medicine, Singapore Singapore Medical Association Executive summary of recommendations

More information

After the Cure: Long-Term Management of HCV Liver Disease Norah A. Terrault, MD, MPH

After the Cure: Long-Term Management of HCV Liver Disease Norah A. Terrault, MD, MPH After the Cure: Long-Term Management of HCV Liver Disease Norah A. Terrault, MD, MPH Professor of Medicine Department of Gastroenterology Director, Viral Hepatitis Center University of California San Francisco

More information

Recent advances of 台 中 榮 總 內 科 部 胃 腸 肝 膽 科 呂 宜 達 醫 師 2013.03.28

Recent advances of 台 中 榮 總 內 科 部 胃 腸 肝 膽 科 呂 宜 達 醫 師 2013.03.28 Recent advances of HBV and HCV co-infection 台 中 榮 總 內 科 部 胃 腸 肝 膽 科 呂 宜 達 醫 師 2013.03.28 Outline Epidemiology of HBV and HCV coinfection Clinical significance of HBV and HCV coinfection Interplay between

More information

PREVENTION OF HCC BY HEPATITIS C TREATMENT. Morris Sherman University of Toronto

PREVENTION OF HCC BY HEPATITIS C TREATMENT. Morris Sherman University of Toronto PREVENTION OF HCC BY HEPATITIS C TREATMENT Morris Sherman University of Toronto Pathogenesis of HCC in chronic hepatitis C Injury cirrhosis HCC Injury cirrhosis HCC Time The Ideal Study Prospective randomized

More information

HBV DNA < monitoring interferon Rx

HBV DNA < monitoring interferon Rx Hepatitis B Virus Suspected acute hepatitis >>Order: Acute Unknown hepatitis screen Suspected chronic hepatitis >>Order: Chronic unknown hepatitis screen Acute HBV or Delayed Anti HBs response after acute

More information

Optimising therapy in chronic hepatitis B: Switch or add treatment

Optimising therapy in chronic hepatitis B: Switch or add treatment Optimising therapy in chronic hepatitis B: Switch or add treatment Teerha Piratvisuth NKC Institute of Gastroenterology and Hepatology Prince of Songkla University,Thailand NA + NA Percent with resistance

More information

Treatment Strategies of Hepatitis B in China

Treatment Strategies of Hepatitis B in China Treatment Strategies of Hepatitis B in China Guangbi Yao MD Shanghai Jing-An Qu Central Hospital 200040 Characteristic features of CHB in China Huge amount of patients Infection during early life Maternal

More information

Liver Cancer and Clinical Trials

Liver Cancer and Clinical Trials Liver Cancer and Clinical Trials Abby Siegel MD, MS Medical Director, Hepatobiliary Oncology Columbia University Medical Center Tony Wang MD Assistant Professor, Radiation Oncology, Columbia University

More information

Chronic hepatitis B (CHB) remains an important public SPECIAL REPORT

Chronic hepatitis B (CHB) remains an important public SPECIAL REPORT CLINICAL GASTROENTEROLOGY AND HEPATOLOGY 2008;6:1315 1341 SPECIAL REPORT A Treatment Algorithm for the Management of Chronic Hepatitis B Virus Infection in the United States: 2008 Update EMMET B. KEEFFE,*

More information

What to Do with the Patient With Abnormal Liver Enzymes? Nizar N. Zein, M.D. The Cleveland Clinic

What to Do with the Patient With Abnormal Liver Enzymes? Nizar N. Zein, M.D. The Cleveland Clinic What to Do with the Patient With Abnormal Liver Enzymes? Nizar N. Zein, M.D. The Cleveland Clinic Introduction Elevated liver enzymes is often not a clinical problem by itself. However it is a warning

More information

Liver Disease and Therapy of Hepatitis B Virus Infections

Liver Disease and Therapy of Hepatitis B Virus Infections Liver Disease and Therapy of Hepatitis B Virus Infections University of Adelaide Catherine Scougall Arend Grosse Huey-Chi Low Allison Jilbert Fox Chase Cancer Center Chunxiao Xu Carol Aldrich Sam Litwin

More information

Treatment of Hepatitis B

Treatment of Hepatitis B Treatment of Hepatitis B Paul Y Kwo, MD Professor of Medicine Gastroenterology/Hepatology Division Medical Director, Liver Transplantation Indiana University Health Indiana University School of Medicine

More information

Efficacy of Prophylactic Entecavir for Hepatitis B Virus- Related Hepatocellular Carcinoma Receiving Transcatheter Arterial Chemoembolization

Efficacy of Prophylactic Entecavir for Hepatitis B Virus- Related Hepatocellular Carcinoma Receiving Transcatheter Arterial Chemoembolization DOI:http://dx.doi.org/10.7314/APJCP.2015.16.18.8659 Efficacy of Prophylactic Entecavir for Hepatitis B Virus Related HCC Receiving Transcatheter Arterial Chemoembolization RESEARCH ARTICLE Efficacy of

More information

Therapy of decompensated cirrhosis Pre-transplant for HBV and HCV

Therapy of decompensated cirrhosis Pre-transplant for HBV and HCV Therapy of decompensated cirrhosis Pre-transplant for HBV and HCV Universitätsklinikum Leipzig Thomas Berg Sektion Hepatologie Klinik und Poliklinik für Gastroenterologie und Rheumatologie Leber- und Studienzentrum

More information

Co-infected health-care workers

Co-infected health-care workers Co-infected health-care workers Y.Yazdanpanah Service Universitaire des Maladies Infectieuses et du Voyageur C.H. Tourcoing, Faculté de Médecine de Lille CNRS U362, Lille, France Co-infected health-care

More information

The availability of newer antiviral agents, as

The availability of newer antiviral agents, as TREATMENT OF HEPATITIS B VIRUS INFECTION * Norman L. Sussman, MD ABSTRACT In treating chronic hepatitis B virus (HBV) infection, the primary goal of therapy is to achieve sustained suppression of HBV replication,

More information

HEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis

HEPATITIS WEB STUDY Acute Hepatitis C Virus Infection: Epidemiology, Clinical Features, and Diagnosis HEPATITIS WEB STUDY Acute C Virus Infection: Epidemiology, Clinical Features, and Diagnosis H. Nina Kim, MD Assistant Professor of Medicine Division of Infectious Diseases University of Washington School

More information

Surveillance for Hepatocellular Carcinoma

Surveillance for Hepatocellular Carcinoma Surveillance for Hepatocellular Carcinoma Marion G. Peters, MD John V. Carbone, MD, Endowed Chair Professor of Medicine Chief of Hepatology Research University of California San Francisco Recorded on April

More information

Virology. Behandlung der Hepatitis B. HBV Genome. HBV life cycle. HBV Genotypes. Natural History. 8 genotypes: A, B, C, D, E, F, G, H

Virology. Behandlung der Hepatitis B. HBV Genome. HBV life cycle. HBV Genotypes. Natural History. 8 genotypes: A, B, C, D, E, F, G, H Virology Behandlung der Hepatitis B Markus Heim Universitätsspital Basel 1 2 HBV Genome HBV life cycle 3 4 HBV Genotypes Natural History 8 genotypes: A, B, C, D, E, F, G, H genotypes A and D are prevalent

More information

Hepatitis B and C Co-infection. Mark Hull MHSc, FRCPC Clinical Assistant Professor Division of AIDS

Hepatitis B and C Co-infection. Mark Hull MHSc, FRCPC Clinical Assistant Professor Division of AIDS Hepatitis B and C Co-infection Mark Hull MHSc, FRCPC Clinical Assistant Professor Division of AIDS Objectives Review natural history of hepatitis coinfection Brief overview of treatment indications for

More information

HCC: Risk factors, surveillance and the importance of a multidisciplinary team

HCC: Risk factors, surveillance and the importance of a multidisciplinary team HCC: Risk factors, surveillance and the importance of a multidisciplinary team Anjana Pillai MD Assistant Professor of Medicine Director, Emory University Hospital Liver Tumor Clinic Division of Digestive

More information

HBsAg level and hepatitis B viral load correlation with focus on pregnancy

HBsAg level and hepatitis B viral load correlation with focus on pregnancy ORIGINAL ARTICLE Annals of Gastroenterology (2015) 28, 1-6 HBsAg level and hepatitis B viral load correlation with focus on pregnancy Maria Belopolskaya a, Viktor Avrutin b, Sergey Firsov a, Alexey Yakovlev

More information

HBV & HCV induced. Liver Cirrhosis Iradj Maleki MD Gut & Liver Research Center Mazandaran University of Medical Sciences

HBV & HCV induced. Liver Cirrhosis Iradj Maleki MD Gut & Liver Research Center Mazandaran University of Medical Sciences HBV & HCV induced Liver Cirrhosis Iradj Maleki MD Gut & Liver Research Center Mazandaran University of Medical Sciences Definition of Cirrhosis Final pathway for a wide variety of chronic liver diseases

More information

CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma

CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma CASL Symposium Hepatitis B Co-chairs: Carla Coffin and Mang Ma Occult HBV Infection: Assessment and Clinical Significance D. Lorne Tyrrell Director, Li Ka Shing Institute of Virology University of Alberta

More information

Case Finding for Hepatitis B and Hepatitis C

Case Finding for Hepatitis B and Hepatitis C Case Finding for Hepatitis B and Hepatitis C John W. Ward, M.D. Division of Viral Hepatitis Centers for Disease Control and Prevention Atlanta, Georgia, USA Division of Viral Hepatitis National Center

More information

Management of Liver Cancer: In the Era of Liver Transplantation

Management of Liver Cancer: In the Era of Liver Transplantation Management of Liver Cancer: In the Era of Liver Transplantation Marwan S. Abouljoud, M.D., F.A.C.S. Benson Ford Chair Transplant and Hepatobiliary Surgery Director, Henry Ford Transplant Institute I have

More information

Quantitative HBV DNA measurements and the management of infected health care workers

Quantitative HBV DNA measurements and the management of infected health care workers Quantitative HBV DNA measurements and the management of infected health care workers A.A. van der Eijk Department of Virology, Erasmus MC, Rotterdam, the Netherlands Introduction Worldwide since 1970s,

More information

EASL INTERNATIONAL CONSENSUS CONFERENCE ON HEPATITIS B 13 14 September, 2002 Geneva, Switzerland Consensus statement (Short version)

EASL INTERNATIONAL CONSENSUS CONFERENCE ON HEPATITIS B 13 14 September, 2002 Geneva, Switzerland Consensus statement (Short version) Journal of Hepatology 38 (2003) 533 540 Special article EASL INTERNATIONAL CONSENSUS CONFERENCE ON HEPATITIS B 13 14 September, 2002 Geneva, Switzerland Consensus statement (Short version) The EASL Jury*

More information

Screening for hepatocellular carcinoma: survival benefit and cost-effectiveness

Screening for hepatocellular carcinoma: survival benefit and cost-effectiveness Review Annals of Oncology 14: 1463 1467, 2003 DOI: 10.1093/annonc/mdg400 Screening for hepatocellular carcinoma: survival benefit and cost-effectiveness M.-F. Yuen & C.-L. Lai* Department of Medicine,

More information

Evaluation and Prognosis of Patients with Cirrhosis

Evaluation and Prognosis of Patients with Cirrhosis Evaluation and Prognosis of Patients with Cirrhosis Marion G. Peters, MD John V. Carbone, MD, Endowed Chair Professor of Medicine Chief of Hepatology Research University of California San Francisco Recorded

More information

Hepatitis B Virus DNA Levels and Outcomes in Chronic Hepatitis B

Hepatitis B Virus DNA Levels and Outcomes in Chronic Hepatitis B Hepatitis B Virus DNA Levels and Outcomes in Chronic Hepatitis B Chien-Jen Chen, 1,2 Hwai-I Yang, 1 and Uchenna H. Iloeje 3 for The REVEAL-HBV Study Group 4 Serum hepatitis B virus (HBV) DNA levels can

More information

Follow-up and indications for liver biopsy in HBeAg-negative chronic hepatitis B virus infection with persistently normal ALT: A systematic review

Follow-up and indications for liver biopsy in HBeAg-negative chronic hepatitis B virus infection with persistently normal ALT: A systematic review Follow-up and indications for liver biopsy in HBeAg-negative chronic hepatitis B virus infection with persistently normal ALT: A systematic review George V. Papatheodoridis 1,, Spilios Manolakopoulos 1,

More information

Kaohsiung Medical University; 5 Department of Occupational and Environmental Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan.

Kaohsiung Medical University; 5 Department of Occupational and Environmental Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan. COMPARISON OF CLINICAL APPLICATION OF THE ABBOTT HBV PCR KIT AND THE VERSANT HBV DNA 3.0 TEST TO MEASURE SERUM HEPATITIS B VIRUS DNA IN TAIWANESE PATIENTS Jeng-Fu Yang, 1,2 Ya-Yun Lin, 1 Jee-Fu Huang,

More information

Clinical Application of HBs quantification

Clinical Application of HBs quantification Clinical Application of HBs quantification Hepatology on the Nile 2 Advances in Liver Disease 2014, "World Expert Review» Wednesday, September 24, 2014 Pr Tarik Asselah MD, PhD; Service d Hépatologie &

More information

During the natural history of chronic hepatitis B. Hepatitis B Virus DNA Prediction Rules for Hepatitis B e Antigen Negative Chronic Hepatitis B

During the natural history of chronic hepatitis B. Hepatitis B Virus DNA Prediction Rules for Hepatitis B e Antigen Negative Chronic Hepatitis B Hepatitis B Virus DNA Prediction Rules for Hepatitis B e Antigen Negative Chronic Hepatitis B Jordan J. Feld, 1,3 Melissa Ayers, 2 Dahlia El-Ashry, 1 Tony Mazzulli, 2 Raymond Tellier, 2 and E. Jenny Heathcote

More information

Liver Transplantation for Hepatocellular Carcinoma. John P. Roberts, MD Chief, Division of Transplant Service University of California, San Francisco

Liver Transplantation for Hepatocellular Carcinoma. John P. Roberts, MD Chief, Division of Transplant Service University of California, San Francisco Liver Transplantation for Hepatocellular Carcinoma John P. Roberts, MD Chief, Division of Transplant Service University of California, San Francisco Hepatocellular Carcinoma HCC is the 5th most common

More information

Transmission of HCV in the United States (CDC estimate)

Transmission of HCV in the United States (CDC estimate) Transmission of HCV in the United States (CDC estimate) Past and Future US Incidence and Prevalence of HCV Infection Decline among IDUs Overall incidence Overall prevalence Infected 20+ years Armstrong

More information

EASL Clinical Practice Guidelines: Management of chronic hepatitis B virus infection

EASL Clinical Practice Guidelines: Management of chronic hepatitis B virus infection EASL Clinical Practice Guidelines: Management of chronic hepatitis B virus infection European Association for the Study of the Liver Introduction Our understanding of the natural history of hepatitis B

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

Seton Medical Center Hepatocellular Carcinoma Patterns of Care Study Rate of Treatment with Chemoembolization 2007 2012 N = 50

Seton Medical Center Hepatocellular Carcinoma Patterns of Care Study Rate of Treatment with Chemoembolization 2007 2012 N = 50 General Data Seton Medical Center Hepatocellular Carcinoma Patterns of Care Study Rate of Treatment with Chemoembolization 2007 2012 N = 50 The vast majority of the patients in this study were diagnosed

More information

Acute exacerbation among chronic hepatitis C patients: Tip of the iceberg that deserves more attention

Acute exacerbation among chronic hepatitis C patients: Tip of the iceberg that deserves more attention Accepted Manuscript Acute exacerbation among chronic hepatitis C patients: Tip of the iceberg that deserves more attention Robert J. Wong, Ramsey C. Cheung PII: S1542-3565(13)00734-9 DOI: 10.1016/j.cgh.2013.05.023

More information



More information

A Revisit of Prophylactic Lamivudine for Chemotherapy-Associated Hepatitis B Reactivation in Non-Hodgkin s Lymphoma: A Randomized Trial

A Revisit of Prophylactic Lamivudine for Chemotherapy-Associated Hepatitis B Reactivation in Non-Hodgkin s Lymphoma: A Randomized Trial A Revisit of Prophylactic Lamivudine for Chemotherapy-Associated Hepatitis B Reactivation in Non-Hodgkin s Lymphoma: A Randomized Trial Chiun Hsu, 1,2 Chao A. Hsiung, 3 Ih-Jen Su, 4 Wei-Shou Hwang, 5 Ming-Chung

More information

Risk Factors for Alcoholism among Taiwanese Aborigines

Risk Factors for Alcoholism among Taiwanese Aborigines Risk Factors for Alcoholism among Taiwanese Aborigines Introduction Like most mental disorders, Alcoholism is a complex disease involving naturenurture interplay (1). The influence from the bio-psycho-social

More information

Phase: IV. Study Period: 20 Jan. 2006-17 Sep. 2008

Phase: IV. Study Period: 20 Jan. 2006-17 Sep. 2008 The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.

More information



More information

Diagnosis of Acute HCV Infection

Diagnosis of Acute HCV Infection Hepatitis C Online PDF created August 23, 2016, 2:28 pm Diagnosis of Acute HCV Infection Module 1: Lesson 5: Contents: Screening and Diagnosis of Hepatitis C Infection Diagnosis of Acute HCV Infection

More information

Management of Chronic Hepatitis B: Consensus Guidelines

Management of Chronic Hepatitis B: Consensus Guidelines Management of Chronic Hepatitis B: Consensus Guidelines Morris Sherman MD PhD 1, Stephen Shafran MD 2, Kelly Burak MD 3, Karen Doucette MD 2, Winnie Wong MD 2, Nigel Girgrah MD 1, Eric Yoshida MD 4, Eberhard

More information


HEPATITIS COINFECTIONS HEPATITIS COINFECTIONS Kenneth E. Sherman, MD, PhD Gould Professor of Medicine Director, Division of Digestive Diseases University of Cincinnati College of Medicine Disclosures (Activity w/i 12 months)

More information

The Natural History of Chronic Hepatitis B Virus Infection

The Natural History of Chronic Hepatitis B Virus Infection The Natural History of Chronic Hepatitis B Virus Infection Brian J. McMahon Chronic hepatitis B virus (HBV) infection has a complicated course. Three phases are identified: an immune tolerant phase with

More information

Patterns of abnormal LFTs and their differential diagnosis

Patterns of abnormal LFTs and their differential diagnosis Patterns of abnormal LFTs and their differential diagnosis Professor Matthew Cramp South West Liver Unit and Peninsula Schools of Medicine and Dentistry, Plymouth Summary liver function / liver function

More information

CASG HBV Study Richard B. Pollard, MD David M. Asmuth, MD Division of Infectious Diseases University of California Davis Medical Center Sacramento, CA

CASG HBV Study Richard B. Pollard, MD David M. Asmuth, MD Division of Infectious Diseases University of California Davis Medical Center Sacramento, CA CASG HBV Study Richard B. Pollard, MD David M. Asmuth, MD Division of Infectious Diseases University of California Davis Medical Center Sacramento, CA Characteristics of HBV DNA Hepadnavirus Reverse transcriptase

More information

AASLD PRACTICE GUIDELINES Chronic Hepatitis B: Update 2009

AASLD PRACTICE GUIDELINES Chronic Hepatitis B: Update 2009 AASLD PRACTICE GUIDELINES Chronic Hepatitis B: Update 2009 Anna S. F. Lok 1 and Brian J. McMahon 2 This guideline has been approved by the American Association for the Study of Liver Diseases and represents

More information

Treatment of Acute Hepatitis C

Treatment of Acute Hepatitis C Management of Patients with Viral Hepatitis, Paris, 2004 Treatment of Acute Hepatitis C Michael P. Manns, Andrej Potthoff, Elmar Jaeckel, Heiner Wedemeyer Hepatitis C Virus (HCV) infection is a common

More information


AASLD PRACTICE GUIDELINES Chronic Hepatitis B AASLD PRACTICE GUIDELINES Chronic Hepatitis B Anna S. F. Lok 1 and Brian J. McMahon 2 This guideline has been approved by the American Association for the Study of Liver Diseases and represents the position

More information

Boehringer Ingelheim- sponsored Satellite Symposium. HCV Beyond the Liver

Boehringer Ingelheim- sponsored Satellite Symposium. HCV Beyond the Liver Boehringer Ingelheim- sponsored Satellite Symposium HCV Beyond the Liver HCV AS A METABOLIC MODIFIER: STEATOSIS AND INSULIN RESISTANCE Francesco Negro University Hospital of Geneva Switzerland Clinical

More information

HBV Treatment Guidelines. By: Prof.Dr. Abdelfatah Hanno Professor of Tropical Medicine Alexandria Faculty of Medicine

HBV Treatment Guidelines. By: Prof.Dr. Abdelfatah Hanno Professor of Tropical Medicine Alexandria Faculty of Medicine HBV Treatment Guidelines By: Prof.Dr. Abdelfatah Hanno Professor of Tropical Medicine Alexandria Faculty of Medicine A 29 Y old lady diagnosed as chronic HBV 3 years ago during her pregnancy, no treatment

More information

New IDSA/AASLD Guidelines for Hepatitis C

New IDSA/AASLD Guidelines for Hepatitis C NORTHWEST AIDS EDUCATION AND TRAINING CENTER New IDSA/AASLD Guidelines for Hepatitis C John Scott, MD, MSc Associate Professor, UW SoM Asst Director, Liver Clinic, Harborview Medical Center Presentation

More information

Epidemiology of Hepatitis C Infection. Pablo Barreiro Service of Infectious Diseases Hospital Carlos III, Madrid

Epidemiology of Hepatitis C Infection. Pablo Barreiro Service of Infectious Diseases Hospital Carlos III, Madrid Epidemiology of Hepatitis C Infection Pablo Barreiro Service of Infectious Diseases Hospital Carlos III, Madrid Worldwide Prevalence of Hepatitis C 10% No data available WHO.

More information

Hepatitis E virus and chronic hepatitis in organ-transplant recipients

Hepatitis E virus and chronic hepatitis in organ-transplant recipients Hepatitis E virus and chronic hepatitis in organ-transplant recipients Nassim Kamar MD, PhD Department of Nephrology, Dialysis and Multi-Organ Transplantation Toulouse University Hospital Antwerp, 13/3/2009

More information

Prognosis: diagnosing the future. The temporal dimension of diagnosis. Predictive models

Prognosis: diagnosing the future. The temporal dimension of diagnosis. Predictive models Prognosis: diagnosing the future. The temporal dimension of diagnosis. Predictive models Gennaro D Amico Gastroenterology Unit V Cervello Hospital Palermo gedamico@libero.it Diagnosing the future The link

More information


BURDEN OF LIVER DISEASE IN BRAZIL BURDEN OF LIVER DISEASE IN BRAZIL Burden of Liver Disease in Europe Blachier et al. J Hepatol 58:593, 2013 Review of 260 epidemiologic studies of the 5 previous years Cirrhosis is responsible for 170.000

More information

Recommendations 8/14/2014. Hepatitis C Clinical Approach Primary Care. Purpose of Presentation. HCV Prevalence Year of Birth

Recommendations 8/14/2014. Hepatitis C Clinical Approach Primary Care. Purpose of Presentation. HCV Prevalence Year of Birth Hepatitis C Clinical Approach Primary Care Dr. Vicki L. MIt McIntyre, FNP Tucson Gastroenterology Specialists Tucson, Arizona University of Phoenix Lead Faculty, Department of Nursing Tucson, Arizona Purpose

More information

Viral Hepatitis. 2009 APHL survey report

Viral Hepatitis. 2009 APHL survey report Issues in Brief: viral hepatitis testing Association of Public Health Laboratories May Viral Hepatitis Testing 9 APHL survey report In order to characterize the role that the nation s public health laboratories

More information

Update on Hepatitis C. Sally Williams MD

Update on Hepatitis C. Sally Williams MD Update on Hepatitis C Sally Williams MD Hep C is Everywhere! Hepatitis C Magnitude of the Infection Probably 8 to 10 million people in the U.S. are infected with Hep C 30,000 new cases are diagnosed annually;

More information

Hepatitis B in Pregnancy

Hepatitis B in Pregnancy Hepatitis B in Pregnancy This guideline was updated in July 2015 by Dr Joana de Sousa, with input from members of the New Zealand Maternal Fetal Medicine Network and Neonatology. Background It is recognised

More information

SBRT (Elekta), 45 Gy in fractions of 3 Gy 3x/week for 5 weeks (N=22) vs.

SBRT (Elekta), 45 Gy in fractions of 3 Gy 3x/week for 5 weeks (N=22) vs. Uitgangsvraag 6: Wat is de plaats van stereotactische radiotherapiebehandeling (SBRT) bij HCC patiënten? Primaire studies I Study ID II Method III Patient characteristics IV Intervention(s) V Results primary

More information

NP/PA Clinical Hepatology Fellowship Summary of Year-Long Curriculum

NP/PA Clinical Hepatology Fellowship Summary of Year-Long Curriculum OVERVIEW OF THE FELLOWSHIP The goal of the AASLD NP/PA Fellowship is to provide a 1-year postgraduate hepatology training program for nurse practitioners and physician assistants in a clinical outpatient

More information

Stepwise Approach for Detecting, Evaluating, and Treating Chronic Hepatitis B Virus Infection

Stepwise Approach for Detecting, Evaluating, and Treating Chronic Hepatitis B Virus Infection Stepwise Approach for Detecting, Evaluating, and Treating Chronic Hepatitis B Virus Infection Federal Bureau of Prisons Clinical Practice Guidelines January 20, 2011 Clinical guidelines are made available

More information

Month/Year of Review: March 2014 Date of Last Review: February 2012

Month/Year of Review: March 2014 Date of Last Review: February 2012 Drug Use Research & Management Program Oregon State University, 500 Summer Street NE, E35, Salem, Oregon 97301-1079 Phone 503-947-5220 Fax 503-947-1119 Copyright 2012 Oregon State University. All Rights

More information

HIV and Hepatitis Co-infection. Martin Fisher Brighton and Sussex University Hospitals, UK

HIV and Hepatitis Co-infection. Martin Fisher Brighton and Sussex University Hospitals, UK HIV and Hepatitis Co-infection Martin Fisher Brighton and Sussex University Hospitals, UK Useful References British HIV Association 2010 http://www.bhiva.org/documents/guidelines/hepbc/2010/ hiv_781.pdf

More information

Management of hepatitis C: pre- and post-liver transplantation. Piyawat Komolmit Bangkok

Management of hepatitis C: pre- and post-liver transplantation. Piyawat Komolmit Bangkok Management of hepatitis C: pre- and post-liver transplantation Piyawat Komolmit Bangkok Liver transplantation and CHC Cirrhosis secondary to HCV is the leading cause of liver transplantation in the US

More information

boceprevir 200mg capsule (Victrelis ) Treatment experienced patients SMC No. (722/11) Merck, Sharpe and Dohme Ltd

boceprevir 200mg capsule (Victrelis ) Treatment experienced patients SMC No. (722/11) Merck, Sharpe and Dohme Ltd boceprevir 200mg capsule (Victrelis ) Treatment experienced patients SMC No. (722/11) Merck, Sharpe and Dohme Ltd 09 September 2011 The Scottish Medicines Consortium (SMC) has completed its assessment

More information

boceprevir 200mg capsule (Victrelis ) Treatment naïve patients SMC No. (723/11) Merck Sharpe and Dohme Ltd

boceprevir 200mg capsule (Victrelis ) Treatment naïve patients SMC No. (723/11) Merck Sharpe and Dohme Ltd boceprevir 200mg capsule (Victrelis ) Treatment naïve patients SMC No. (723/11) Merck Sharpe and Dohme Ltd 09 September 2011 The Scottish Medicines Consortium (SMC) has completed its assessment of the

More information

Dr David Chadwick. James Cook University Hospital, Middlesbrough. 19 th Annual Conference of the British HIV Association (BHIVA)

Dr David Chadwick. James Cook University Hospital, Middlesbrough. 19 th Annual Conference of the British HIV Association (BHIVA) 19 th Annual Conference of the British HIV Association (BHIVA) Dr David Chadwick James Cook University Hospital, Middlesbrough 16-19 April 2013, Manchester Central Convention Complex Occult hepatitis B/HIV

More information

Peg-IFN and ribavirin: what sustained virologic response can be achieved by using HCV genotyping and viral kinetics?

Peg-IFN and ribavirin: what sustained virologic response can be achieved by using HCV genotyping and viral kinetics? Peg-IFN and ribavirin: what sustained virologic response can be achieved by using HCV genotyping and viral kinetics? Prof. I. Bakulin Gastroenterology Department Key Questions Background Worldwide prevalence

More information

Evidence for the cost-effectiveness of screening for chronic hepatitis B and C among migrant populations: results from a review of the literature

Evidence for the cost-effectiveness of screening for chronic hepatitis B and C among migrant populations: results from a review of the literature Evidence for the cost-effectiveness of screening for chronic hepatitis B and C among migrant populations: results from a review of the literature October 2014 Prepared by Irene Veldhuijzen 1,2 and Susan

More information

The safety and clinical outcome of chemoembolisation in Child-Pugh Class C patients with hepatocellular carcinoma

The safety and clinical outcome of chemoembolisation in Child-Pugh Class C patients with hepatocellular carcinoma The safety and clinical outcome of chemoembolisation in Child-Pugh Class C patients with hepatocellular carcinoma Poster No.: C-1714 Congress: ECR 2015 Type: Authors: Keywords: DOI: Scientific Exhibit

More information

EASL Clinical Practice Guidelines: Management of chronic hepatitis B

EASL Clinical Practice Guidelines: Management of chronic hepatitis B Journal of Hepatology 50 (2009) 227 242 www.elsevier.com/locate/jhep EASL Clinical Practice Guidelines: Management of chronic hepatitis B European Association for the Study of the Liver * Keywords: Hepatitis

More information

Hepatitis C virus related cirrhosis: time to occurrence of hepatocellular carcinoma and death

Hepatitis C virus related cirrhosis: time to occurrence of hepatocellular carcinoma and death Gut ;47:3 36 3 Hepatitis C virus related cirrhosis: time to occurrence of hepatocellular carcinoma and death F Degos, C Christidis, N Ganne-Carrie, J-P Farmachidi, C Degott, C Guettier, J-C Trinchet, M

More information

DENOMINATOR: All patients aged 18 years and older with a diagnosis of chronic hepatitis C cirrhosis

DENOMINATOR: All patients aged 18 years and older with a diagnosis of chronic hepatitis C cirrhosis Measure #401: Hepatitis C: Screening for Hepatocellular Carcinoma (HCC) in Patients with Cirrhosis National Quality Strategy Domain: Effective Clinical Care 2016 PQRS OPTIONS FOR INDIVIDUAL MEASURES: REGISTRY

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Huang H, Li X, Zhu J, et al. Entecavir vs lamivudine for prevention of hepatitis B virus reactivation among patients with untreated diffuse large B-cell lymphoma receiving

More information

Alcoholic and Non-Alcoholic Fatty Liver Disease

Alcoholic and Non-Alcoholic Fatty Liver Disease Alcoholic and Non-Alcoholic Fatty Liver Disease Thomas W. Faust, M.D., M.B.E. Professor of Clinical Medicine Division of Gastroenterology The University of Pennsylvania Alcoholic Liver Disease Additional

More information

The first issue of HEPATOLOGY appeared around

The first issue of HEPATOLOGY appeared around Natural History of Chronic Hepatitis B Virus Infection: What We Knew in 1981 and What We Know in 2005 Hyung Joon Yim and Anna Suk-Fong Lok Remarkable progress has been made in our understanding of the

More information

Recommendations for the Identification of Chronic Hepatitis C virus infection Among Persons Born During 1945-1965

Recommendations for the Identification of Chronic Hepatitis C virus infection Among Persons Born During 1945-1965 Recommendations for the Identification of Chronic Hepatitis C virus infection Among Persons Born During 1945-1965 MMWR August 17, 2012 Prepared by : The National Viral Hepatitis Technical Assistance Center

More information

Ultrasound screening for hepatocellular carcinoma in patients with advanced liver fibrosis. An overview.

Ultrasound screening for hepatocellular carcinoma in patients with advanced liver fibrosis. An overview. Review Med Ultrason 2014, Vol. 16, no. 2, 139-144 DOI: 10.11152/mu.2013.2066.162.md1is2 Ultrasound screening for hepatocellular carcinoma in patients with advanced liver fibrosis. An overview. Mirela Dănilă,

More information

Viral Hepatitis Case Report

Viral Hepatitis Case Report Page 1 of 9 Viral Hepatitis Case Report Perinatal Hepatitis B Virus Infection Michigan Department of Community Health Communicable Disease Division Investigation Information Investigation ID Onset Date

More information

Liver Transplantation in Asian Patients With Chronic Hepatitis B Using Lamivudine Prophylaxis

Liver Transplantation in Asian Patients With Chronic Hepatitis B Using Lamivudine Prophylaxis ANNALS OF SURGERY Vol. 233, No. 2, 276 281 2001 Lippincott Williams & Wilkins, Inc. Liver Transplantation in Asian Patients With Chronic Hepatitis B Using Lamivudine Prophylaxis Chung-Mau Lo, MS, FRCS

More information

Hepatitis C Glossary of Terms

Hepatitis C Glossary of Terms Acute Hepatitis C A short-term illness that usually occurs within the first six months after someone is exposed to the hepatitis C virus (HCV). 1 Antibodies Proteins produced as part of the body s immune

More information

LIVER TRANSPLANTATION Update on Allocation Living Donor Liver Tx.

LIVER TRANSPLANTATION Update on Allocation Living Donor Liver Tx. LIVER TRANSPLANTATION Update on Allocation Living Donor Liver Tx. Steven L. Flamm MD Associate Professor of Medicine Medical Director, Liver Transplantation Northwestern University Medical School 1958

More information

Acute viral hepatitis B (AVH-B) is successfully. A Randomized Controlled Trial of Lamivudine to Treat Acute Hepatitis B. Patients and Methods

Acute viral hepatitis B (AVH-B) is successfully. A Randomized Controlled Trial of Lamivudine to Treat Acute Hepatitis B. Patients and Methods A Randomized Controlled Trial of Lamivudine to Treat Acute Hepatitis B M. Kumar, S. Satapathy, R. Monga, K. Das, S. Hissar, C. Pande, B. C. Sharma, and S. K. Sarin The role of antivirals in patients with

More information