PCR and Real-time PCR. Richard Thwaites Plant Health Group, CSL

Transcription

1 PCR and Real-time PCR Richard Thwaites Plant Health Group, CSL

2 Conventional PCR Amplification of a specific target DNA sequence DNA amplified between primers Target sequences typically 150 bp or more Requires post-pcr procedures

3 Conventional PCR

4 Conventional PCR gel electrophoresis PCR products resolved by observing DNA stained on a gel

5 Real-time PCR Fluorescence is used as a measure of amplicon production Enables real-time analysis, e.g. at each PCR cycle Allows quantification of initial amount of target sequence in sample Rapid, no post-amplification processing steps

6 Real-time PCR : results

7 Typical cycling conditions 94 C - 15 sec 40 cycles 60 C - 60 sec

8 TaqMan real-time PCR PCR amplification Cleavage of a fluorescent probe

9 Typical Amplicon Typical TaqMan amplicon bp. PRIMER F PROBE PRIMER R

10 TaqMan

11 TaqMan

12 TaqMan

13 TaqMan

14 TaqMan

15 TaqMan

16 TaqMan

17 TaqMan

18 TaqMan

19 Real-time PCR chemistries SYBR Green Molecular beacons Scorpion primers LUX Displacement probes Cycleave Wong & Medrano 2005 BioTechniques 39:75-85

20 Data Analysis A positive result is defined as a value greater than the established threshold Signal strength of reporter dye increases proportionately as the level of input DNA increases C T is predictive of input target quantity Use of C T permits a wider linear range than using R N

21 Real-time PCR: data analysis Different amounts of template can lead to similar ΔRn values

22 SYBR Green I Assay SYBR Green I dye fluoresces when bound to double-stranded DNA

23 SYBR Green I Assay When DNA is denatured, SYBR Green I dye is released and the fluorescence signal is reduced

24 SYBR Green I Assay During amplification, a double stranded amplicon accumulates, which results in a net increase in the amount of dye binding and fluorescence

25

26

27 Advantages to SYBR Green I Ideally suited for rapid screening Lower costs than a probe-based assay Simple way of monitoring accumulating amplicon Couple with melting curve (T M ) analysis to increase assay specificity

28 Disadvantages to SYBR Green I Assay Detect accumulation of both specific and nonspecific PCR products, thus resulting in a lower specificity than a probe-based assay

29 Advantages to Real-Time Rapid turn-around-time Ease of performing quantitative assays Ability to perform a multiplex assay Reduced risk of contamination using a closed system High level of assay specificity when using a probe Post-PCR processing is eliminated, which reduces labor and material costs

30 Disadvantages Requires the synthesis of different probes for different target Stringent rules for primer and probe design means that conversion from a conventional assay to a real-time one may require assay modifications Royalty payments for additional patents may be necessary

31 X. arboricola pv. fragariae Real-time PCR assay designed to prolyl endopeptidase (pep) gene sequence Weller, S.A., Beresford-Jones, N.J., Hall, J., Thwaites, R., Parkinson, N. and Elphinstone, J.G. (2007) Detection of Xanthomonas fragariae and presumptive detection of Xanthomonas arboricola pv. fragariae, from strawberry leaves, by real-time PCR. Journal of Microbiological Methods

32 X. arboricola pv. fragariae assay Real-time PCR assay designed by alignment of pep gene sequences of related Xanthomonas strains X arboricola cacacgtgcccctccaaaacccggaattggcccggaaaccggcaaaaaagggccacccacccgggcgccaagccccccggccaaag X campestris ccagcgtgcgcatcccgcagcc---gcatggcccgggcgccggcaaga cggctgcgcaa------ggcaaggccaccggcaacga X axonopodis ccagcgtgcgcattccgcagcc---gcatggcccggaagcaggcaagaa----cgccaaggccagcggcaagcccaccggtaacga X fragariae ccagcgtgcgcgtgccgcagcc---ttacggcaccaaggcaggcaaaa----ctgcaactgctggcggcaaacccaccggcaacga Xf arboricola ccagcgtgcgcgtgccgcagcc---gcatgggccggaaaccggcaaga----aggcaagcgccggcgccaagcccaccggcaacga

33 Real-time PCR 71 assays in use on a daily basis at CSL 31 virus assays 28 fungal assays 7 bacterial assays 5 invertebrates

34 Real-time PCR - conclusions Generic technology Quantitative Sensitive For high-throughput testing Portable/de-centralised testing