PCR and Real-time PCR. Richard Thwaites Plant Health Group, CSL

Save this PDF as:

Size: px
Start display at page:

Download "PCR and Real-time PCR. Richard Thwaites Plant Health Group, CSL"


1 PCR and Real-time PCR Richard Thwaites Plant Health Group, CSL

2 Conventional PCR Amplification of a specific target DNA sequence DNA amplified between primers Target sequences typically 150 bp or more Requires post-pcr procedures

3 Conventional PCR

4 Conventional PCR gel electrophoresis PCR products resolved by observing DNA stained on a gel

5 Real-time PCR Fluorescence is used as a measure of amplicon production Enables real-time analysis, e.g. at each PCR cycle Allows quantification of initial amount of target sequence in sample Rapid, no post-amplification processing steps

6 Real-time PCR : results

7 Typical cycling conditions 94 C - 15 sec 40 cycles 60 C - 60 sec

8 TaqMan real-time PCR PCR amplification Cleavage of a fluorescent probe

9 Typical Amplicon Typical TaqMan amplicon bp. PRIMER F PROBE PRIMER R

10 TaqMan

11 TaqMan

12 TaqMan

13 TaqMan

14 TaqMan

15 TaqMan

16 TaqMan

17 TaqMan

18 TaqMan

19 Real-time PCR chemistries SYBR Green Molecular beacons Scorpion primers LUX Displacement probes Cycleave Wong & Medrano 2005 BioTechniques 39:75-85

20 Data Analysis A positive result is defined as a value greater than the established threshold Signal strength of reporter dye increases proportionately as the level of input DNA increases C T is predictive of input target quantity Use of C T permits a wider linear range than using R N

21 Real-time PCR: data analysis Different amounts of template can lead to similar ΔRn values

22 SYBR Green I Assay SYBR Green I dye fluoresces when bound to double-stranded DNA

23 SYBR Green I Assay When DNA is denatured, SYBR Green I dye is released and the fluorescence signal is reduced

24 SYBR Green I Assay During amplification, a double stranded amplicon accumulates, which results in a net increase in the amount of dye binding and fluorescence



27 Advantages to SYBR Green I Ideally suited for rapid screening Lower costs than a probe-based assay Simple way of monitoring accumulating amplicon Couple with melting curve (T M ) analysis to increase assay specificity

28 Disadvantages to SYBR Green I Assay Detect accumulation of both specific and nonspecific PCR products, thus resulting in a lower specificity than a probe-based assay

29 Advantages to Real-Time Rapid turn-around-time Ease of performing quantitative assays Ability to perform a multiplex assay Reduced risk of contamination using a closed system High level of assay specificity when using a probe Post-PCR processing is eliminated, which reduces labor and material costs

30 Disadvantages Requires the synthesis of different probes for different target Stringent rules for primer and probe design means that conversion from a conventional assay to a real-time one may require assay modifications Royalty payments for additional patents may be necessary

31 X. arboricola pv. fragariae Real-time PCR assay designed to prolyl endopeptidase (pep) gene sequence Weller, S.A., Beresford-Jones, N.J., Hall, J., Thwaites, R., Parkinson, N. and Elphinstone, J.G. (2007) Detection of Xanthomonas fragariae and presumptive detection of Xanthomonas arboricola pv. fragariae, from strawberry leaves, by real-time PCR. Journal of Microbiological Methods

32 X. arboricola pv. fragariae assay Real-time PCR assay designed by alignment of pep gene sequences of related Xanthomonas strains X arboricola cacacgtgcccctccaaaacccggaattggcccggaaaccggcaaaaaagggccacccacccgggcgccaagccccccggccaaag X campestris ccagcgtgcgcatcccgcagcc---gcatggcccgggcgccggcaaga cggctgcgcaa------ggcaaggccaccggcaacga X axonopodis ccagcgtgcgcattccgcagcc---gcatggcccggaagcaggcaagaa----cgccaaggccagcggcaagcccaccggtaacga X fragariae ccagcgtgcgcgtgccgcagcc---ttacggcaccaaggcaggcaaaa----ctgcaactgctggcggcaaacccaccggcaacga Xf arboricola ccagcgtgcgcgtgccgcagcc---gcatgggccggaaaccggcaaga----aggcaagcgccggcgccaagcccaccggcaacga

33 Real-time PCR 71 assays in use on a daily basis at CSL 31 virus assays 28 fungal assays 7 bacterial assays 5 invertebrates

34 Real-time PCR - conclusions Generic technology Quantitative Sensitive For high-throughput testing Portable/de-centralised testing

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results

Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Optimizing Real Time PCR: A Focused Approach for Exceptional Real-Time qpcr Results Michael Wakem M.Sc Bio-Rad Laboratories Canada Ltd (800) 268-0213 Ext 3360 michael_wakem@bio-rad.com Overview Fundamentals

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Applications Guide. Real-Time PCR Applications Guide

Applications Guide. Real-Time PCR Applications Guide Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time

More information

Methods and Application Guide. Introduction to Quantitative PCR

Methods and Application Guide. Introduction to Quantitative PCR Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304

More information

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

Introduction to Quantitative PCR

Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770

More information

Highly specific and sensitive quantitation

Highly specific and sensitive quantitation PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Validating Microarray Data Using RT 2 Real-Time PCR Products

Validating Microarray Data Using RT 2 Real-Time PCR Products Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

Real-time PCR handbook

Real-time PCR handbook Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time

More information

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,

More information

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems

Reagent Guide. Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Applied Biosystems StepOne and StepOnePlus Real-Time PCR Systems Reagent Guide Copyright 2008, 2010 Applied Biosystems. All

More information

REAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE

REAL-TIME PCR: Put the odds in your favor with SuperScript RT. FROM THEORY TO PRACTICE i REAL-TIME PCR: FROM THEORY TO PRACTICE ii Put the odds in your favor with SuperScript RT. Engineered to be RNase H and incredibly thermostable, SuperScript III RT delivers robust first-strand synthesis

More information

Absolute Quantification Getting Started Guide

Absolute Quantification Getting Started Guide 5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension

Application Note. Biotechnology Explorer Crime Scene Investigator PCR Basics. Kit: A Real-Time PCR Extension Biotechnology Explorer Crime Scene Investigator PCR Basics Kit: Table of Contents Introduction.............................................. 2 Learning Objectives......................................

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information

Realtime PCR Master Mix

Realtime PCR Master Mix Instruction manual Realtime PCR Master Mix 0810 F0923K Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol 1. TaqMan assay

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

Quando si parla di PCR quantitativa si intende:

Quando si parla di PCR quantitativa si intende: Quando si parla di PCR quantitativa si intende: A. Una PCR che produce grandi quantità di DNA B. Una PCR che emette quanti di luce C. Una PCR che quantifica il numero di molecole stampo presenti all inizio

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System

Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Optimizing and Analyzing Real-Time Assays on the SmartCycler II System Cepheid Technical Support Overview This technical note provides guidelines on transferring, optimizing, and evaluating real-time PCR

More information

Scorpions Technology for Real Time PCR and Genotyping

Scorpions Technology for Real Time PCR and Genotyping Scorpions Technology for Real Time PCR and Genotyping Outline Origins of Scorpions Principles of Scorpions Performance Applications Conclusions Origins of Scorpions A Bit of History At Zeneca Diagnostics,

More information

Considerations for standardizing qpcr assays.

Considerations for standardizing qpcr assays. Considerations for standardizing qpcr assays. qpcr Satellite Symposium BioCity Leipzig March 10-11, 11, 2005 Reinhold Mueller, PhD Senior Staff Scientist Outline: Introduction Controls, references and

More information

Fluorescent dyes for use with the

Fluorescent dyes for use with the Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany

More information

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput

Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput amplification tech note 5362 Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput Daniel Sullivan, Babette Fahey, and David Titus, Bio-Rad Laboratories, Inc., Waltham, MA

More information

Fundamentals of Real-Time PCR. Poupak Farahani, Ph.D. Senior Product Specialist

Fundamentals of Real-Time PCR. Poupak Farahani, Ph.D. Senior Product Specialist Fundamentals of Real-Time PCR Poupak Farahani, Ph.D. Senior Product Specialist Polymerase Chain Reaction (PCR) Unamplified DNA Strand Denaturation Primer annealing PCR Primer extension Dreischrittreaktion

More information

GoTaq Amplification Maximum performance, flexibility, control and convenience

GoTaq Amplification Maximum performance, flexibility, control and convenience GoTaq Amplification Maximum performance, flexibility, control and convenience GoTaq products and formulations designed to improve your amplification needs Reverse Transcription GoScript Reverse Transcriptase

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

Brilliant QPCR Master Mix

Brilliant QPCR Master Mix Brilliant QPCR Master Mix Instruction Manual Catalog #600549 (single kit) #929549 (10-pack kit) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600549-12 LIMITED PRODUCT WARRANTY This

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian

More information

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September

More information

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication

More information

The AB7900Fast and Principles of Real Time PCR

The AB7900Fast and Principles of Real Time PCR The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information


PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Quantitative Real Time PCR Protocol. Stack Lab

Quantitative Real Time PCR Protocol. Stack Lab Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Quantitative Telomerase Detection Kit (QTD Kit)

Quantitative Telomerase Detection Kit (QTD Kit) Quantitative Telomerase Detection Kit (QTD Kit) Catalog No. MT3010, MT3011, MT3012 For Research Use Only. Not for use in diagnostic procedures 1 Table of Contents 1. Introduction Background Product Overview

More information

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A.

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A. Pitfalls in qpcr Primer and probe design and synthesis Mary Span Eurogentec S.A. Steps in qpcr assay Set up experiment statistical relevant # samples/experimental group controls Design and synthesis primers

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

Brilliant II QRT-PCR Master Mix with ROX, 1-Step

Brilliant II QRT-PCR Master Mix with ROX, 1-Step Brilliant II QRT-PCR Master Mix with ROX, 1-Step Instruction Manual Catalog #600838 (Brilliant II QRT-PCR High ROX Master Mix, 1-Step) #600837 (Brilliant II QRT-PCR Low ROX Master Mix, 1-Step) #600842

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide Table of Contents qpcr Technical Guide Introduction... 1 Quantitative PCR: How does it work?... 2 qpcr

More information

Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial

Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds. Overview. Data Analysis Tutorial Data Analysis on the ABI PRISM 7700 Sequence Detection System: Setting Baselines and Thresholds Overview In order for accuracy and precision to be optimal, the assay must be properly evaluated and a few

More information

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BB BioBank control cdna

BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BB BioBank control cdna BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign

More information

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Real Time PCR and the icycler iq Real Time PCR Detection System for Quantitative PCR

Real Time PCR and the icycler iq Real Time PCR Detection System for Quantitative PCR eal Time PC and the icycler iq eal Time PC Detection System for Quantitative PC PC FOMULA Correlazione tra la quantità di amplificato e la quantita iniziale Y = X (1 + E) n -1 Y = PC amplificato DNA quantità

More information

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Chemistry Guide Copyright 2004 Applied Biosystems. All rights reserved. For Research Use Only.

More information

Human Herpes Virus 4 (Epstein Barr)

Human Herpes Virus 4 (Epstein Barr) Techne qpcr test Human Herpes Virus 4 (Epstein Barr) nonglycosylated membrane protein (BNRF1) gene 150 tests For general laboratory and research use only 1 Introduction to Human Herpes Virus 4 (Epstein

More information

All-in-One mirna qrt-pcr Detection System Handbook

All-in-One mirna qrt-pcr Detection System Handbook All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)

More information

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

Quantitative PCR Systems

Quantitative PCR Systems QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE FULL-FEATURED FLEXIBLE

More information

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems

Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Real-Time PCR Systems Applied Biosystems 7900HT Fast Real-Time PCR System and 7300/7500 Real-Time PCR Systems Chemistry Guide Copyright 2005 Applied Biosystems. All rights reserved. For Research Use Only.

More information


Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES UNIT.3 Real-Time PCR Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland,

More information

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation Roche Applied Science Technical Note No. LC 19/2004 Purpose of this Note Color The LightCycler System is able to simultaneously detect and analyze more than one color in each capillary. Due to overlap

More information

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents Scientific Working Group on DNA Analysis Methods Validation Guidelines for DNA Analysis Methods Table of Contents Introduction.2 1. Definitions. 2 2. General Considerations 3 3. Developmental Validation..5

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information


Real-Time PCR UNIT 10.3 OVERVIEW AND PRINCIPLES UNIT.3 Dean Fraga, 1 Tea Meulia, 2 and Steven Fenster 3 1 College of Wooster, Wooster, Ohio 2 Ohio Agricultural Research and Development Center, Wooster, Ohio 3 Ashland University, Ashland, Ohio OVERVIEW

More information

Novel In-process Monitoring Tools for Improving Accuracy and Reproducibility of RT-qPCR Results. Dirk Schacht, Global Product Manager, June 2015

Novel In-process Monitoring Tools for Improving Accuracy and Reproducibility of RT-qPCR Results. Dirk Schacht, Global Product Manager, June 2015 Novel In-process Monitoring Tools for Improving Accuracy and Reproducibility of RT-qPCR Results Dirk Schacht, Global Product Manager, June 2015 In-process monitoring tools for RT-qPCR 1 4-Part webinar

More information

Real-time qpcr Assay Design Software www.qpcrdesign.com

Real-time qpcr Assay Design Software www.qpcrdesign.com Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488

More information

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System

Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System 5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

Introduction to Gene Expression. Getting Started Guide

Introduction to Gene Expression. Getting Started Guide Introduction to Gene Expression Getting Started Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without

More information

KAPA Library Quantification Kits For Illumina sequencing platforms

KAPA Library Quantification Kits For Illumina sequencing platforms Technical Data Sheet KAPA Library Quantification Kits For Illumina sequencing platforms Kit code KK4824 KK4601: Components KAPA SYBR FAST Universal qpcr Kit 1. Product Description Accurate quantification

More information

PrimeTime. qpcr Application Guide. Experimental Overview, Protocol, Troubleshooting Fourth Edition

PrimeTime. qpcr Application Guide. Experimental Overview, Protocol, Troubleshooting Fourth Edition PrimeTime qpcr Application Guide Experimental Overview, Protocol, Troubleshooting Fourth Edition qpcr Application Guide Experimental Overview, Protocol, Troubleshooting Fourth Edition Managing Editors

More information

amplification tech A Practical Guide to High Resolution Melt Analysis Genotyping

amplification tech A Practical Guide to High Resolution Melt Analysis Genotyping amplification tech note 6004 A Practical Guide to High Resolution Melt Analysis Genotyping Sean Taylor, Rachel Scott, Richard Kurtz, Carl Fisher, Viresh Patel, and Frank Bizouarn, Bio-Rad Laboratories,

More information

Gene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program

Gene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program WHITE PAPER TaqMan Assays QPCR Guarantee Program Gene Expression Assay Performance Guaranteed With the TaqMan Assays QPCR Guarantee Program Real-Time PCR for the Quantification of Gene Expression Real-time

More information

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems

Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems Technical Manual Plexor Systems Instrument Setup and Data Analysis for the Applied Biosystems 7300 and 7500 Real-Time PCR Systems INSTRUCTIONS FOR USE OF PRODUCTS A4011, A4021, A4031, A4041, A4051 AND

More information

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd.

Lyme Disease RecA gene. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... 150 tests. Primerdesign Ltd. TM Primerdesign Ltd TM Primerdesign Ltd Lyme Disease RecA gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use only 1 Introduction

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

sirna Duplexes & RNAi Explorer

sirna Duplexes & RNAi Explorer P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01

More information



More information

Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix

Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix Brilliant III Ultra-Fast SYBR Green QRT-PCR Master Mix Instruction Manual Catalog #600886 (single kit) #600887 (10-pack kit) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600886-12

More information

Absolute Quantitation Using Standard Curve Getting Started Guide

Absolute Quantitation Using Standard Curve Getting Started Guide Applied Biosystems 7900HT Fast Real-Time PCR System Absolute Quantitation Using Standard Curve Getting Started Guide Introduction Designing an AQ Experiment Preparing the Samples and Reaction Plate Creating

More information

Competitive PCR Guide

Competitive PCR Guide Lit. # L0126 Rev. 8/99 Competitive PCR Guide Table of Contents I. What is Competitive PCR? A. Difficulties of Quantitative Analysis in Normal PCR... 2 B. Principle of Competitive PCR... 3 C. Competitive

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07

Lyme Disease. RecA gene. 150 tests. Quantification of Lyme Disease genomes. Advanced kit handbook HB10.03.07 Techne qpcr test Lyme Disease RecA gene 150 tests For general laboratory and research use only 1 Introduction to Lyme Disease Lyme disease is an infectious disease caused mainly by three species of bacteria

More information

Fast SYBR Green Master Mix. Protocol

Fast SYBR Green Master Mix. Protocol Fast SYBR Green Master Mix Protocol Copyright 2007, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document is subject to

More information