pcdna 5/FRT Vector Expression vector designed for use with the Flp-In System user guide Catalog Number V
|
|
|
- Jasper Manning
- 9 years ago
- Views:
Transcription
1 user guide pcdna 5/FRT Vector Expression vector designed for use with the Flp-In System Catalog Number V Revision Date 12 September 2012 Publication Part Number MAN For Research Use Only. Not for human or animal therapeutic or diagnostic use.
2 ii
3 Contents Kit Contents and Storage...iv Accessory Products... v Introduction... 1 Overview... 1 Methods... 3 Cloning into pcdna 5/FRT... 3 Transfection... 5 Appendix... 7 Map of pcdna 5/FRT Vector... 7 Features of pcdna 5/FRT Vector... 8 pcdna 5/FRT/CAT Vector... 9 Technical Support Purchaser Notification References iii
4 Kit Contents and Storage Shipping/Storage The pcdna 5/FRT Vectors are shipped on wet ice. Upon receipt, store at 20 C. Kit Contents The following vectors are provided with pcdna 5/FRT: Vector Quantity Contents pcdna 5/FRT 20 μg 40 μl of 0.5 μg/μl pcdna 5/FRT in 10 mm Tris HCl, 1 mm EDTA, ph 8.0. pcdna 5/FRT/CAT 20 μg 40 μl of 0.5 μg/μl pcdna 5/ FRT/CAT in 10 mm Tris HCl, 1 mm EDTA, ph 8.0. Product Use For Research Use Only. Not for human or animal therapeutic or diagnostic use. iv
5 Accessory Products Accessory Products Additional products available from Life Technologies are listed below. For more information, visit our website at or contact Technical Support (page 10). Product Amount Catalog No. T7 Promoter Primer 2 μg, lyophilized N Zeocin 1 g 5 g R R Hygromycin 1 g R pfrt/laczeo 20 μg, suspended as 40 μl of 0.5 μg/μl pfrt/ laczeo in 10 mm Tris HCl, 1 mm EDTA, ph 8.0. V pfrt/laczeo2 20 μg, suspended as 40 μl of 0.5 μg/μl pfrt/ laczeo2 in 10 mm Tris HCl, 1 mm EDTA, ph 8.0. V pog44 20 μg, suspended as 40 μl of 0.5 μg/μl pog44 in 10 mm Tris HCl, 1 mm EDTA, ph 8.0. V reactions C One Shot Kit 20 reactions C (TOP10 Chemically Competent Cells) 40 reactions C One Shot Kit 10 reactions C (TOP10 Electrocompetent Cells) 20 reactions C Flp-In Expression Vectors Additional Flp-In expression vectors are available from Life Technologies. For more information about the features of each vector, visit our website at or contact Technical Support (page 10). Product Amount Catalog No. pcdna 5/FRT/V5-His TOPO TA Expression Kit 1 kit K psectag/frt/v5-his TOPO TA Expression Kit 1 kit K pef5/frt/v5 Directional TOPO Expression Kit 1 kit K pef5/frt/v5-dest Gateway Vector Pack 6 μg, supplied as 40 μl of 150ng/μL vector in 10 mm Tris HCl, 1 mm EDTA, ph 8.0 V Continued on next page v
6 Accessory Products, continued Flp-In Host Cell Lines For your convenience, Life Technologies has available several mammalian Flp-In host cell lines that stably express the lacz-zeocin fusion gene from pfrt/laczeo or pfrt/laczeo2. Each cell line contains a single integrated FRT site as confirmed by Southern blot analysis. The cell lines should be maintained in medium containing Zeocin. For more information, visit our website at or contact Technical Support (page 10). Cell Line Amount Catalog No. Flp-In cells, frozen R Flp-In -CV cells, frozen R Flp-In -CHO cells, frozen R Flp-In -BHK cells, frozen R Flp-In -3T cells, frozen R Flp-In -Jurkat cells, frozen R vi
7 Introduction Overview Introduction pcdna 5/FRT is a 5.1 kb expression vector designed for use with the Flp-In System (Catalog nos. K and K ) available from Life Technologies. When cotransfected with the pog44 Flp recombinase expression plasmid into a Flp-In mammalian host cell line, the pcdna 5/FRT vector containing the gene of interest is integrated in a Flp recombinase-dependent manner into the genome. The vector contains the following elements: The human cytomegalovirus (CMV) immediate-early enhancer/promoter for high-level constitutive expression of the gene of interest in a wide range of mammalian cells (Andersson et al., 1989; Boshart et al., 1985; Nelson et al., 1987) Multiple cloning site with 10 unique restriction sites to facilitate cloning the gene of interest FLP Recombination Target (FRT) site for Flp recombinase-mediated integration of the vector into the Flp-In host cell line (see next page for more information) Hygromycin resistance gene for selection of stable cell lines (Gritz & Davies, 1983) The control plasmid, pcdna 5/FRT/CAT, is included for use as a positive control for transfection and expression in the Flp-In host cell line of choice. For more information about the Flp-In System, the pog44 plasmid, and generation of the Flp-In host cell line, refer to the Flp-In System manual. The Flp-In System manual is supplied with the Flp-In Complete or Core Systems, but is also available for downloading from our Website ( or by contacting Technical Support (see page 10). A Note About pcdna 5/FRT The pcdna 5/FRT vector contains a single FRT site immediately upstream of the hygromycin resistance gene for Flp recombinase-mediated integration and selection of the pcdna 5/FRT plasmid following cotransfection of the vector (with pog44) into Flp-In mammalian host cells. The FRT site serves as both the recognition and cleavage site for the Flp recombinase and allows recombination to occur immediately adjacent to the hygromycin resistance gene. The Flp recombinase is expressed from the pog44 plasmid. For more information about the FRT site and recombination, see the next page. For more information about pog44, refer to the Flp-In System manual. Important The hygromycin resistance gene in pcdna 5/FRT lacks a promoter and an ATG initiation codon; therefore, transfection of the pcdna 5/FRT plasmid alone into mammalian host cells will not confer hygromycin resistance to the cells. The SV40 promoter and ATG initiation codon required for expression of the hygromycin resistance gene are integrated into the genome (in the Flp-In host cell line) and are only brought into the correct proximity and frame with the hygromycin resistance gene through Flp recombinase-mediated integration of pcdna 5/FRT at the FRT site. For more information about the generation of the Flp-In host cell line and details of the Flp-In System, refer to the Flp-In System manual. Continued on next page 1
8 Overview, Continued Flp Recombinase- Mediated DNA Recombination In the Flp-In System, integration of your pcdna 5/FRT expression construct into the genome occurs via Flp recombinase-mediated intermolecular DNA recombination. The hallmarks of Flp-mediated recombination are listed below. Recombination occurs between specific FRT sites (see below) on the interacting DNA molecules. Recombination is conservative and requires no DNA synthesis; the FRT sites are preserved following recombination and there is minimal opportunity for introduction of mutations at the recombination site. Strand exchange requires only the small 34 bp minimal FRT site (see below). For more information about the Flp recombinase and conservative site-specific recombination, refer to published reviews (Craig, 1988; Sauer, 1994). FRT Site The FRT site, originally isolated from Saccharomyces cerevisiae, serves as a binding site for Flp recombinase and has been well-characterized (Gronostajski & Sadowski, 1985; Jayaram, 1985; Sauer, 1994; Senecoff et al., 1985). The minimal FRT site consists of a 34 bp sequence containing two 13 bp imperfect inverted repeats separated by an 8 bp spacer that includes an Xba I restriction site (see figure below). An additional 13 bp repeat is found in most FRT sites, but is not required for cleavage (Andrews et al., 1985). While Flp recombinase binds to all three of the 13 bp repeats, strand cleavage actually occurs at the boundaries of the 8 bp spacer region (see figure below) (Andrews et al., 1985; Senecoff et al., 1985). Minimal FRT site CS GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC Xba I CS CS = cleavage site Experimental Outline The following table outlines the steps required to clone and express your gene of interest in pcdna 5/FRT. Step Action 1 Consult the multiple cloning site diagrammed on page 4 to design your cloning strategy. 2 Ligate your insert into pcdna 5/FRT and transform into E. coli. Select transformants on μg/ml ampicillin. 3 Analyze your transformants for the presence of insert by restriction digestion. 4 Select a transformant with the correct restriction pattern and sequence to confirm that your gene is cloned in the correct orientation. 5 Cotransfect your pcdna 5/FRT construct and pog44 into the Flp-In host cell line using your own method of choice and select for hygromycin resistant clones (see the Flp-In System manual for more information). 6 Assay for expression of the gene of interest. 2
9 Cloning into pcdna 5/FRT Methods Introduction A diagram is provided on the next page to help you clone your gene of interest into pcdna 5/FRT. General considerations for cloning and transformation are listed below. General Molecular Biology Techniques For help with DNA ligations, E. coli transformations, restriction enzyme analysis, DNA sequencing, and DNA biochemistry, refer to Molecular Cloning: A Laboratory Manual (Sambrook et al., 1989) or Current Protocols in Molecular Biology (Ausubel et al., 1994). E. coli Strain Many E. coli strains are suitable for the propagation and maintenance of this vector. We recommend that you propagate vectors containing inserts in E. coli strains that are recombination deficient (reca) and endonuclease A deficient (enda). For your convenience, TOP10 is available as chemically competent or electrocompetent cells from Life Technologies (page v). Transformation Method You may use any method of your choice for transformation. Chemical transformation is the most convenient method for many researchers. Electroporation is the most efficient and the method of choice for large plasmids. Maintenance of Plasmids To propagate and maintain the pcdna 5/FRT and pcdna 5/FRT/CAT vectors, we recommend using 10 ng of the vector to transform a reca, enda E. coli strain like TOP10, DH5α, JM109, or equivalent. Select transformants on LB agar plates containing μg/ml ampicillin. Be sure to prepare a glycerol stock of each plasmid for long-term storage (see page 4). Cloning Considerations Your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation (Kozak, 1987; Kozak, 1990; Kozak, 1991). An example of a Kozak consensus sequence is provided below. Other sequences are possible, but the G or A at position 3 and the G at position +4 (shown in bold) illustrates the most commonly occurring sequence with strong consensus. Replacing one of the two bases at these positions provides moderate consensus, while having neither results in weak consensus. The ATG initiation codon is shown underlined. (G/A)NNATGG Your insert must also contain a stop codon for proper termination of your gene. Continued on next page 3
10 Cloning into pcdna 5/FRT, Continued Multiple Cloning Site of pcdna 5/FRT Below is the multiple cloning site for pcdna 5/FRT. Restriction sites are labeled to indicate the cleavage site. The multiple cloning site has been confirmed by sequencing and functional testing. The complete sequence of pcdna 5/FRT is available for downloading from our website at or from Technical Support (page 10). For a map and a description of the features of pcdna 5/FRT, refer to the Appendix, pages 7 8. CMV promoter CAAT AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG CMV forward priming site 3' end of CMV promoter putative transcriptional start TATA GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA T7 promoter/priming site Nhe I CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGC Pme I* Afl II Hind III Asp718 I Kpn I Bam H I Bst X I* GTTTAAACTT AAGCTTGGTA CCGAGCTCGG ATCCACTAGT CCAGTGTGGT GGAATTCTGC Eco R V Bst X I* Not I Xho I Apa I Pme I* AGATATCCAG CACAGTGGCG GCCGCTCGAG TCTAGAGGGC CCGTTTAAAC CCGCTGATCA BGH reverse priming site GCCTCGACTG TGCCTTCTAG TTGCCAGCCA TCTGTTGTTT GCCCCTCCCC CGTGCCTTCC *Note: there are two Pme I sites and two BstX I sites in the polylinker. E. coli Transformation Transform your ligation mixtures into a competent reca, enda E. coli strain (e.g., TOP10, DH5α ) and select on LB agar plates containing μg/ml ampicillin. Select clones and analyze for the presence and orientation of your insert. RECOMMENDATION We recommend that you sequence your construct to confirm that your gene is in the correct orientation for expression and contains an ATG initiation codon and a stop codon. To sequence your construct, we suggest using the T7 Promoter and BGH Reverse primer sequences. See page 4 for sequences and location of primer binding sites. For your convenience, Life Technologies offers the T7 Promoter Primer (page v) as well as custom primer services. For more information on custom primer services, visit or contact Technical Support (page 10). Preparing a Glycerol Stock Once you have identified the correct clone, purify the colony and make a glycerol stock for long-term storage. You should keep a DNA stock of your plasmid at 20 C. Streak the original colony out on an LB plate containing 50 μg/ml ampicillin. Incubate the plate at 37 C overnight. Isolate a single colony and inoculate into 1 2 ml of LB containing 50 μg/ml ampicillin. Grow the culture to mid-log phase (OD 600 = ). Mix 0.85 ml of culture with 0.15 ml of sterile glycerol and transfer to a cryovial. Store at 80 C. 4
11 Transfection Introduction Once you have cloned your gene of interest into pcdna 5/FRT and have prepared clean plasmid preparations of your pcdna 5/FRT construct and pog44, you are ready to cotransfect the plasmids into your mammalian Flp-In host cell line to generate your stable Flp-In expression cell line. We recommend that you include the pcdna 5/FRT/CAT positive control vector and a mock transfection (negative control) to evaluate your results. General information about transfection and selection is provided below. Specific guidelines and protocols for generation of the Flp-In expression cell line can be found in the Flp-In System manual. For detailed information about pog44 and generation of the Flp-In host cell line, refer to the Flp-In System manual. RECOMMENDATION Several Flp-In host cell lines which stably express the lacz-zeocin fusion gene from pfrt/laczeo or pfrt/laczeo2 and which contain a single integrated FRT site are available from Life Technologies (see page vi for ordering information). If you wish to express your gene of interest in 293, CV-1, CHO, 3T3, BHK, or Jurkat cells, may want to use one of Flp-In cell lines as the host to establish your stable expression cell line. For more information, visit our website or contact Technical Support (see page 10). Important We have observed down-regulation of the viral CMV promoter and subsequent loss of gene expression when pcdna 5/FRT-based expression constructs are introduced into 3T3 or BHK cells. This behavior is not observed with pef5/frtbased expression constructs. If you are generationg Flp-In expression cell lines using a 3T3 or BHK host cell line, we recommend that you clone your gene of interest into a pef5/frt-based expression plasmid (e.g., pef5/frt/v5-d- TOPO or pef5/frt/v5-dest). For more information, visit our website or contact Technical Support (see page 10). Plasmid Preparation Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride. Contaminants will kill the cells, and salt will interfere with lipid complexing, decreasing transfection efficiency. We recommend isolating plasmid DNA using the S.N.A.P. MiniPrep Kit (10 15 μg DNA, Catalog No. K ), the S.N.A.P. MidiPrep Kit ( μg DNA, Catalog No. K ), or CsCl gradient centrifugation. Positive Control pcdna 5/FRT/CAT is provided as a positive control vector for mammalian cell transfection and expression (see page 9) and may be used to assay for recombinant protein expression levels in your Flp-In expression cell line. Cotransfection of the positive control vector and pog44 into your Flp-In host cell line allows you to generate a stable cell line expressing chloramphenicol acetyl transferase (CAT) at the same genomic locus as your gene of interest. If you have several different Flp-In host cell lines, you may use the pcdna 5/FRT/CAT control vector to compare protein expression levels between the various cell lines. Continued on next page 5
12 Transfection, Continued Assay for CAT Protein The CAT protein expressed from the pcdna 5/FRT/CAT control plasmid is approximately 32 kda in size. You may assay for CAT expression by ELISA assay, Western blot analysis, fluorometric assay, or radioactive assay (Ausubel et al., 1994; Neumann et al., 1987). For Western blot analysis, you may use CAT Antiserum available from Life Technologies for detection. Other commercial kits to assay for CAT protein are available. Hygromycin B The pcdna 5/FRT vector contains the hygromycin resistance gene (Gritz & Davies, 1983) for selection of transfectants with the antibiotic, hygromycin B (Palmer et al., 1987). When added to cultured mammalian cells, hygromycin B acts as an aminocyclitol to inhibit protein synthesis. Hygromycin B liquid is supplied with the Flp-In Complete System and is also available separately from Life Technologies. For instructions to handle and store hygromycin B, refer to the Flp-In System manual. Determination of Hygromycin Sensitivity Before generating a stable cell line expressing your protein of interest (Flp-In expression cell line), we recommend that you generate a kill curve to determine the minimum concentration of hygromycin required to kill your untransfected Flp-In host cell line. Generally, concentrations between 10 and 400 μg/ml hygromycin are required for selection of most mammalian cell lines. General guidelines for performing a kill curve are provided in the Flp-In System manual. Generation of Flp- In Expression Cell Lines Refer to the Flp-In System manual for detailed guidelines and instructions to cotransfect your pcdna 5/FRT construct and pog44 into the Flp-In host cell line to generate stable Flp-In expression cell lines. 6
13 Map of pcdna 5/FRT Vector Appendix Map of pcdna 5/FRT The figure below summarizes the features of the pcdna 5/FRT vector. Note that the hygromycin resistance gene lacks a promoter and its native ATG start codon. Transfection of the pcdna 5/FRT plasmid alone into mammalian cells will not confer hygromycin resistance to the cells. The complete nucleotide sequence for pcdna 5/FRT is available for downloading from our website at or by contacting Technical Support (page 10). T7 Nhe I Pme I Afl II Hind III Asp718 I Kpn I BamH I BstX I EcoR V BstX I Not I Xho I Apa I Pme I P CMV BGH pa FRT Ampicillin pcdna5/frt 5070 bp Hygromycin Comments for pcdna5/frt 5070 nucleotides puc ori CMV promoter: bases CMV forward priming site: bases T7 promoter/priming site: bases Multiple cloning site: bases BGH reverse priming site: bases BGH polyadenylation signal: bases FRT site: bases Hygromycin resistance gene (no ATG): bases SV40 early polyadenylation signal: bases puc origin: bases (complementary strand) bla promoter: bases (complementary strand) Ampicillin (bla) resistance gene: bases (complementary strand) SV40 pa 7
14 Features of pcdna 5/FRT Vector Features of pcdna 5/FRT pcdna 5/FRT is a 5070 bp vector that expresses your gene of interest under the control of the human CMV promoter. The table below describes the relevant features of pcdna 5/FRT. All features have been functionally tested. Feature Human cytomegalovirus (CMV) immediate early promoter CMV Forward priming site T7 promoter/priming site Multiple cloning site pbgh Reverse priming site Bovine growth hormone (BGH) polyadenylation signal Flp Recombination Target (FRT) site Hygromycin resistance gene (no ATG) SV40 early polyadenylation signal puc origin bla promoter Ampicillin (bla) resistance gene (β-lactamase) Benefit Allows high-level expression of your gene of interest (Andersson et al., 1989; Boshart et al., 1985; Nelson et al., 1987). Allows sequencing in the sense orientation. Allows in vitro transcription in the sense orientation and sequencing through the insert. Allows insertion of your gene of interest. Allows sequencing of the non-coding strand. Allows efficient transcription termination and polyadenylation of mrna (Goodwin & Rottman, 1992). Encodes a 34 bp (+14 bp of non-essential) sequence that serves as the binding and cleavage site for Flp recombinase (Gronostajski & Sadowski, 1985; Jayaram, 1985; Senecoff et al., 1985). Allows selection of stable transfectants in mammalian cells (Gritz & Davies, 1983) when brought in frame with a promoter and an ATG initiation codon through Flp recombinase-mediated recombination via the FRT site. Allows efficient transcription termination and polyadenylation of mrna. Allows high-copy number replication and growth in E. coli. Allows expression of the ampicillin (bla) resistance gene. Allows selection of transformants in E. coli. 8
15 pcdna 5/FRT/CAT Vector Description pcdna 5/FRT/CAT is a 5858 bp control vector containing the gene for chloramphenicol acetyl transferase (CAT). This vector was constructed by ligating a 0.7 kb Xho I-Apa I fragment containing the CAT gene into the Xho I-Apa I site of pcdna 5/FRT. The CAT protein expressed from pcdna 5/FRT/CAT is approximately 32 kda in size. Map of pcdna 5/FRT/ CAT The figure below summarizes the features of the pcdna 5/FRT/CAT vector. The complete nucleotide sequence for pcdna 5/FRT/CAT is available for downloading from our website at or from Technical Support (page 10). T7 Nhe I Pme I Afl II Hind III Asp718 I Kpn I BamH I BstX I EcoR V BstX I Not I Xho I CAT Apa I Pme I P CMV BGH pa FRT Comments for pcdna5/frt/cat 5858 nucleotides Ampicillin pcdna5/frt/cat 5858 bp Hygromycin CMV promoter: bases CMV forward priming site: bases T7 promoter/priming site: bases Chloramphenicol acetyl transferase (CAT) gene: bases BGH reverse priming site: bases BGH polyadenylation signal: bases FRT site: bases Hygromycin resistance gene (no ATG): bases SV40 early polyadenylation signal: bases puc origin: bases (complementary strand) bla promoter: bases (complementary strand) Ampicillin (bla) resistance gene: bases (complementary strand) puc ori SV40 pa 9
16 Technical Support Obtaining Support For the latest services and support information for all locations, go to At the website, you can: Access worldwide telephone and fax numbers to contact Technical Support and Sales facilities Search through frequently asked questions (FAQs) Submit a question directly to Technical Support ([email protected]) Search for user documents, SDSs, vector maps and sequences, application notes, formulations, handbooks, certificates of analysis, citations, and other product support documents Obtain information about customer training Download software updates and patches Safety Data Sheets (SDS) Safety Data Sheets (SDSs) are available at Certificate of Analysis The Certificate of Analysis provides detailed quality control and product qualification information for each product. Certificates of Analysis are available on our website. Go to and search for the Certificate of Analysis by product lot number, which is printed on the box. Limited Product Warranty Life Technologies Corporation and/or its affiliate(s) warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on Life Technologies website at If you have any questions, please contact Life Technologies at 10
17 References Andersson, S., Davis, D. L., Dahlbäck, H., Jörnvall, H., and Russell, D. W. (1989) Cloning, Structure, and Expression of the Mitochondrial Cytochrome P-450 Sterol 26-Hydroxylase, a Bile Acid Biosynthetic Enzyme. J. Biol. Chem. 264, Andrews, B. J., Proteau, G. A., Beatty, L. G., and Sadowski, P. D. (1985) The FLP Recombinase of the 2 Micron Circle DNA of Yeast: Interaction with its Target Sequences. Cell 40, Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1994) Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Interscience, New York Boshart, M., Weber, F., Jahn, G., Dorsch-Häsler, K., Fleckenstein, B., and Schaffner, W. (1985) A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus. Cell 41, Craig, N. L. (1988) The Mechanism of Conservative Site-Specific Recombination. Ann. Rev. Genet. 22, Goodwin, E. C., and Rottman, F. M. (1992) The 3 -Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation. J. Biol. Chem. 267, Gritz, L., and Davies, J. (1983) Plasmid-Encoded Hygromycin-B Resistance: The Sequence of Hygromycin- B-Phosphotransferase Gene and its Expression in E. coli and S. Cerevisiae. Gene 25, Gronostajski, R. M., and Sadowski, P. D. (1985) Determination of DNA Sequences Essential for FLPmediated Recombination by a Novel Method. J. Biol. Chem. 260, Jayaram, M. (1985) Two-micrometer Circle Site-specific Recombination: The Minimal Substrate and the Possible Role of Flanking Sequences. Proc. Natl. Acad. Sci. USA 82, Kozak, M. (1987) An Analysis of 5 -Noncoding Sequences from 699 Vertebrate Messenger RNAs. Nucleic Acids Res. 15, Kozak, M. (1990) Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes. Proc. Natl. Acad. Sci. USA 87, Kozak, M. (1991) An Analysis of Vertebrate mrna Sequences: Intimations of Translational Control. J. Cell Biology 115, Nelson, J. A., Reynolds-Kohler, C., and Smith, B. A. (1987) Negative and Positive Regulation by a Short Segment in the 5 -Flanking Region of the Human Cytomegalovirus Major Immediate-Early Gene. Molec. Cell. Biol. 7, Neumann, J. R., Morency, C. A., and Russian, K. O. (1987) A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression. BioTechniques 5, Palmer, T. D., Hock, R. A., Osborne, W. R. A., and Miller, A. D. (1987) Efficient Retrovirus-Mediated Transfer and Expression of a Human Adenosine Deaminase Gene in Diploid Skin Fibroblasts from an Adenosine-Deficient Human. Proc. Natl. Acad. Sci. U.S.A. 84, Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Second Ed., Cold Spring Harbor Laboratory Press, Plainview, New York Sauer, B. (1994) Site-Specific Recombination: Developments and Applications. Curr. Opin. Biotechnol. 5, Senecoff, J. F., Bruckner, R. C., and Cox, M. M. (1985) The FLP Recombinase of the Yeast 2-micron Plasmid: Characterization of its Recombination Site. Proc. Natl. Acad. Sci. USA 82, Life Technologies Corporation. All rights reserved. The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners. Zeocin is a registered trademark of Cayla Sarl. 11
18 LIFE TECHNOLOGIES CORPORATION AND/OR ITS AFFILIATE(S) DISCLAIM ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT, EXPRESSED OR IMPLIED, INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE, OR NON-INFRINGEMENT. TO THE EXTENT ALLOWED BY LAW, IN NO EVENT SHALL LIFE TECHNOLOGIES AND/OR ITS AFFILIATE(S) BE LIABLE, WHETHER IN CONTRACT, TORT, WARRANTY, OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL, INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT, INCLUDING BUT NOT LIMITED TO THE USE THEREOF. 12
19
20 Headquarters 5791 Van Allen Way Carlsbad, CA USA Phone Toll Free in USA For support visit or
pog44 Flp-recombinase expression vector designed for use with the Flp-In System Catalog no. V6005-20 www.invitrogen.com tech_service@invitrogen.
pog44 Flp-recombinase expression vector designed for use with the Flp-In System Catalog no. V6005-20 Version B 021402 25-0352 www.invitrogen.com [email protected] ii Table of Contents Table of
NIH Mammalian Gene Collection (MGC)
USER GUIDE NIH Mammalian Gene Collection (MGC) Catalog number FL1002 Revision date 28 November 2011 Publication Part number 25-0610 MAN0000351 For Research Use Only. Not for diagnostic procedures. ii Table
pcdna 3.1(+) pcdna 3.1( )
pcdna 3.1(+) pcdna 3.1( ) Catalog nos. V790-20 and V795-20 Version K 10 November 2010 28-0104 User Manual ii Table of Contents Important Information...v Accessory Products...vi Methods... 1 Overview...1
One Shot TOP10 Competent Cells
USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.
Fluorescein Isothiocyanate (FITC)- conjugated Antibodies
USER GUIDE Fluorescein Isothiocyanate (FITC)- conjugated Antibodies Catalog Numbers R933-25, R953-25, R963-25 Document Part Number 25-0376 Publication Number MAN0000194 Revision 2.0 For Research Use Only.
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
How To Clone Into Pcdna 3.1/V5-His
pcdna 3.1/V5-His A, B, and C Catalog no. V810-20 Rev. date: 09 November 2010 Manual part no. 28-0141 MAN0000645 User Manual ii Contents Contents and Storage... iv Methods... 1 Cloning into pcdna 3.1/V5-His
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM PrOduct information content: - 20 mg of lyophilized pmod2-puro plasmid
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
Bacillus Subtilis Expression Vectors. Product Information and Instructions November 2005
Bacillus Subtilis Expression Vectors Product Information and Instructions November 2005 1 Content 1. Introduction... 3 2. The pht Vectors...4 2.1. Vector Map pht01...4 2.2. Vector Map pht43...5 2.3. Location
STOP. Before using this product, please read the Limited Use License statement below:
STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-rgfap The purchase of the pdrive5lucia-rgfap vector conveys
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305
MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305 The MGC premier Expression-Ready collection has the high quality,
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Before opening this package, please read the Limited Use License statement below:
STOP Before opening this package, please read the Limited Use License statement below: Important Limited Use License information for pcpgfree-ova The purchase of the pcpgfree-ova vector conveys to the
Growth and Maintenance of T-REx Cell Lines
USER GUIDE Growth and Maintenance of T-REx Cell Lines Catalog Numbers R710-07, R714-07, R718-07, R722-07 Document Part Number 25-0272 Publication Number MAN0000106 Revision 3.0 For Research Use Only. Not
Zeocin Selection Reagent
USER GUIDE Zeocin Selection Reagent Catalog nos. R250-01, R250-05 Revision date 19 January 2012 Publication Part number 25-0078 MAN0000019 For Research Use Only. Not intended for any animal or human therapeutic
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)
TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
LightSwitch Dual Assay System DA010 (100 assays)
LightSwitch Dual Assay System DA010 (100 assays)! Description The LightSwitch Dual Assay System is used to normalize for variation between transfection replicates in cell lines that are particularly difficult
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
Protein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
MEF Nucleofector Kit 1 and 2
page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Design of conditional gene targeting vectors - a recombineering approach
Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design
Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Chapter 11. Rapid Screening of Gli2/3 Mutants Using the Flp-In System. Pawel Niewiadomski and Rajat Rohatgi. Abstract.
Chapter 11 Rapid Screening of Gli2/3 Mutants Using the Flp-In System Abstract Gli2 and Gli3 respond to the Hedgehog (Hh) signal in mammals by undergoing posttranslational modifications and moving to the
TransIT -2020 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Mouse ES Cell Nucleofector Kit
page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
ptune Inducible Vector
ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
LAB 10 DNA TRANSFORMATION
LAB 10 DNA TRANSFORMATION STUDENT GUIDE GOAL The objective of this lab is to successfully perform DNA transformation of a recombinant plasmid and use blue-white selection to select recombinant clones.
Rapid GST Inclusion Body Solubilization and Renaturation Kit
Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
OpenArray Sample Tracker Software
QUICK REFERENCE OpenArray Sample Tracker Software For QuantStudio 12K Flex OpenArray Sample Block and the OpenArray Real-Time PCR System Publication Part Number 4460657 Rev. C Revision Date May 2012 Contents
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Molecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Qubit dsdna HS Assay Kits
Qubit dsdna HS Assay Kits For use with the Qubit 2.0 Fluorometer Table 1. Contents and storage information. Material Amount Concentration Storage Stability Qubit dsdna HS Reagent (Component A) 250 µl or
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH
Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies
Ms. Campbell Protein Synthesis Practice Questions Regents L.E.
Name Student # Ms. Campbell Protein Synthesis Practice Questions Regents L.E. 1. A sequence of three nitrogenous bases in a messenger-rna molecule is known as a 1) codon 2) gene 3) polypeptide 4) nucleotide
Compiled and/or written by Amy B. Vento and David R. Gillum
Fact Sheet Describing Recombinant DNA and Elements Utilizing Recombinant DNA Such as Plasmids and Viral Vectors, and the Application of Recombinant DNA Techniques in Molecular Biology Compiled and/or written
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS
STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY
Nucleic Acid Purity Assessment using A 260 /A 280 Ratios
Nucleic Acid Purity Assessment using A 260 /A 280 Ratios A common practice in molecular biology is to perform a quick assessment of the purity of nucleic acid samples by determining the ratio of spectrophotometric
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
The E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Gene Cloning. Reference. T.A. Brown, Gene Cloning, Chapman and Hall. S.B. Primrose, Molecular Biotechnology, Blackwell
Gene Cloning 2004 Seungwook Kim Chem. & Bio. Eng. Reference T.A. Brown, Gene Cloning, Chapman and Hall S.B. Primrose, Molecular Biotechnology, Blackwell Why Gene Cloning is Important? A century ago, Gregor
Bio 102 Practice Problems Recombinant DNA and Biotechnology
Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
Transformation of the bacterium E. coli. using a gene for Green Fluorescent Protein
Transformation of the bacterium E. coli using a gene for Green Fluorescent Protein Background In molecular biology, transformation refers to a form of genetic exchange in which the genetic material carried
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
