Research of Human Microbiome Sequencing and Comparison
|
|
- Allan Hampton
- 7 years ago
- Views:
Transcription
1 BIOTECHNOLOGY BULLETIN Research of Human Microbiome Sequencing and Comparison Xu Xiaoyu 1 Chen Jinghua 1 Liu He 2 1 School of Medicine and Pharmaceutical Jiangnan University Wuxi School of Environment and Civil Engineering Jiangnan University Wuxi Abstract The human microbiota which reside in or on the human body affect human heath and has closely associated to obesity diabetes coronary heart disease colon carcinoma. In recent years great importance has been attached in the research of human microbiome. The paper reviewed the progress of human microbiome sequencing and comparison. Key words Human microbiome Metagenomics Gut microbiota Oral microbiota % - 2% microbiome metagenome NIH Karen Nelson Human Microbiome Project HMP BE iist@ jiangnan. edu. cn
2 Grice S rrna K B12 Fierera % 13% Paulino 10 PCR MetaHIT Broad range PCR S /ITS Gao 11 16S rdna Elizabeth Kurokawa 15 18
3 68 Biotechnology Bulletin Xu Bacteroides thetaiotaomicron DNA Methanobrevibacter smithii Methanobrevibacter smithii Peer Bork Sanger 17 Eckburg DNA Sanger Li Firmicutes Bacteroidetes Proteobacteria Actinobacteria Verrucomicrobia Fusobacteria Bacteroidetes Firmicutes Methanobrevibacter smithii Gordon 16S S rrna 2008 NIH NIDCR
4 Burton Zaura S rrna 3 42% L. iners Lactobacillus 3 84% Zhou 16S rrna % 65% 3 16S rrna % 94% L. crispatus L. iners % Lactobacillus Atopobium vaginae 15 Lactobacillus Atopobi- Megasphaera Leptotrichia 3 Bik 28 PCR 10 um Lactobacillus T-RFLP gene-based 16S rrna Lazarevic PCR Lactobacillus V5 82 Illumina 135 Firmicutes Proteobacteria Actinobacteria Fusobacteria Bacteroidetes Nasidze 30 16S rrna Lactobacillus Lactobacillus bp 101 Bifidobacterium Gardnerella Atopobium Coryne- 39 bacterium Janthinobacterium8 Lactobacillus Bifidobacterium Gardnerella Gemel % la Prevotella Pseudomonas Streptococcus 34 Oakley % Lactobacillus lactobacilli Atopobium Hyman 28 16S rrna 10 86% Lactobacillus
5 70 Biotechnology Bulletin Actinobacteria Bacteriodetes Verstraelen 38 Wertz lactobacilli Verstraelen 36 Lactobacillus 1Gill SR Pop M DeBoy RT distal gut microbiome. Science 2006 L. crispatus 2Bckhed F Ley RE Sonnenburg JL in the human intestine. Science 2005 L. gasseri L. iners 3Sonnenburg JL Xu J Leip DD 2 et al. Metagenomic analysis of the human et al. Host-bacterial mutualism et al. Glycanforaging in vivo by an intestine-adapted bacterial symbiont. Science Flint HJ Bayer EA Rincon MT et al. Polysaccharide utilization by gut bacteriapotential for new insights from genomic analysis. Nat Rev Microbiol Mai V Draganov PV. Recent advances and remaining gaps in our knowledge of associations between gut microbiota and human health. World J Gastroenterol Turnbaugh PJ Ley RE Hamady M project. Nature NIH. Human microbiome projectovervieweb /OL 05. http/ /nihroadmap. nih. gov /hmp /. et al. The human microbiome et al. The influence of sex handed- 9Fierer N Hamady M Lauber CL ness Paulino LC Tseng CH Strober BE sions. Journal of Clinical Microbiology Gao Z Tseng CH Pei ZH arm superficial skin Costello EK Lauber CL Hamady M Grice EA Kong HH Renaud G et al. A diversity profile of the hu- man skin microbiota. Genome Res Qin J Li R Raes J tablished by metagenomic sequencing. Nature Kurokawa K Itoh T Kuwahara T DNA Research Xu J Bjursell MK Himrod J Bacteroides thetaiotaomicron symbiosis. Science The Human Microbiome Jumpstart Reference Strains Consortium. Acatalog of reference genomes from the human microbiome. Science and washing on the diversity of hand surface bacteria. PNAS et al. Molecular analysis of fungal microbiota in samples from healthy human skin and psoriatic le et al. Molecular analysis of human fore- bacterial biota. PNAS et al. Bacterial community variation in human body habitats across space and time. Science et al. A human gut microbial gene catalogue es et al. Comparative metagenomics revealed commonly enriched gene sets in human gut microbiomes. et al. A genomic view of the human
6 Samuel BS Hansen EE Manchester JK et al. Genomic and metabolic adaptations of Methanobrevibacter smithii to the human gut. PNAS Eckburg PB Bik EM Bernstein CN et al. Diversity of the human intestinal microbial flora. Science Li M Wang B Zhang M et al. Symbiotic gut microbes modulate human metabolic phenotypes. Proc Natl Acad Sci USA Ley RE Turnbaugh PJ Klein S et al. Microbial ecologyhuman gut microbes associated with obesity. Nature Ley RE Bckhed F Turnbaugh P et al. Obesity alters gut microbial ecology. Proc Natl Acad Sci USA Backhed F Ding H Wang T et al. The gut microbiota as an environmental factor that regulates fat storage. Proc Natl Acad Sci USA Turnbaugh PJ Hamady M Yatsunenko T et al. A core gut microbiome in obese and lean twins. Nature Turnbaugh PJ Ley RE Mahowald MA et al. An obesity-associated gut microbiome with increased capacity for energy harvest. Nature Arumugam M Raes J Pelletier E et al. Enterotypes of the human gut microbiom. Nature Verstraelen H Verhelst R Claeys G et al. Longitudinal analysis of the vaginal microflora in pregnancy suggests that L. crispatus promotes the stability of the normal vaginal microflora and that L. gasseri and /or L. iners are more conducive to the occurrence of abnor mal vaginal microflora. BMC Microbiol Zaura E Keijser BJ Huse SM et al. Defining the healthy core microbiome of oral microbial communities. BMC Microbiol Bik EM Long CD Armitage GC et al. Bacterial diversity in the oral cavity of ten healthy individuals. ISME J Lazarevic VWhiteson K Huse S et al. Metagenomic study of the oral microbiota by Illumina high-throughput sequencing. Journal of Microbiological Methods Nasidze I Li J Quinque D et al. Global diversity in the human salivary microbiome. Genome Research Burton JP Cadieux PA Reid G. Improved understanding of the bacterial vaginal microbiota of women before and after probiotic instillation. Appl Environ Microbiol Zhou X Bent SJ Schneider MG et al. Characterization of vaginal microbial communities in adult healthy women using cultivation-independent methods. Microbiology Zhou X Brown CJ Abdo Z et al. Differences in the composition of vaginal microbial communities found in healthy Caucasian and black women. Isme J Hyman RW Fukushima M Diamond L et al. Microbes on the human vaginal epithelium. Proc Natl Acad Sci USA Oakley BB Fiedler TL Marrazzo JM et al. Diversity of human vaginal bacterial communities and associations with clinically defined bacterial vaginosis. Appl Environ Microbiol
NIH Public Access Author Manuscript J Allergy Clin Immunol. Author manuscript; available in PMC 2012 November 01.
NIH Public Access Author Manuscript Published in final edited form as: J Allergy Clin Immunol. 2012 May ; 129(5): 1204 1208. doi:10.1016/j.jaci.2012.03.010. The interpersonal and intrapersonal diversity
More informationAmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data
Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer
More informationAccelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
More informationThe impact of antibiotics on the gut microbiota
The impact of antibiotics on the gut microbiota Dr Paul Cotter paul.cotter@teagasc.ie Teagasc Food Research Centre, Moorepark & Alimentary Pharmabiotic Centre (APC), University College Cork Cork, Ireland
More informationCanadian Microbiome Initiative
Canadian Microbiome Initiative Background The human body plays host to trillions of microbes, including bacteria, viruses and protists. These microbes constitute the Human Microbiome that resides both
More informationOwen White Institute for Genome Sciences University of Maryland
Owen White Institute for Genome Sciences University of Maryland hmpdacc.org Gevers D, Knight R, Petrosino JF, Huang K, et al. (2012) The Human Microbiome Project: A Community Resource for the Healthy Human
More informationObesity is a complex, multifactorial disease that contributes
Intestinal Methane Production in Obese Individuals Is Associated with a Higher Body Mass Index Robert J. Basseri, MD, Benjamin Basseri, MD, Mark Pimentel, MD, Kelly Chong, PhD, Adrienne Youdim, MD, Kimberly
More informationMicrobial community profiling for human microbiome projects: Tools, techniques, and challenges
Next-Generation DNA Sequencing/Review Microbial community profiling for human microbiome projects: Tools, techniques, and challenges Micah Hamady 1 and Rob Knight 2,3 1 Department of Computer Science,
More informationDefining a Healthy Human Gut Microbiome: Current Concepts, Future Directions, and Clinical Applications
Defining a Healthy Human Gut Microbiome: Current Concepts, Future Directions, and Clinical Applications Fredrik Bäckhed, 1 Claire M. Fraser, 2 Yehuda Ringel, 3 Mary Ellen Sanders, 4 R. Balfour Sartor,
More informationTOOLS FOR T-RFLP DATA ANALYSIS USING EXCEL
TOOLS FOR T-RFLP DATA ANALYSIS USING EXCEL A collection of Visual Basic macros for the analysis of terminal restriction fragment length polymorphism data Nils Johan Fredriksson TOOLS FOR T-RFLP DATA ANALYSIS
More informationA link between gut microbiota, mucosal immunity and autoimmune arthritis. Hsin-Jung Joyce Wu "Microbiota and man: the story about us
A link between gut microbiota, mucosal immunity and autoimmune arthritis Microbes and Man The majority of microbes we encounter are gut microbiota that live mostly in harmony with their host Duodenum 10
More informationHost-microbial interaction in the mammalian intestine and their metabolic role inside
Biomedical Research 2012; 23 (1): 9-21 Review article Host-microbial interaction in the mammalian intestine and their metabolic role inside Dipendra Raj Pandeya 1,2, Roshan D Souza 1, Md. Mashiar Rahman
More informationNature 464, 59-65 (4 March 2010) doi:10.1038/nature08821; Received 14 August 2009; Accepted 23 December 2009
Article Nature 464, 59-65 (4 March 2010) doi:10.1038/nature08821; Received 14 August 2009; Accepted 23 December 2009 A human gut microbial gene catalogue established by metagenomic sequencing Junjie Qin
More informationGut microbiota and obesity: lessons from the microbiome Patrice D. Cani
Briefings in Functional Genomics Advance Access published April 24, 2013 BRIEFINGS IN FUNCTIONAL GENOMICS. page 1 of 7 doi:10.1093/bfgp/elt014 Gut microbiota and obesity: lessons from the microbiome Patrice
More informationNicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
More informationDevelopment of intestinal microbiota in infants and its impact on health
Review Human Microbiome Development of intestinal microbiota in infants and its impact on health Sebastien Matamoros 1, Christele Gras-Leguen 2*, Françoise Le Vacon 3, Gilles Potel 2,y, and Marie-France
More informationHigh-throughput sequencing and big data: implications for personalized medicine?
High-throughput sequencing and big data: implications for personalized medicine? Dominick J. Lemas, PhD Postdoctoral Fellow in Pediatrics - Neonatology Mentor: Jacob E. (Jed) Friedman, PhD What is Big
More informationSymptomspesifikke probiotikum. Linda Mulder, MSc. Vårseminaret 2014
Linda Mulder, MSc. Vårseminaret 2014 Content Background on probiotics Intestinal microbiota & health on 3 levels Indication-specific probiotics Strain-specific characteristics Monostrain vs. multispecies
More informationTribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined
Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,
More informationInfluence of the skin mechanical and microbial properties on hair growth
Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont
More informationIntroduction. Contamination sources
Introduction Tim Sandle www.pharmamicro.com Cleanrooms and environmental monitoring Contamination sources Contamination control The human microbiome and the microbial ecology of people Case study: Microorganisms
More informationRichmond, VA. Richmond, VA. 2 Department of Microbiology and Immunology, Virginia Commonwealth University,
Massive Multi-Omics Microbiome Database (M 3 DB): A Scalable Data Warehouse and Analytics Platform for Microbiome Datasets Shaun W. Norris 1 (norrissw@vcu.edu) Steven P. Bradley 2 (bradleysp@vcu.edu) Hardik
More informationMK Gibson et al. Training and Benchmarking of Resfams profile HMMs
Training and Benchmarking of Resfams profile HMMs A curated list of antibiotic resistance (AR) proteins used to generate Resfams profile HMMs, along with associated reference gene sequences, is available
More informationNext Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner
Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions
More informationBiography Keynote Address
Biography Keynote Address Harry J. Flint, Ph.D. Harry Flint is leader of the Microbiology Group and of the Gut Health Theme at the Rowett Institute of Nutrition and Health, University of Aberdeen, UK,
More informationInterpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE. GI Effects Comprehensive Profile - Stool TEST
3425 Corporate Way Duluth, GA 30096 Patient: MALE TET GI Effects Comprehensive Profile - tool Interpretation At-a-Glance INFECTION INFLAMMATION INUFFICIENCY Calprotectin Pancreatic Elastase 1 Fecal Fats
More informationTarmbakterier ved fedme og type 2 diabetes
Tarmbakterier ved fedme og type 2 diabetes Trine Nielsen, læge, ph.d. Novo Nordisk Foundation Center for Basic Metabolic Research Københavns Universitet Landskursus for diabetessygeplejersker 8. november
More informationClinical Policy Title: Fecal transplantation for the treatment of Clostridium difficile infection
Clinical Policy Title: Fecal transplantation for the treatment of Clostridium difficile infection Clinical policy number: 08.02.02 Effective Date: October 1, 2014 Initial Review Date: June 18, 2014 Most
More informationFeature Subset Selection for Inferring Relative Importance of Taxonomy
Feature Subset Selection for Inferring Relative Importance of Taxonomy Gregory Ditzler Drexel University Dept. of Electrical & Computer Engineering Philadelphia, PA 19104 USA gregory.ditzler@gmail.com
More informationU.S. Meat Animal Research Center Clay Center, NE
Agricultural Research Clay Center, NE The (USMARC) was authorized by Congress on June 16, 1964, following transfer of the Naval Ammunition Depot from the Department of Defense to the Department of Agriculture.
More informationStudy of Effects of Probiotic Lactobacilli in Preventing Major Complications in Patients of Liver Cirrhosis
Research Article Study of Effects of Probiotic Lactobacilli in Preventing Major Complications in Patients of Liver Cirrhosis RR. Pawar*, ML. Pardeshi and BB. Ghongane Department of Pharmacology, B.J. Medical
More informationIntestinal microbiota and faecal transplantation as treatment modality for insulin resistance and type 2 diabetes mellitus
bs_bs_banner doi:10.1111/cei.12293 FOCUS ON HYGIENE HYPOTHESIS AND APPROACHES TO MODULATING THE MICROBIOME Series originator and editor: Matthias von Herrath Clinical and Experimental Immunology Intestinal
More informationGrand V Challenge We must improve human health, nutrition and wellness of the U.S. population
Grand V Challenge We must improve human health, nutrition and wellness of the U.S. population 1 Current Health Challenges Large health care costs(estimates range from $2.5 to $3 trillion in 2008 and 2009)
More informationMolecular Aspects of Medicine
Molecular Aspects of Medicine 34 (2013) 39 58 Contents lists available at SciVerse ScienceDirect Molecular Aspects of Medicine journal homepage: www.elsevier.com/locate/mam Review The gut microbiota, obesity
More informationHistory of DNA Sequencing & Current Applications
History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied
More informationInfluential passengers:
Influential passengers: monitoring invasive species through High Throughput DNA Sequencing during EXPO2015 Maurizio Casiraghi ZooPlantLab, The research topics in the scientific area are committed to the
More informationOnline Supporting Material
Supplemental Table 1 Bacterial pure cultures used in this study for optimization of the Lactobacillus group qpcr Species Strain Clostridial Phylogenetic affiliation according to cluster 1 NCBI 2 taxonomy
More informationGerardo Nardone Professore di Gastroenterologia Università degli Studi di Napoli Federico II
NOME TITOLO ISTITUZIONE Gerardo Nardone Professore di Gastroenterologia Università degli Studi di Napoli Federico II Il sottoscritto dichiara di non aver avuto negli ultimi 12 mesi conflitto d interesse
More informationFACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
More informationVictims Compensation Claim Status of All Pending Claims and Claims Decided Within the Last Three Years
Claim#:021914-174 Initials: J.T. Last4SSN: 6996 DOB: 5/3/1970 Crime Date: 4/30/2013 Status: Claim is currently under review. Decision expected within 7 days Claim#:041715-334 Initials: M.S. Last4SSN: 2957
More informationEcological and Evolutionary Forces Shaping Microbial Diversity in the Human Intestine
Leading Edge Review Ecological and Evolutionary Forces Shaping Microbial Diversity in the Human Intestine Ruth E. Ley, 1 Daniel A. Peterson, 1 and Jeffrey I. Gordon 1, * 1 Center for Genome Sciences, Washington
More informationMIBIE Summer School 2014. Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS
MIBIE Summer School 2014 Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS Eugen Domann Institute for Medical Microbiology Justus-Liebig University Gießen Human microbiome 14 Superorganism
More informationIntestinal Microflora
The Developing Intestinal Microbial Ecosystem: Relationship to Subsequent Health and Disease Josef Neu, M.D. University of Florida neuj@peds.ufl.edu Extra! Scientists Discover a New Organ in Humans! Citation:
More informationBioinformatics and its applications
Bioinformatics and its applications Alla L Lapidus, Ph.D. SPbAU, SPbSU, St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as
More informationGest Microbiology and the Development of Obesity
Nutrients 2013, 5, 829-851; doi:10.3390/nu5030829 Review OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journal/nutrients The Role of Gut Microbiota on Insulin Resistance Andrea M. Caricilli 1 and Mario
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationExploring Human Host-Microbiome Interactions in Health and Disease 29 June 1 July 2015
Programme Exploring Human Host-Microbiome Interactions in Health and Disease 29 June 1 July 2015 Kendrew Lecture Theatre, EBI South Building Wellcome Trust Genome Campus Hinxton, Cambridge, UK Oral Presentations
More informationBacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.de Commercial Disclosure Dag Harmsen is co-founder and partial owner
More informationIntestinal Microbiota around Colorectal Cancer Genesis
Intestinal Microbiota around Colorectal Cancer Genesis Giovanni Brandi, Francesco De Rosa, Giuseppina Liguori Valentina Agostini, Stefania Di Girolamo L. and A. Seràgnoli Department of Hematology and Oncological
More informationReproducible Community Dynamics of the Gastrointestinal Microbiota following Antibiotic Perturbation
INFECTION AND IMMUNITY, June 2009, p. 2367 2375 Vol. 77, No. 6 0019-9567/09/$08.00 0 doi:10.1128/iai.01520-08 Copyright 2009, American Society for Microbiology. All Rights Reserved. Reproducible Community
More informationReduced Incidence of Prevotella and Other Fermenters in Intestinal Microflora of Autistic Children
Reduced Incidence of Prevotella and Other Fermenters in Intestinal Microflora of Autistic Children Dae-Wook Kang 1., Jin Gyoon Park 2., Zehra Esra Ilhan 1, Garrick Wallstrom 2,3, Joshua LaBaer 2, James
More informationDisruptive Dairy innovation: Why has it become a necessity for the food industry?
Disruptive Dairy innovation: Why has it become a necessity for the food industry? Jens Bleiel CEO FHI June 16, 2015 Alicante 4topics 1 Dairy innovation : Why is it so difficult? 2 Formula 1 and the Man
More informationCurrent and Future Applications of Probiotic Science
Current and Future Applications of Probiotic Science Patricia L Hibberd, MD, PhD Chief, Division of Global Health Department of Pediatrics Massachusetts General Hospital, Boston Disclosures Probiotics
More informationPHYSIOLOGY AND MAINTENANCE Vol. II Intestinal Microflora - Erkki Eerola, Wen Hua Ling
INTESTINAL MICROFLORA Erkki Eerola Turku University. Department of Medical Microbiology, Turku, Finland. Wen Hua Ling Zhongshan University. Department of Clinical Nutrition, Guangzhou, PRChina Keywords:
More informationGENETICS AND GENOMICS IN NURSING PRACTICE SURVEY
GENETICS AND GENOMICS IN NURSING PRACTICE SURVEY Dear Registered Nurse: You are invited to take a survey that will evaluate primary issues in genetics and genomics. As the front line of care, nurses have
More informationMetagenomic and metatranscriptomic analysis
Metagenomic and metatranscriptomic analysis Marcelo Falsarella Carazzolle mcarazzo@lge.ibi.unicamp.br Laboratório de Genômica e Expressão (LGE) Unicamp METAGENOMIC Jo Handelsman (1998) University of Wisconsin-EUA)
More informationSpecial Program Announcement for 2013 Office of Naval Research Research Opportunity: Host/ Gut Microbiota Response to Stressors: Informing Resiliency
Special Program Announcement for 2013 Office of Naval Research Research Opportunity: Host/ Gut Microbiota Response to Stressors: Informing Resiliency I. INTRODUCTION This announcement describes a research
More informationThe Need for a PARP in vivo Pharmacodynamic Assay
The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D., Chief Scientific Officer, Trevigen, Inc., Gaithersburg, MD For further infomation, please contact: William Booth, Ph.D. Tel: +44 (0)1235
More informationProduction of prebiotics from PATRICK ADLERCREUTZ, DIV. OF BIOTECHNOLOGY
Production of prebiotics from hemicellulose PATRICK ADLERCREUTZ, DIV. OF BIOTECHNOLOGY Gut microbiota Gut microbiota microorganisms in our gastrointestinal tract The gut microbiota has a large influence
More informationDeliverable 7.3.1 First report on sample storage, DNA extraction and sample analysis processes
Model Driven Paediatric European Digital Repository Call identifier: FP7-ICT-2011-9 - Grant agreement no: 600932 Thematic Priority: ICT - ICT-2011.5.2: Virtual Physiological Human Deliverable 7.3.1 First
More informationBeyond gut microbiota: understanding obesity and type 2 diabetes
HORMONES Review Beyond gut microbiota: understanding obesity and type 2 diabetes Eva Lau, 1 Davide Carvalho, 1 Cidália Pina-Vaz, 2 José-Adelino Barbosa, 3 Paula Freitas 1 1 Department of Endocrinology,
More informationMOLECULAR BIOLOGY 4P03 / BIOLOGY 6P03 - Medical Microbiology
MOLECULAR BIOLOGY 4P03 / BIOLOGY 6P03 - Medical Microbiology Term II 2015-2016 Instructor: Guest Lecturers: Dr. Jianping Xu (Microbiologist) Dr. Marek Smieja (Medical Microbiologist, Infectious Diseases
More informationIntro to Bioinformatics
Intro to Bioinformatics Marylyn D Ritchie, PhD Professor, Biochemistry and Molecular Biology Director, Center for Systems Genomics The Pennsylvania State University Sarah A Pendergrass, PhD Research Associate
More informationEFFECT OF FOOD INGREDIENTS ON THE HUMAN ORAL AND INTESTINAL MICROBIOTA: POLYPHENOLS, PROBIOTICS AND PREBIOTICS
UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS Departamento de Química Física Aplicada EFFECT OF FOOD INGREDIENTS ON THE HUMAN ORAL AND INTESTINAL MICROBIOTA: POLYPHENOLS, PROBIOTICS AND PREBIOTICS
More informationMouse gut microbiomics of short chain fatty acid metabolism and mucosal responses. Floor Hugenholtz
Mouse gut microbiomics of short chain fatty acid metabolism and mucosal responses Floor Hugenholtz Thesis committee Promotors Prof. Dr H. Smidt Personal chair in the Laboratory of Microbiology Wageningen
More informationHECHO RELEVANTE AB-BIOTICS, S.A. 27 de Mayo de 2015
HECHO RELEVANTE AB-BIOTICS, S.A. 27 de Mayo de 2015 En cumplimiento de lo dispuesto en la Circular 9/2010 del Mercado Alternativo Bursátil y para su puesta a disposición del público como hecho relevante,
More informationA Metagenomics & Phylogenetic Analysis of Woods Hole Passage Microorganisms. Gail P. Ferguson University of Edinburgh (UK)
A Metagenomics & Phylogenetic Analysis of Woods Hole Passage Microorganisms Gail P. Ferguson University of Edinburgh (UK) 1 ABSTRACT Within the Oceans, microorganisms are subject to an array of different
More informationIMCAS-BRC: toward better management and more efficient exploitation of microbial resources
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources Xiuzhu Dong Biological Resources Center Institute of Microbiology, Chinese Academy of Sciences Challenges Global
More informationPresenting data: how to convey information most effectively Centre of Research Excellence in Patient Safety 20 Feb 2015
Presenting data: how to convey information most effectively Centre of Research Excellence in Patient Safety 20 Feb 2015 Biomedical Informatics: helping visualization from molecules to population Dr. Guillermo
More informationLecture Objectives: Why study microbiology? What is microbiology? Roots of microbiology
1 Lecture Objectives: Why study microbiology? What is microbiology? Roots of microbiology Why study microbiology? ENVIRONMENTAL MEDICAL APPLIED SCIENCE BASIC SCIENCE The science of microbiology Microbiology
More informationAnalysis of Illumina Gene Expression Microarray Data
Analysis of Illumina Gene Expression Microarray Data Asta Laiho, Msc. Tech. Bioinformatics research engineer The Finnish DNA Microarray Centre Turku Centre for Biotechnology, Finland The Finnish DNA Microarray
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
More informationHuman milk: a source of more life than we imagine
Beneficial Microbes, March 2013; 4(1): 17-30 Wageningen Academic P u b l i s h e r s Human milk: a source of more life than we imagine P.V. Jeurink 1,2, J. van Bergenhenegouwen 1,2, E. Jiménez 3, L.M.J.
More informationGive a NOD to diabetes:
Give a NOD to diabetes: NOD proteins ti link immunity it and metabolism tbli Jonathan Schertzer McMaster University McMaster University Faculty of Health Sciences Department of Biochemistry and Biomedical
More informationHow To Analyze A Gut Microbiome
UNIVERSITY of SASSARI PhD school in Biomolecular and Biotechnological Sciences PhD Programme: Molecular and Clinical Microbiology XXVI cycle PhD School Director: Prof. Claudia Crosio Development of new
More informationDNA Sequencing and Personalised Medicine
DNA Sequencing and Personalised Medicine Mick Watson Director of ARK-Genomics The Roslin Institute PERSONALISED MEDICINE What is personalised medicine? Personalized Medicine refers to the tailoring of
More informationEffect van boterzuur op insulineresistentie. Voeding, inflammatie en insulinerestentie Utrecht 9-03-2015 16.20-16.40
Effect van boterzuur op insulineresistentie Voeding, inflammatie en insulinerestentie Utrecht 9-03-2015 16.20-16.40 Max Nieuwdorp MD PhD Internist-endocrinologist Professor Diabetes, Chair Diabetes Center
More informationMICROBIOTA NEWSLETTER BIOFORTIS 2014
In the Spotlight Biofortis publication on microbiota alteration related to chemotherapy HOST MICROBE INTERACTIONS 16S rrna Gene Pyrosequencing Reveals Shift in Patient Faecal Microbiota During High-Dose
More informationBeneficial Microflora in Honey Bee Colonies
Beneficial Microflora in Honey Bee Colonies Diana Sammataro, Ph.D. USDA-ARS Carl Hayden Bee Research Center Tucson, AZ Our Website: http://gears.tucson.ars.ag.gov Lactobacillus spp. Bifidobacterium spp.
More informationDefinition: What is the Microbiome- A Big Picture
The Microbiome What is the Microbiome- A Big Picture Definition: The collection of genomes of the microbes (bacteria, bacteriophages, fungi, protozoa, and viruses) that live inside a human body Are we
More informationHow Can Institutions Foster OMICS Research While Protecting Patients?
IOM Workshop on the Review of Omics-Based Tests for Predicting Patient Outcomes in Clinical Trials How Can Institutions Foster OMICS Research While Protecting Patients? E. Albert Reece, MD, PhD, MBA Vice
More informationCloud Computing for Scientific Research
Cloud Computing for Scientific Research The NIH Nephele Project for Microbiome Analysis On behalf of: Yentram Huyen, Ph.D., Chief Nick Weber, Scientific Computing Project Manager Bioinformatics and Computational
More informationNORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT
1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun
More informationLa capture de la fonction par des approches haut débit
Colloque Génomique Environnementale LYON 2011 La capture de la fonction par des approches haut débit Pierre PEYRET J. Denonfoux, N. Parisot, E. Dugat-Bony, C. Biderre-Petit, D. Boucher, G. Fonty, E. Peyretaillade
More informationThe Norwegian brain abscess study -Massive parallel sequencing in clinical bacteriology
The Norwegian brain abscess study -Massive parallel sequencing in clinical bacteriology Oyvind Kommedal, Consultant, PhD Haukeland University Hospital 1 STUDY BACKGROUND 2 1 16S sekvensering 16S rrna-genet
More informationSupplemental Information. Biogeography of the Intestinal Mucosal. and Lumenal Microbiome in the Rhesus Macaque. Cell Host & Microbe, Volume 17
Cell Host & Microbe, Volume 17 Supplemental Information Biogeography of the Intestinal l and Lumenal Microbiome in the Rhesus Macaque Koji Yasuda, Keunyoung Oh, Boyu Ren, Timothy L. Tickle, Eric A. Franzosa,
More informationRaw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests?
Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests? Martin Wiedmann Milk Quality Improvement Program November 3, 2011 Fluid milk shelf life What defines shelf life
More informationThe National Institute of Genomic Medicine (INMEGEN) was
Genome is...... the complete set of genetic information contained within all of the chromosomes of an organism. It defines the particular phenotype of an individual. What is Genomics? The study of the
More informationComplex Microbial Communities. Single-Stage Chemostat Model
Characterization of Complex Microbial Communities Developed in a Single-Stage Chemostat Model Of the Human Distal Gut Julie McDonald jmcdonal@uoguelph.ca Allen-Vercoe Laboratory University of Guelph Guelph,
More informationIntegrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
More informationType 1 diabetes in adults pathogenesis and early intervention
Type 1 diabetes in adults pathogenesis and early intervention Bruce H.R. Wolffenbuttel, MD PhD Dept of Endocrinology, UMC Groningen website: www.umcg.net & www.gmed.nl Twitter: @bhrw Where do I come from?
More informationValidation and Replication
Validation and Replication Overview Definitions of validation and replication Difficulties and limitations Working examples from our group and others Why? False positive results still occur. even after
More informationMicrobiome Profiling by Illumina Sequencing of Combinatorial Sequence-Tagged PCR Products
Microbiome Profiling by Illumina Sequencing of Combinatorial Sequence-Tagged PCR Products Gregory B. Gloor 1 *, Ruben Hummelen 2,3, Jean M. Macklaim 1,2, Russell J. Dickson 1, Andrew D. Fernandes 1,4,
More informationStudies Explore Relationship Between the Gut Microbiome and the Brain Targeting gut bacteria may help treat stress, anxiety, and depression
Embargoed until Oct. 18, 4 p.m. CST Contacts: Emily Ortman, (202) 962-4090 Press Room, Oct. 17-21: (312) 791-6730 Anne Nicholas, (202) 962-4060 Studies Explore Relationship Between the Gut Microbiome and
More informationBiogeography of a human oral microbiome at the micron scale
Biogeography of a human oral microbiome at the micron scale Jessica L. Mark Welch a,b,1, Blair J. Rossetti a,b, Christopher W. Rieken b, Floyd E. Dewhirst a,c, and Gary G. Borisy a,b,1 a The Forsyth Institute,
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More informationPositive Feedback and Bistable Systems. Copyright 2008: Sauro
Positive Feedback and Bistable Systems 1 Copyright 2008: Sauro Non-Hysteretic Switches; Ultrasensitivity; Memoryless Switches Output These systems have no memory, that is, once the input signal is removed,
More informationProduct: Expression Arrest TM egfp control shrna vector
Product: Expression Arrest TM egfp control vector Catalog #: RHS1702 Product Description The laboratory of Dr. Greg Hannon at Cold Spring Harbor Laboratory (CSHL) has created an RNAi Clone Library comprised
More informationEDUCATION University of Illinois at Chicago Postdoc (Bioengineering, Modeling of biological networks) 2012
Youfang Cao, PhD Visiting Research Assistant Professor Department of Bioengineering M/C 563 Room W103, 835 S. Wolcott Ave. Chicago IL 60612 Office: 312-996-5624 Cell: 312-395-0455 youfang@uic.edu youfangcao@gmail.com
More informationMicrobial Oceanomics using High-Throughput DNA Sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean
More information