Structures and Drug Binding Potentials of HIF /ARNT Complexes

Size: px
Start display at page:

Download "Structures and Drug Binding Potentials of HIF /ARNT Complexes"

Transcription

1 Structures and Drug Binding Potentials of HIF /ARNT Complexes Hypoxia (low oxygen stress) Fraydoon Rastinejad HIF 1 Accumulation nucleus SBP Medical Discovery Institute CBP/p300 HRE ARNT Target genes HIF targets regulate multiple steps of cancer development Transactivation Metabolism: (GLUT1, PDK1, LDHA) The Segment We Crystallized Proliferation & Survival: (MYC, p53, PI3K/AKT) Angiogenesis: (VEGF, PDFG) Cell Infiltration: (CXCR4, SDF1) HIF 1 and HIF 2 ARNT (HIF 1 ) Crystallized As Heterodimers +/ DNA +/ Small Molecules Invasion and Metastasis: (LOX, TWIST) Cancer Stem Cell: Notch, MYC, WNT pathways 1

2 Questions We Asked Transactivation HIF 2 ARNT PAS B Do All Family Members Look the Same? How do Human Mutation Alter Function? Are Domains Coupled? Are there Any Ligand Binding Pockets? How do they Recognize DNA? PAS B HIF Inhibitors OX3 (selective for HIF 2 ) R.K.Bruick Lab (UTSW) Proflavine/Acriflavine (Inhibits both HIF 1 & HIF 2 G.L Semenza Lab (JH) Acriflavine/Proflavine inhibits HIF 1 Dimerization, Tumor Growth and Vascularization Lee, K, Zhang, H., Qian, DZ, Rey, S., Liu, JO, and Semenza, GL. PNAS

3 Proflavine 0X3 Space Available 3

4 110 Å Å Å 3 60 Å Å 3 5 Distinct Ligand Binding Sites 60% of residues in pocket of HIF 2 are identical in HIF 1 Proflavine Site is similar in HIF 2 /ARNT and HIF 1 /ARNT Why does OX3 Selectively bind to HIF 2? Proflavine 4

5 Three Residues Prevent 0X3 Binding to HIF 1 HIF 2 HIF 1 * HIF 2 ARNT+DNA HIF 1 ARNT+DNA 0X3 * Larger pocket Smaller pocket % identity HIF 1 vs. HIF 2 77% 62% 75% Missense Mutations in HIF 1 and HIF 2 R102 H94 N184 K GCTGCGTACGTGCGGGTCGT CGACGCATGCACGCCCAGCA-5 A23 R27 E98 PAS domain Extends DNA Footprint Location Possible Role Primary Tissue (Subtype) Associated Histology HIF-2α K18E α1 DNA interaction Stomach A23V α1 DNA interaction Endometrium Endometrioid carcinoma V47M α1-α2 loop Interface 6 (/) Central nervous system (brain) Glioma F98L Aβ Internal stability Large intestine (colon) R166L Gβ Internal stability Kidney Clear cell renal cell carcinoma I223M Iβ Interface 2 (/) Lung H248N Aβ Internal stability Large intestine (colon) R275H Dα-Eα loop Internal stability Cervix Squamous cell carcinoma A277P Eα Internal stability Lung Squamous cell carcinoma E279V Eα Internal stability Liver Hepatocellular carcinoma HIF-1α K19Q α1 DNA interaction Endometrium Endometrioid carcinoma R30Q α1 DNA interaction Skin Malignant melanoma L54I α1-α2 loop Interface 6 (/) Kidney Clear cell renal cell carcinoma V116E Cα Internal stability Kidney Clear cell renal cell carcinoma M120T Cα Internal stability Large intestine (colon) M171I Gβ Internal stability Kidney Clear cell renal cell carcinoma M250I Aβ-Bβ loop Internal stability Lung L262S Cα Internal stability Skin Malignant melanoma V341I Iβ Internal stability Endometrium Endometrioid carcinoma Tissue and histology data from the COSMIC database 5

6 Hepatocellular Carcinoma Domain Domain Junction modifiers DNA Binding modifiers Endometrioid Carcinoma Glioma Clear Cell Renal Carcinoma PAS pocket modifiers New Questions We Are Asking Hepatocellular Carcinoma Are there Endogenous Ligands that Regulate HIF Activity? HIF 1/2 ARNT +++ Gene expression Glioma Which Pockets Should We Target with Small Molecules Therapeutics? VEGF GLUT1 PDGF CAIX CXCR4 TGF Metabolic Angiogenesis Reprogramming Cancer Progression 6

7 But which sites should we target? What We Learned So Far. HIF 2 ARNT Domains Are Tightly Connected in HIF 1 /ARNT and HIF 1 /ARNT so Ligand Binding May Influence DNA binding and/or Transcriptional Responses of these complexes. HIF and ARNT (HIF ) Have Different Individual Subunit structures. They Heterodimerize Asymmetrically to form their Quaternary Arrangement. Mutagenesis and co IP studies Validate the Functional Interfaces we Observed. Productive Heterodimer PAS Domains Pocket HIF selective? Panmodulato r antagonist agonist MOA PAS B Yes? Yes?? Yes???? PAS B No Yes??? No Yes??? JUNCTIONA L No? Yes?? Major Rearrangements in the Domains Accompany DNA Binding. PAS Domains Extend DNA. Human Cancer Mutations Map to Sensitive Locations in the architectures. There are Five Different Ligand Binding Sites. ACKNOWLEDGEMENTS Dalei Wu Nalini Potluri Youngchang Kim (Argonne Nat l Labs) Vikas Chandra Jingping Lu Xiaoyu Su Yuan Seo Sepideh Khorasnaizadeh Siobhan Malany David Terry CPCCG 7

VHL and clear cell Renal Cell Carcinoma. Expression profiling reveals cell of origin. Renal Cell Carcinoma (RCC) Title. VHL syndrome hallmark cancer:

VHL and clear cell Renal Cell Carcinoma. Expression profiling reveals cell of origin. Renal Cell Carcinoma (RCC) Title. VHL syndrome hallmark cancer: VHL and clear cell Renal Cell Carcinoma Gene expression profiles in renal cell carcinoma October 23, 2014 VHL syndrome hallmark cancer: Clear cell renal cell carcinoma (ccrcc) VHL mutations also a hallmark

More information

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function: Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic

More information

Department of BioScience Technology Chung Yuan Christian University 2015/08/13

Department of BioScience Technology Chung Yuan Christian University 2015/08/13 Department of BioScience Technology Chung Yuan Christian University 2015/08/13 Cancer Cells Cancer, the 1st leading cause of death, is an example of a disease that arises from abnormalities in cell function

More information

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative

More information

CHAPTER 2: UNDERSTANDING CANCER

CHAPTER 2: UNDERSTANDING CANCER CHAPTER 2: UNDERSTANDING CANCER INTRODUCTION We are witnessing an era of great discovery in the field of cancer research. New insights into the causes and development of cancer are emerging. These discoveries

More information

BAP1 germline mutations A new Cutaneous Nevus Melanoma Syndrome. Thomas Wiesner

BAP1 germline mutations A new Cutaneous Nevus Melanoma Syndrome. Thomas Wiesner BAP1 germline mutations A new Cutaneous Nevus Melanoma Syndrome Thomas Wiesner Disclosure Listed as co-inventor US patent application US 61/463,389 BAP1 mutational analysis in determining susceptibility

More information

Successes and Limitations of Targeted Therapies in Renal Cell Carcinoma

Successes and Limitations of Targeted Therapies in Renal Cell Carcinoma g Tumor Res. Basel, Karger, 2014, vol 41, pp 98 112 (DOI: 10.1159/000355906) Successes and Limitations of Targeted Therapies in Renal Cell Carcinoma Marc Pracht Dominik Berthold Medical Oncology Unit,

More information

Targeted Therapy What the Surgeon Needs to Know

Targeted Therapy What the Surgeon Needs to Know Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures

More information

Cytotoxic and Biotherapies Credentialing Programme Module 2

Cytotoxic and Biotherapies Credentialing Programme Module 2 Cytotoxic and Biotherapies Credentialing Programme Module 2 1. The Cell Cycle 2. Cancer Therapies 3. Adjunctive Therapies On completion of this module the RN will State the difference between a normal

More information

Metastasis. brain metastasis from bronchial carcinoma

Metastasis. brain metastasis from bronchial carcinoma metastasis Metastasis brain metastasis from bronchial carcinoma How many genetic changes are needed for neoplastic transformation?... if you have some of these changes, but not all, you will never become

More information

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Médecine de précision médecine personnalisée en Oncologie Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Successful targeted drug development Rapid identification

More information

A disease of populations of cells that live, divide, invade and spread without regard to normal limits

A disease of populations of cells that live, divide, invade and spread without regard to normal limits 1 Targeted Cancer Therapies Mark McKeage Medical Oncology Specialist Professor in Clinical Pharmacology 2 Cancer Definition- A disease of populations of cells that live, divide, invade and spread without

More information

Cancer: DNA Synthesis, Mitosis, and Meiosis

Cancer: DNA Synthesis, Mitosis, and Meiosis Chapter 5 Cancer: DNA Synthesis, Mitosis, and Meiosis Copyright 2007 Pearson Copyright Prentice Hall, 2007 Inc. Pearson Prentice Hall, Inc. 1 What Is Cancer? Benign tumors do not invade surrounding tissue

More information

Developments in Biomarker Identification and Validation for Lung Cancer

Developments in Biomarker Identification and Validation for Lung Cancer Developments in Biomarker Identification and Validation for Lung Cancer Alexandre Passioukov, MD, PhD [email protected] Contents Introduction Lung cancer pathogenesis NSCLC treatment options

More information

Targeted Therapies in Lung Cancer

Targeted Therapies in Lung Cancer Targeted Therapies in Lung Cancer I Edited by: Simona Carnio Thoracic Oncology Division - St Luigi Hospital Orbassano (TO) - Italy Silvia Novello Department of Oncology - University of Torino - Italy Why

More information

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Michael B. Atkins, M.D. Deputy Director Georgetown-Lombardi Comprehensive Cancer Center Michael Atkins, MD Consulting Fees (e.g., advisory

More information

Cyclooxygenase and NSAIDs

Cyclooxygenase and NSAIDs Cyclooxygenase and NSAIDs Cyclooxygenase An enzyme responsible for the production of prostaglandins Two forms, COX1 and COX2 Contains two separate active sites for prostaglandin synthase One side contains

More information

Types of Cancers [-oma growth ]!

Types of Cancers [-oma growth ]! Cancer: disease of transcription factors and replication 1 Uncontrolled cell growth and division -> immortalized cells -> tumor growth -> metastasis (cells float away from tumor and spread throughout the

More information

STEM CELL FELLOWSHIP

STEM CELL FELLOWSHIP Module I: The Basic Principles of Stem Cells 1. Basics of Stem Cells a. Understanding the development of embryonic stem cells i. Embryonic stem cells ii. Embryonic germ cells iii. Differentiated stem cell

More information

targeted therapy a guide for the patient

targeted therapy a guide for the patient targeted therapy FOR LUNG CANCER a guide for the patient TABLE OF CONTENTS lung cancer basics... 2-3 Gene changes... 4-5 Testing... 7-8 Targeted therapy... 9-11 Drugs Targeting EGFR... 12 Drugs Targeting

More information

FARMACI PERSONALIZZATI PER

FARMACI PERSONALIZZATI PER ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica FARMACI

More information

Cellular, Molecular, and Biochemical Targets in Breast Cancer

Cellular, Molecular, and Biochemical Targets in Breast Cancer Cellular, Molecular, and Biochemical Targets in Breast Cancer Kristy Kummerow Ingrid Meszoely December 12, 2012 VUMC Resident Bonus Conference One size fits all surgical treatment of breast cancer Wilhelm

More information

Cancer can occur at almost any organ in the body

Cancer can occur at almost any organ in the body Cancer can occur at almost any organ in the body There are many different types of cancers affecting different parts of the body. A cancer, or tumor, can occur in any organ or tissue of the human body.

More information

New strategies in anticancer therapy

New strategies in anticancer therapy 癌 症 診 療 指 引 簡 介 及 臨 床 應 用 New strategies in anticancer therapy 中 山 醫 學 大 學 附 設 醫 院 腫 瘤 內 科 蔡 明 宏 醫 師 2014/3/29 Anti-Cancer Therapy Surgical Treatment Radiotherapy Chemotherapy Target Therapy Supportive

More information

The Biological Basis of Cancer. Annie Young, Professor of Nursing, University of Warwick, University Hospitals Coventry and Warwickshire

The Biological Basis of Cancer. Annie Young, Professor of Nursing, University of Warwick, University Hospitals Coventry and Warwickshire The Biological Basis of Cancer Annie Young, Professor of Nursing, University of Warwick, University Hospitals Coventry and Warwickshire Aim of Presentation By the end of this presentation you will: Be

More information

Anti-angiogenesis Treatment

Anti-angiogenesis Treatment Anti-angiogenesis Treatment The search for better cancer drugs Today we are better able to treat cancer than ever. More than half of all people with cancer now live at least 5 years after being diagnosed.

More information

Metastasis. Brookdale Hospital, Brooklyn, New York 11212, USA; 2 Cambridge, MA 02138, USA [email protected]

Metastasis. Brookdale Hospital, Brooklyn, New York 11212, USA; 2 Cambridge, MA 02138, USA ma8080@gmail.com Metastasis Ma Hongbao 1, Margaret Ma 2, Yang Yan 1 1 Brookdale Hospital, Brooklyn, New York 11212, USA; 2 Cambridge, MA 02138, USA [email protected] Abstract: Cancer begins when cells in a part of the body

More information

Biochemistry of Cancer Cell

Biochemistry of Cancer Cell Biochemistry of Cancer Cell Prof. Taha Kumosani Prof. Taha Kumosani http://biochemistry4all.com/taha/5.htm Cancer: an Overview Paleopathologists Dinosaur bones Egyptians Papyrus Autopsis Hippocrates Carcinoma

More information

Update on Clinical Trials and Foundation Funded Grants

Update on Clinical Trials and Foundation Funded Grants Update on Clinical Trials and Foundation Funded Grants Mary Hesdorffer, MS, APRN-BC Medical Liaison Meso Foundation www.curemeso.org Delivering the Diagnosis Delivering the Diagnosis Day 1 Taking control

More information

Molecular Diagnostics in Thyroid Cancer

Molecular Diagnostics in Thyroid Cancer Disclosure Nothing to disclose Jonathan George, MD, MPH Assistant Professor Head and Neck Oncologic & Endocrine Surgery Molecular Diagnostics in Thyroid Cancer Current Practices & Future Trends UCSF Medical

More information

Exelixis Showcases R&D Pipeline at JPMorgan Healthcare Conference

Exelixis Showcases R&D Pipeline at JPMorgan Healthcare Conference Exelixis Showcases R&D Pipeline at JPMorgan Healthcare Conference Two New Clinical Programs and Significant Expansion of Cancer Pipeline Planned for 2004 SOUTH SAN FRANCISCO, Calif., Jan. 13 /PRNewswire-FirstCall/

More information

WntResearch. Foxy-5 A unique Phase 1 opportunity to combat the spreading of cancer

WntResearch. Foxy-5 A unique Phase 1 opportunity to combat the spreading of cancer WntResearch Foxy-5 A unique Phase 1 opportunity to combat the spreading of cancer Why WntResearch is developing novel anti-cancer drugs Approximately 55 000 Swedish citizens are diagnosed with cancer every

More information

Essentials of Human Anatomy & Physiology. 7 th edition Marieb, Elaine, 2003. Chapters 10-11. Lab Manual, 2 nd edition and coloring book, 7 th edition

Essentials of Human Anatomy & Physiology. 7 th edition Marieb, Elaine, 2003. Chapters 10-11. Lab Manual, 2 nd edition and coloring book, 7 th edition Topic/Unit: Anatomy & Physiology Circulatory System Curricular Goals/ Learning Outcomes: Students will be able to identify the composition of blood and its function. Students will be able to differentiate

More information

Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi

Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi Cancer SBL101 James Gomes School of Biological Sciences Indian Institute of Technology Delhi All Figures in this Lecture are taken from 1. Molecular biology of the cell / Bruce Alberts et al., 5th ed.

More information

ALK+ lung cancer and the Blood-Brain Barrier (BBB) A concise guide

ALK+ lung cancer and the Blood-Brain Barrier (BBB) A concise guide ALK+ lung cancer and the Blood-Brain Barrier (BBB) A concise guide Contents Section Page number Section 1: Lung cancer and ALK+ NSCLC 3 Section 2: The Blood-Brain Barrier (BBB): What and why? 4 Section

More information

BRAF as a prognostic marker in papillary thyroid cancer

BRAF as a prognostic marker in papillary thyroid cancer 12 Congresso Nazionale AME Molecular markers in thyroid cancer: current role in clinical practice BRAF as a prognostic marker in papillary thyroid cancer Dott. ssa Cristina Romei Sezione di Endocrinologia

More information

Gene Silencing Oligos (GSOs) Third Generation Antisense

Gene Silencing Oligos (GSOs) Third Generation Antisense Gene Silencing Oligos (GSOs) Third Generation Antisense Walter R. Strapps, Ph.D. Executive Director, RNA Therapeutics Idera Pharmaceuticals Cambridge, MA NASDAQ: IDRA www.iderapharma.com Idera is a leader

More information

PROTOCOL OF THE RITA DATA QUALITY STUDY

PROTOCOL OF THE RITA DATA QUALITY STUDY PROTOCOL OF THE RITA DATA QUALITY STUDY INTRODUCTION The RITA project is aimed at estimating the burden of rare malignant tumours in Italy using the population based cancer registries (CRs) data. One of

More information

Nursing 113. Pharmacology Principles

Nursing 113. Pharmacology Principles Nursing 113 Pharmacology Principles 1. The study of how drugs enter the body, reach the site of action, and are removed from the body is called a. pharmacotherapeutics b. pharmacology c. pharmacodynamics

More information

What You Need to Know About Lung Cancer Immunotherapy

What You Need to Know About Lung Cancer Immunotherapy What You Need to Know About Lung Cancer Immunotherapy Lung.org/immunotherapy What is immunotherapy? Immunotherapy for cancer, sometimes called immune-oncology, is a type of medicine that treats cancer

More information

Renal Cell Carcinoma: Advances in Diagnosis B. Iványi, MD

Renal Cell Carcinoma: Advances in Diagnosis B. Iványi, MD Renal Cell Carcinoma: Advances in Diagnosis B. Iványi, MD Department of Pathology University of Szeged, Hungary ISUP Vancouver Classification of Renal Neoplasia Am J Surg Pathol 37:14691489, 2013 13 histologic

More information

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Rafal Dziadziuszko, MD, PhD University of Colorado Cancer Center, Aurora, CO, USA Medical University of Gdansk, Poland EMEA Workshop on Biomarkers,

More information

A 70-year old Man with Pleural Effusion

A 70-year old Man with Pleural Effusion Mesothelioma Diagnosis: Pitfalls and Latest Updates S Klebe and DW Henderson Recommendations Indisputable malignant cells on cytomorphological criteria which demonstrate a mesothelial phenotype, which

More information

Targeted Molecular Therapy for Renal Cell Carcinoma: Impact on Existing Treatment Paradigms

Targeted Molecular Therapy for Renal Cell Carcinoma: Impact on Existing Treatment Paradigms Targeted Molecular Therapy for Renal Cell Carcinoma: Impact on Existing Treatment Paradigms Wolfram Samlowski, MD For a CME/CEU version of this article please go to www.namcp.org/cmeonline.htm, and then

More information

Cancer is the leading cause of death for Canadians aged 35 to 64 and is also the leading cause of critical illness claims in Canada.

Cancer is the leading cause of death for Canadians aged 35 to 64 and is also the leading cause of critical illness claims in Canada. Underwriting cancer In this issue of the Decision, we provide an overview of Canadian cancer statistics and the information we use to make an underwriting decision. The next few issues will deal with specific

More information

Oxygen-Binding Proteins

Oxygen-Binding Proteins Oxygen-Binding Proteins Myoglobin, Hemoglobin, Cytochromes bind O 2. Oxygen is transported from lungs to various tissues via blood in association with hemoglobin In muscle, hemoglobin gives up O 2 to myoglobin

More information

Cancer Genomics: What Does It Mean for You?

Cancer Genomics: What Does It Mean for You? Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this

More information

Immunohistochemical differentiation of metastatic tumours

Immunohistochemical differentiation of metastatic tumours Immunohistochemical differentiation of metastatic tumours Dr Abi Wheal ST1. TERA 3/2/14 Key points from a review article written by Daisuke Nonaka Intro Metastatic disease is the initial presentation in

More information

MICRONUTRIENTS IN CANCER

MICRONUTRIENTS IN CANCER MICRONUTRIENTS IN CANCER Dr. Bilwa Bhanap, MD Scope of the problem 2000 1500 Heart Disease 12 million people worldwide are diagnosed with cancer every year. This is expected to rise to 27 million by 2030.

More information

The following information is only meant for people who have been diagnosed with advanced non-small cell

The following information is only meant for people who have been diagnosed with advanced non-small cell Important information for people with advanced non-small cell lung cancer The following information is only meant for people who have been diagnosed with advanced non-small cell lung cancer (NSCLC). NSCLC

More information

Contents. molecular biology techniques. - Mutations in Factor II. - Mutations in MTHFR gene. - Breast cencer genes. - p53 and breast cancer

Contents. molecular biology techniques. - Mutations in Factor II. - Mutations in MTHFR gene. - Breast cencer genes. - p53 and breast cancer Contents Introduction: biology and medicine, two separated compartments What we need to know: - boring basics in DNA/RNA structure and overview of particular aspects of molecular biology techniques - How

More information

Brigham and Women s Hospital, Boston, MA, USA; 2 Verastem, Inc., Boston, MA, USA

Brigham and Women s Hospital, Boston, MA, USA; 2 Verastem, Inc., Boston, MA, USA Determination of Biomarker Response in a Phase II Window of Opportunity Study of Defactinib (VS 6063), a Focal Adhesion Kinase (FAK) Inhibitor, in Patients with Resectable Malignant Pleural Mesothelioma

More information

Hepatocellular Carcinoma (HCC)

Hepatocellular Carcinoma (HCC) Abhishek Vadalia Introduction Chemoembolization is being used with increasing frequency in the treatment of solid hepatic tumors such as Hepatocellular Carinoma (HCC) & rare Cholangiocellular Carcinoma

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer

More information

Cancer Patients Urgently Need Effective, Genetically-Targeted Treatments

Cancer Patients Urgently Need Effective, Genetically-Targeted Treatments Cancer Patients Urgently Need Effective, Genetically-Targeted Treatments The Core Problem One Symptom, Not One Disease The disease we call cancer is the second most common cause of death in the United

More information

PRINIPLES OF RADIATION THERAPY Adarsh Kumar. The basis of radiation therapy revolve around the principle that ionizing radiations kill cells

PRINIPLES OF RADIATION THERAPY Adarsh Kumar. The basis of radiation therapy revolve around the principle that ionizing radiations kill cells PRINIPLES OF RADIATION THERAPY Adarsh Kumar The basis of radiation therapy revolve around the principle that ionizing radiations kill cells Radiotherapy terminology: a. Radiosensitivity: refers to susceptibility

More information

PART 3.3: MicroRNA and Cancer

PART 3.3: MicroRNA and Cancer BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway

More information

Future Directions in Cancer Research What does is mean for medical physicists and AAPM?

Future Directions in Cancer Research What does is mean for medical physicists and AAPM? Future Directions in Cancer Research What does is mean for medical physicists and AAPM? John D. Hazle, Ph.D., FAAPM, FACR President-elect American Association of Physicists in Medicine Professor and Chairman

More information

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions

More information

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of

More information

What is New in Oncology. Michael J Messino, MD Cancer Care of WNC An affiliate of Mission hospitals

What is New in Oncology. Michael J Messino, MD Cancer Care of WNC An affiliate of Mission hospitals What is New in Oncology Michael J Messino, MD Cancer Care of WNC An affiliate of Mission hospitals Personalized Medicine Personalized Genomics Genomic Medicine Precision Medicine Definition Application

More information

Advanced Radiation Therapy of Cancer by Proton Beam

Advanced Radiation Therapy of Cancer by Proton Beam March 20th, 2014 Advanced Radiation Therapy of Cancer by Proton Beam Fukui Prefectural Hospital Proton Therapy Center Yamamoto, Kazutaka Wave (electromagnetic wave) IR (Ionizing) Radiation 700 400 350~100

More information

Histopathology and prognosis in renal cancer

Histopathology and prognosis in renal cancer Histopathology and prognosis in renal cancer Granular cell Granular cell Granular cell Granular cell Clear cell Chromophobe cell Papillary type 2 Luca Mazzucchelli Istituto cantonale di patologia, Locarno

More information

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma

Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma The Use of Kinase Inhibitors: Translational Lab Results Targeting Specific Cell Signaling Pathways for the Treatment of Malignant Peritoneal Mesothelioma Sheelu Varghese, Ph.D. H. Richard Alexander, M.D.

More information

LESSON 3.5 WORKBOOK. How do cancer cells evolve? Workbook Lesson 3.5

LESSON 3.5 WORKBOOK. How do cancer cells evolve? Workbook Lesson 3.5 LESSON 3.5 WORKBOOK How do cancer cells evolve? In this unit we have learned how normal cells can be transformed so that they stop behaving as part of a tissue community and become unresponsive to regulation.

More information

Immuno-Oncology Therapies to Treat Lung Cancer

Immuno-Oncology Therapies to Treat Lung Cancer Immuno-Oncology Therapies to Treat Lung Cancer What you need to know ONCHQ14NP07519 Introduction: Immuno-oncology represents an innovative approach to cancer research that seeks to harness the body s own

More information

Big Data analytics for precision medicine and drug discovery

Big Data analytics for precision medicine and drug discovery Institute for Computational Biomedicine Big Data analytics for precision medicine and drug discovery Olivier Elemento, PhD Associate Professor Laboratory of Cancer Systems Biology Institute for Precision

More information

Biofocus Molecular Diagnostic Panel

Biofocus Molecular Diagnostic Panel Biofocus Molecular Diagnostic Panel Dr. Lothar Prix Biofocus GmbH, Recklinghausen, Germany www.biofocus.de Molecular detection of infectious diseases Human & veterinary hereditary diseases / genetic predisposition

More information

NM- Nuclear Medicine

NM- Nuclear Medicine NM- Nuclear Medicine CODE DESCRIPTION 78000 Thyroid uptake; single determination 78001 Thyroid uptake; multiple determinations 78003 Thyroid uptake; stimulation, suppression or discharge 78006 Thyroid

More information

Preliminary Results from a Phase 2 Study of ARQ 197 in Patients with Microphthalmia Transcription Factor Family (MiT) Associated Tumors

Preliminary Results from a Phase 2 Study of ARQ 197 in Patients with Microphthalmia Transcription Factor Family (MiT) Associated Tumors Preliminary Results from a Phase 2 Study of ARQ 197 in Patients with Microphthalmia Transcription Factor Family (MiT) Associated Tumors John Goldberg 1 *, George Demetri 2, Edwin Choy 3, Lee Rosen 4, Alberto

More information

a Phase 2 prostate cancer clinical trial is ongoing. Table 2: Squalamine vs Standard-of-care literature

a Phase 2 prostate cancer clinical trial is ongoing. Table 2: Squalamine vs Standard-of-care literature PRODUCT FACT SHEET Spring 2007 MISSION STATEMENT Genaera Corporation is a biopharmaceutical company with a focus on metabolic and respiratory diseases. The compounds in the Genaera pipeline address signal

More information

MALIGNANT MESOTHELIOMA UPDATE ON PATHOLOGY AND IMMUNOHISTOCHEMISTRY

MALIGNANT MESOTHELIOMA UPDATE ON PATHOLOGY AND IMMUNOHISTOCHEMISTRY MALIGNANT MESOTHELIOMA UPDATE ON PATHOLOGY AND IMMUNOHISTOCHEMISTRY Sisko Anttila, MD, PhD Jorvi Hospital Laboratory of Pathology Helsinki University Hospital Espoo, Finland 2nd Nordic Conference on Applied

More information

Mutations: 2 general ways to alter DNA. Mutations. What is a mutation? Mutations are rare. Changes in a single DNA base. Change a single DNA base

Mutations: 2 general ways to alter DNA. Mutations. What is a mutation? Mutations are rare. Changes in a single DNA base. Change a single DNA base Mutations Mutations: 2 general ways to alter DNA Change a single DNA base Or entire sections of DNA can move from one place to another What is a mutation? Any change in the nucleotide sequence of DNA Here

More information

Chapter 45: Hormones and the Endocrine System

Chapter 45: Hormones and the Endocrine System Name Period Overview 1. What is a hormone? 2. Why does a hormone elicit a response only with target cells? 3. The body has two long-distance regulating systems. Which involves chemical signals by hormones?

More information

Cancer: Cells Behaving Badly

Cancer: Cells Behaving Badly Cancer: Cells behaving badly It s quite likely your body is harboring precancerous cells. Don t panic: this doesn t mean you have cancer. Many of us have cells here and there with defense mechanisms that

More information

Genetic material of all living organisms. Biology - 100

Genetic material of all living organisms. Biology - 100 Genetic material of all living organisms. Biology - 100 This antibiotic is made from a fungus that was first discovered growing on an orange and it became the first antibiotic to treat infection. Biology

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Predictive Biomarkers for Tumor Immunotherapy: Are we ready for clinical implementation? Howard L. Kaufman Rush University

Predictive Biomarkers for Tumor Immunotherapy: Are we ready for clinical implementation? Howard L. Kaufman Rush University Predictive Biomarkers for Tumor Immunotherapy: Are we ready for clinical implementation? Howard L. Kaufman Rush University Changing Paradigms in Cancer Treatment Potential Uses of Biomarkers Adverse event

More information

Accelerated Death Benefit Endorsements

Accelerated Death Benefit Endorsements Accelerated Death Benefit Endorsements Financial Protection To Help with Critical, Chronic and Terminal Illness Marketing Guide North American Company automatically includes the accelerated death benefit

More information

The Di Bella Method (DBM) improves Survival, Objective Response and Performance Status in Breast Cancer

The Di Bella Method (DBM) improves Survival, Objective Response and Performance Status in Breast Cancer BIT's 4th World Cancer Congress 2011 People s Republic of China Dalian The Di Bella Method (DBM) improves Survival, Objective Response and Performance Status in treated with DBM therapy Retrospective observational

More information

Genomic Analysis of Mature B-cell Malignancies

Genomic Analysis of Mature B-cell Malignancies Genomic Analysis of Mature B-cell Malignancies Update and Lessons Learned Omar Abdel-Wahab, MD Memorial Sloan Kettering Cancer Center Human Oncology and Pathogenesis Program and Leukemia Service Disclaimer:

More information

2006 7.012 Problem Set 6 KEY

2006 7.012 Problem Set 6 KEY 2006 7.012 Problem Set 6 KEY ** Due before 5 PM on WEDNESDAY, November 22, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You create an artificial

More information

Bispecific antibodies with native chain structure

Bispecific antibodies with native chain structure Bispecific antibodies with native chain structure 11.03.2014 Kristin Fritsch Natural function of antibodies I. Spasevska, Biosciences Master Reviews, 2014 IgG Antibody http://www.ebioscience.com/knowledge-center/antigen/immunoglobulin/structure.htm

More information

CHAPTER 6 AN INTRODUCTION TO METABOLISM. Section B: Enzymes

CHAPTER 6 AN INTRODUCTION TO METABOLISM. Section B: Enzymes CHAPTER 6 AN INTRODUCTION TO METABOLISM Section B: Enzymes 1. Enzymes speed up metabolic reactions by lowering energy barriers 2. Enzymes are substrate specific 3. The active site in an enzyme s catalytic

More information

T Cell Maturation,Activation and Differentiation

T Cell Maturation,Activation and Differentiation T Cell Maturation,Activation and Differentiation Positive Selection- In thymus, permits survival of only those T cells whose TCRs recognize self- MHC molecules (self-mhc restriction) Negative Selection-

More information

Dal germinale al somatico nella identificazione di tumori ereditari

Dal germinale al somatico nella identificazione di tumori ereditari Modena 18-19 novembre 2010 Dal germinale al somatico nella identificazione di tumori ereditari Laura Ottini Tendencies to develop cancer can be inherited Fletcher & Houlston, 2010 Cancer is a genetic disease

More information

Oncos Therapeutics: ONCOS THERAPEUTICS Personalized Cancer Immunotherapy. March 2015. Antti Vuolanto, COO and co-founder

Oncos Therapeutics: ONCOS THERAPEUTICS Personalized Cancer Immunotherapy. March 2015. Antti Vuolanto, COO and co-founder Oncos Therapeutics: Personalized Cancer Immunotherapy ONCOS THERAPEUTICS Personalized Cancer Immunotherapy March 2015 Antti Vuolanto, COO and co-founder 1 History of Oncos Therapeutics 2002 2007 2009 Research

More information

Fulfilling the Promise

Fulfilling the Promise Fulfilling the Promise Advancing the Fight Against Cancer: America s Medical Schools and Teaching Hospitals For more than a century, the nation s medical schools and teaching hospitals have worked to understand,

More information

Lung Cancer: More than meets the eye

Lung Cancer: More than meets the eye Lung Cancer Education Program November 23, 2013 Lung Cancer: More than meets the eye Shantanu Banerji MD, FRCPC Presenter Disclosure Faculty: Shantanu Banerji Relationships with commercial interests: Grants/Research

More information