Structures and Drug Binding Potentials of HIF /ARNT Complexes

Transcription

1 Structures and Drug Binding Potentials of HIF /ARNT Complexes Hypoxia (low oxygen stress) Fraydoon Rastinejad HIF 1 Accumulation nucleus SBP Medical Discovery Institute CBP/p300 HRE ARNT Target genes HIF targets regulate multiple steps of cancer development Transactivation Metabolism: (GLUT1, PDK1, LDHA) The Segment We Crystallized Proliferation & Survival: (MYC, p53, PI3K/AKT) Angiogenesis: (VEGF, PDFG) Cell Infiltration: (CXCR4, SDF1) HIF 1 and HIF 2 ARNT (HIF 1 ) Crystallized As Heterodimers +/ DNA +/ Small Molecules Invasion and Metastasis: (LOX, TWIST) Cancer Stem Cell: Notch, MYC, WNT pathways 1

2 Questions We Asked Transactivation HIF 2 ARNT PAS B Do All Family Members Look the Same? How do Human Mutation Alter Function? Are Domains Coupled? Are there Any Ligand Binding Pockets? How do they Recognize DNA? PAS B HIF Inhibitors OX3 (selective for HIF 2 ) R.K.Bruick Lab (UTSW) Proflavine/Acriflavine (Inhibits both HIF 1 & HIF 2 G.L Semenza Lab (JH) Acriflavine/Proflavine inhibits HIF 1 Dimerization, Tumor Growth and Vascularization Lee, K, Zhang, H., Qian, DZ, Rey, S., Liu, JO, and Semenza, GL. PNAS

3 Proflavine 0X3 Space Available 3

4 110 Å Å Å 3 60 Å Å 3 5 Distinct Ligand Binding Sites 60% of residues in pocket of HIF 2 are identical in HIF 1 Proflavine Site is similar in HIF 2 /ARNT and HIF 1 /ARNT Why does OX3 Selectively bind to HIF 2? Proflavine 4

5 Three Residues Prevent 0X3 Binding to HIF 1 HIF 2 HIF 1 * HIF 2 ARNT+DNA HIF 1 ARNT+DNA 0X3 * Larger pocket Smaller pocket % identity HIF 1 vs. HIF 2 77% 62% 75% Missense Mutations in HIF 1 and HIF 2 R102 H94 N184 K GCTGCGTACGTGCGGGTCGT CGACGCATGCACGCCCAGCA-5 A23 R27 E98 PAS domain Extends DNA Footprint Location Possible Role Primary Tissue (Subtype) Associated Histology HIF-2α K18E α1 DNA interaction Stomach A23V α1 DNA interaction Endometrium Endometrioid carcinoma V47M α1-α2 loop Interface 6 (/) Central nervous system (brain) Glioma F98L Aβ Internal stability Large intestine (colon) R166L Gβ Internal stability Kidney Clear cell renal cell carcinoma I223M Iβ Interface 2 (/) Lung H248N Aβ Internal stability Large intestine (colon) R275H Dα-Eα loop Internal stability Cervix Squamous cell carcinoma A277P Eα Internal stability Lung Squamous cell carcinoma E279V Eα Internal stability Liver Hepatocellular carcinoma HIF-1α K19Q α1 DNA interaction Endometrium Endometrioid carcinoma R30Q α1 DNA interaction Skin Malignant melanoma L54I α1-α2 loop Interface 6 (/) Kidney Clear cell renal cell carcinoma V116E Cα Internal stability Kidney Clear cell renal cell carcinoma M120T Cα Internal stability Large intestine (colon) M171I Gβ Internal stability Kidney Clear cell renal cell carcinoma M250I Aβ-Bβ loop Internal stability Lung L262S Cα Internal stability Skin Malignant melanoma V341I Iβ Internal stability Endometrium Endometrioid carcinoma Tissue and histology data from the COSMIC database 5

6 Hepatocellular Carcinoma Domain Domain Junction modifiers DNA Binding modifiers Endometrioid Carcinoma Glioma Clear Cell Renal Carcinoma PAS pocket modifiers New Questions We Are Asking Hepatocellular Carcinoma Are there Endogenous Ligands that Regulate HIF Activity? HIF 1/2 ARNT +++ Gene expression Glioma Which Pockets Should We Target with Small Molecules Therapeutics? VEGF GLUT1 PDGF CAIX CXCR4 TGF Metabolic Angiogenesis Reprogramming Cancer Progression 6

7 But which sites should we target? What We Learned So Far. HIF 2 ARNT Domains Are Tightly Connected in HIF 1 /ARNT and HIF 1 /ARNT so Ligand Binding May Influence DNA binding and/or Transcriptional Responses of these complexes. HIF and ARNT (HIF ) Have Different Individual Subunit structures. They Heterodimerize Asymmetrically to form their Quaternary Arrangement. Mutagenesis and co IP studies Validate the Functional Interfaces we Observed. Productive Heterodimer PAS Domains Pocket HIF selective? Panmodulato r antagonist agonist MOA PAS B Yes? Yes?? Yes???? PAS B No Yes??? No Yes??? JUNCTIONA L No? Yes?? Major Rearrangements in the Domains Accompany DNA Binding. PAS Domains Extend DNA. Human Cancer Mutations Map to Sensitive Locations in the architectures. There are Five Different Ligand Binding Sites. ACKNOWLEDGEMENTS Dalei Wu Nalini Potluri Youngchang Kim (Argonne Nat l Labs) Vikas Chandra Jingping Lu Xiaoyu Su Yuan Seo Sepideh Khorasnaizadeh Siobhan Malany David Terry CPCCG 7