SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2.
|
|
- Margery Reynolds
- 7 years ago
- Views:
Transcription
1 41 1 () Vol. 41 No Journal of Xiamen University (Natural Science) Jan : (2002) SSR,,, (, ) :, GEN E BAN K, 2 SSR (Bn92A,Bn72A). PCR ( Touchdown PCR),,,, 12 DNA PCR.,PCR SSR,150 bp (Bn92A),250bp (Bn72A). SSR.,,2 SSR. :SSR ; ;; : Q 753 : A SSR ( simple sequence repeats) DNA [ 1, 2 ] DNA,16,( GT) n,( GA TA) n., PCR,,SSR,,, Dietrich [3 ] SSR, 1. 1cM ( Centi2Morgen). Akkaya [4 ] 96,29 SSR, RFL P 23.,,SSR RFL P. SSR SSR. DNA, DNA,, SSR.,,.,SSR, [5,6 ].,,,GEN E BAN K.,.,, SSR, SSR,, SSR : 2 58, 63 ; 23 # ; 2 98 ; 227,5 ; 2, ; 2RS21, YP1 ; 2 Moricandia nitens ; 2. : : ( ) :( ),,.
2 90 () : Taq DNA (dn TPs) Marker Promega ; SSR 2Bn92A (A) 28,Bn72A ( TAA) 5 ( GA) 4 [ 5,6 ] ;. : PCR : PE,9600 ; :752 ;:B IO2RAD,Power300. :UVP, GDS DNA 5 g,, 50 ml, 25 ml DNA (0. 1 mol/ L Tris2HCl, p H 8. 0 ; mol/ L ED TA, p H 8. 0 ; 1 mol/ L NaCl ; mol/ L 2ME) 20 % SDS 2. 5 ml, min,, 5 mol/ L KAc5 ml,, 30 min g 10 min,,,4 000 g 10 min., 10 mmol/ L N H 4 Ac 70 % DNA g 10 min,. 2 ml TE, DNA. 15 L RNaseA (10 mg/ ml ), 37 1 h,,, h DNA. DNA,70 %, 30 min,. 400L TE, 4. DNA TE 260 nm 280 nm, DNA, % DNA, DNA PCR PCR Touchdown PCR, : 1 PCR buffer, mmol/ L MgCl 2, mmol/ L dn TP,1. 0mol/ L SSR,1 U Taq,30 ng DNA. 20 L. : 94 1 min, 30 sec,72 45 sec, 68,1, ,20., (10 mmol/ L NaOH,95 % formamide,0. 05 %,0. 05 % ), 5 min,. 4 %6 %,100 W 0. 5 h,5l, 100 W 1. 5 h.,, 1 L (10 % ), 30 min., 1L ( 1 g/ L AgNO 3, % Formaldehyde). 30 min,, 1 L (2. 5 % Na 2 CO 3, % Na 2 SO 3, % formaldehyde), 1 L,3 min DNA Tab. 1 The results of the DNA extraction of 12 plant samples A 260 A 280 A 260 / A 280 (g/ g FW) # RS YP Moricandia nitens
3 1 :SSR DNA (112 :1. 58 ; ; 3. 3 # ; ; ; 6. 5 ; 7. ; 8. ; 9. RS21 ; 10. YP1 ; 11. Moricandia nitens ; 12. ; M :DNA/ Hind ) Fig. 1 DNA electrophosis examination of 12 plant species 2 SSR 12 (112 :1. 58 ; ; 3. 3 # ; ; ; 6. 5 ; 7. ; 8. ; 9. RS21 ; 10. YP1 ; 11. Moricandia nitens, ; 12. ; M :1kb ) Fig. 2 Amplification of 12 different species DNA with SSR primers of B rassica. napus, PCR DNA 12 DNA A 260 A 280 1, 1. 1, 12 DNA A 260 / A ,DNA. 1, DNA,23 kb. 12 DNA PCR SSR PCR Bn92A Bn72A SSR 12 DNA PCR, 2. 2, Bn92A,(, ) ; (RS21, YP1) ; ( Moricandia nitens), ()2 ; ( 58, 63), (27,5)2; (3 # )2 ; ( 98)2,150 bp. Bn72A YP1,
4 92 () bp.. [13,14 ] SSR Bn92A Bn72A. SSR,., SSR. 3,., 648 [ 7 ]., [8,9 ] [10,11 ] [1215 ] [16 ] [17 ] [18 ],2,.,,,,.. SSR,.. Asya [19 ],() SSR.,,,. : [1 ] Litt M, Luty J A. A hypervariable microsatellite reeveae by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene [ J ]. Am J Hum Genet, 1989, 44 : [ 2 ] Love J M, Knight A M. Towards construction of a high2 resolution map of the mouse genome using PCR2analyzed microsatellites [ J ]. Nucleic Acids Res., 1990, 18 : [3 ] Dietrich W F, Miller J, et al. A comprehensive genetic map of the mouse genome[j ]. Nature, 1996, 380 : [4 ] Akkaya M S, Cregan P B. Length polymorphisms of simple2sequence repeat DNA in soybean [ J ]. Genetics, 1992, 132 : [ 5 ] Kresovich S, Szewe2Mcfadden A K. Abundance and char2 acterization of simple2sequence repeats ( SSRs) isolated from a size2fractionate genomic library of B rassica napus L. (rapeseed) [J ]. Theor Appl Genet, 1995, 91 : [ 6 ] Szewc2Mcfadden A K. Kresovich S. Identification of polymorphic conserved simple2sequence repeats ( SSRs) in cultivated Brassica species [ J ]. Theor. Appl. Genet, 1996, 93 : [ 7 ] Obrien S, Seuaneze H N, Womax J. Mammalian genome organization: An evolutionary view [ J ]. Annu. Rev. Genet, 1988, 22 : [8 ] Bonierbale M W, Plaisted R L, Richter s,et al. RFL P maps based on a common set of clones reveal modes of chromosomal evolution in potato and tomato [J ]. Genet2 ics, 1988, 120 : [9 ] Tanksley S D. High density molecular linkage maps of the tomato and potato genomes : biological inferences and practical implications[j ]. Genetics, 1992, 132 : [10 ] Prince J, Pochard E, Tanksley S D. Construction of a molecular linkage map of pepper and a comparison of syteny with tomato [J ]. Genome, 1993, 36 : [11 ] Tanksley S D, Bernatzky R. Conservation of gene repertoire but not gene order in pepper and tomato [J ]. Proc Natl Acad Sci. USA, 1988, 85 : [12 ] Guimares C. Comparative mapping of sugarcane, maize and sorghum. Plant Genome IV [ M ]. San Diego, USA. : Garland Publishing, [13 ] Hulbert S H, Richter T E. Genetic mapping and char2 acterization of sorghum and related corps by means of maize DNA probes[j ]. Proc. Natl. Acad. Sci. USA, 1990, 87 : [14 ] Periera M G, Lee M, Bramel P. Construction of an RFL P map in sorghum and comparative mapping in maize[j ]. Genome, 1993, 37 : [15 ] Witkus R, Womak E. Comparative genome mapping of
5 1 :SSR 93 sorghum and maize[j ]. Genetic, 1992, 132 : [ 16 ] Ahn S, Tanksley S D. Comparative linkage maps of the maize and rice genomes[j ]. Mol. Gen. Genet, 1993, 247 : [17 ] Ahn S, Anderson J A. Homoeologous relationships of rice, wheat and maize chromosome [ J ]. Mol. Gen. Genet., 1993, 241 : [18 ] Teutonico R A, Osborn T C. Mapping of RFL P and qualitative trait loci in B rassica rapa and comparision to the linkage maps of B. napus, B. oleracea and A ra2 bidopsis thaliana[j ]. Theor. Appl. Genet, 1994, 89 : [19 ] Asya R, Yujuni K. Family of crucifurous[j ]. Planta, 1997, 34 : Common SSR Primers for Molecular Marker in Different Crops ZHOU Han2tao, ZHEN G Wen2zhu, ZHOU Yi2ting, XIA Tao ( School of Life Sciences, Xiamen University, Xiamen , China) Abstract : Using 2 pairs of SSR (Simple Sequence Repeats) primers form B rassica napus2bn92a Bn72A, syn2 thesized according to the reports on GEN E BAN K, DNAs extracted from 12 different crops (rice, maize, cot2 ton, rape, orange, cabbage, et al. ) were amplified bytouchdownpcr. The result shows that, the main bands of 150 bp and 250 bp amplified by Bn92A Bn72A respectively appear in all 12 crops and are the same size in B rassica napus by the same SSR primers. The results indicated that different kinds of genomes of crops have the certain extent comparability, and can use the common SSR primers for the molecular markers on genome comparative mapping. Key words : SSR ; molecular marker ; genome comparative mapping ; crops
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More informationPrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
More informationIMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
More informationNimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
More informationWorksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
More informationGenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
More informationGenomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
More informationIsolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.
Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH
More informationCastillo et al. Rice Archaeogenetics electronic supplementary information
Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products
More informationSUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION
SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION Senthilkumar Padmanaban, Haiyan Li, David P. Puthoff and Ann C. Smigocki USDA-ARS Molecular Plant Pathology Laboratory,
More informationMOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING
MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING Viktor Korzun Lochow-Petkus GmbH, Grimsehlstr.24, 37574 Einbeck, Germany korzun@lochow-petkus.de Summary The development of molecular techniques
More informationMATCH Commun. Math. Comput. Chem. 61 (2009) 781-788
MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,
More informationProtocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
More informationCCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
More informationRapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
More informationReliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
More informationThe Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
More informationReverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
More informationApplication Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
More informationRecombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
More informationHepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
More informationRT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
More informationTerra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
More informationUsefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers
J. Appl. Genet. 44(3), 2003, pp. 419-423 Short communication Usefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers Bohdan GÓRSKI,
More informationABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
More informationAnnex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
More informationAn example of bioinformatics application on plant breeding projects in Rijk Zwaan
An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on
More informationForensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
More informationDNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
More informationTroubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationTARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS
TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS J.-M. Lacape, T.-B. Nguyen, B. Hau, and M. Giband CIRAD-CA, Programme Coton, TA 70/03, Avenue Agropolis, 34398 Montpellier Cede
More informationA quick and simple method for the identi cation of meat species and meat products by PCR assay
Meat Science 51 (1999) 143±148 A quick and simple method for the identi cation of meat species and meat products by PCR assay T. Matsunaga a, K. Chikuni b *, R. Tanabe b, S. Muroya b, K. Shibata a, J.
More informationSOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
More informationTechnical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
More informationIn vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
More information(3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS
(3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS Ebenezer A. Ogundiwin 1, Antonio Granell 2, Thomas M. Gradziel 1, and Carlos H. Crisosto 1 1 Department of Plant Sciences,
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationDNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments
DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,
More informationSite-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
More informationPicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
More informationPCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
More informationquantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
More informationLecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
More informationCommonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
More informationPatent issues in Industrial Biotech:
Patent issues in Industrial Biotech: Nucleic Acids, Life Forms & Natural Products Konrad Sechley PhD, Vancouver, Canada 18 April, 2016 OVERVIEW Gene patenting Life Forms & Natural Products Conclusions
More informationQUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
More informationPyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
More informationEZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031
INSTRUCTION MANUAL EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031 Highlights Fastest method for complete bisulfite conversion of DNA for methylation analysis. Ready-to-use conversion reagent
More informationONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue
ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal
More informationNetPrimer Manual. PREMIER Biosoft International. 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773
NetPrimer Manual PREMIER Biosoft International 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773 E-mail: sales@premierbiosoft.com 1 Copyright 2009 by PREMIER Biosoft International.
More informationBrief Communication. B. Freeman, 1 N. Smith, 1 C. Curtis, 1 L. Huckett, 1 J. Mill, 1 and I. W. Craig 1,2
Behavior Genetics, Vol. 33, No. 1, January 2003 ( 2003) Brief Communication DNA from Buccal Swabs Recruited by Mail: Evaluation of Storage Effects on Long-term Stability and Suitability for Multiplex Polymerase
More informationMolecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
More informationRevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationAnalysis of the DNA Methylation Patterns at the BRCA1 CpG Island
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory
More informationHow To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
More informationFOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual for KOD FX Neo 1103 F1100K KOD FX Neo KFX-201 200 U 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products
More informationApplied molecular genetics testing for quality control in seed testing. Dr. Patrik Stolt ScanBi Diagnostics
Applied molecular genetics testing for quality control in seed testing Dr. Patrik Stolt ScanBi Diagnostics It is hard to find things you do not know that you are looking for! Short reminder about DNA/PCR
More informationMagExtractor -Genome-
Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification
More information1 General introduction. 1.1 Cauliflower importance
1 General introduction 1.1 Cauliflower importance Cauliflower (Brassica oleracea var. botrytis) is a cool season crop and a member of the Brassicaceae family. It is thought that cauliflower originated
More informationRubisco; easy Purification and Immunochemical Determination
Rubisco; easy Purification and Immunochemical Determination Ulrich Groß Justus-Liebig-Universität Gießen, Institute of Plant Nutrition, Department of Tissue Culture, Südanlage 6, D-35390 Giessen e-mail:
More informationMitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More information2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationEZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100
More informationDNA Technology Mapping a plasmid digesting How do restriction enzymes work?
DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria
More informationDNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More informationDevelopment of Lygus Management Strategies for Texas Cotton
Development of Lygus Management Strategies for Texas Cotton Ram Shrestha, Megha Parajulee, and Stanley Carroll Texas A&M AgriLife Research and Extension Center Lubbock, Texas 3 rd International Lygus Symposium,
More informationGENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
More informationGene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
More informationReplacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin
User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin
More informationSequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction
Sequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction Michael Motz*, Gregor Sagner 1, Svante PaÈaÈbo and Christian Kilger 2 Nucleic Acids Research, 2003, Vol.
More informationCloning and Expression of Recombinant Proteins
Cloning and Expression of Recombinant Proteins Dr. Günther Woehlke Dept. Physics E22 (Biophysics) Technical University Munich James-Franck-Str. D-85748 Garching Germany guenther.woehlke@mytum.de 1 Created
More informationSoybean Seeds Sampling and DNA Extraction. Report on the Validation of a DNA Extraction Method from Soybean Seeds
Soybean Seeds Sampling and DNA Extraction Report on the Validation of a DNA Extraction Method from Soybean Seeds 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer
More informationGlobal MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More information[29] Rapid Production of Single-Stranded Sequencing Template from Amplified DNA Using Magnetic Beads
[29] PRODUCTION OF ssdna SEQUENONO TEMPLATES 399 Dye terminator C 1 #1 Taq polymerase 4 units 9. Prepare the individual reactions to contain 12/zl DNA template, 7.25/d reaction premix, and 1/zl primer
More informationMICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
More informationAnalyzing Complexity For NP-Complete Problem Through DNA Computing Algorithm
Global Journal of Computer Science and Technology Vol. 10 Issue 13 (Ver. 1.0 ) October 2010 P a g e 43 Analyzing Complexity For NP-Complete Problem Through DNA Computing Algorithm Shalini Rajawat 1, Dr
More informationAuthentication of Basmati rice using SSR-PCR and QIAxcel Advanced
Application Note Authentication of Basmati rice using SSR-PCR and QIAxcel Advanced R. Cassier ADGENE Laboratoire, Thury Harcourt, France Introduction Basmati is one of the most popular types of rice in
More informationSYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
More informationGenetic Engineering and Biotechnology
1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines
More informationINSTRUCTION MANUAL. EZ DNA Methylation Kit Catalog Nos. D5001 & D5002. Highlights. Contents
INSTRUCTION MANUAL EZ DNA Methylation Kit Catalog Nos. D5001 & D5002 Highlights Streamlined, proven procedure for bisulfite conversion of DNA. Desulphonation and recovery of bisulfite-treated DNA with
More informationCloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
More informationDNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
More informationMultiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro
Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information.
More informationIntended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
More informationTIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
More informationRT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
More informationThermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
More informationBuccalAmp DNA Extraction Kit QuickExtract DNA Extraction Solution 1.0
QuickExtract DNA Extraction Solution 1.0 Cat. Nos. BQ0901S (CR, SC, RB, BS), BQ0908S (CR, SC, RB, BS), BQ0916S (CR, SC, RB, BS), QE09050, QEC091H, QEC89100, MB100BR, and MB100SP Please store the QuickExtract
More informationTransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationPNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
More information