SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2.

Size: px
Start display at page:

Download "SSR, 2 SSR, 150 bp (Bn92A),250bp (Bn72A). , nitens ; 2."

Transcription

1 41 1 () Vol. 41 No Journal of Xiamen University (Natural Science) Jan : (2002) SSR,,, (, ) :, GEN E BAN K, 2 SSR (Bn92A,Bn72A). PCR ( Touchdown PCR),,,, 12 DNA PCR.,PCR SSR,150 bp (Bn92A),250bp (Bn72A). SSR.,,2 SSR. :SSR ; ;; : Q 753 : A SSR ( simple sequence repeats) DNA [ 1, 2 ] DNA,16,( GT) n,( GA TA) n., PCR,,SSR,,, Dietrich [3 ] SSR, 1. 1cM ( Centi2Morgen). Akkaya [4 ] 96,29 SSR, RFL P 23.,,SSR RFL P. SSR SSR. DNA, DNA,, SSR.,,.,SSR, [5,6 ].,,,GEN E BAN K.,.,, SSR, SSR,, SSR : 2 58, 63 ; 23 # ; 2 98 ; 227,5 ; 2, ; 2RS21, YP1 ; 2 Moricandia nitens ; 2. : : ( ) :( ),,.

2 90 () : Taq DNA (dn TPs) Marker Promega ; SSR 2Bn92A (A) 28,Bn72A ( TAA) 5 ( GA) 4 [ 5,6 ] ;. : PCR : PE,9600 ; :752 ;:B IO2RAD,Power300. :UVP, GDS DNA 5 g,, 50 ml, 25 ml DNA (0. 1 mol/ L Tris2HCl, p H 8. 0 ; mol/ L ED TA, p H 8. 0 ; 1 mol/ L NaCl ; mol/ L 2ME) 20 % SDS 2. 5 ml, min,, 5 mol/ L KAc5 ml,, 30 min g 10 min,,,4 000 g 10 min., 10 mmol/ L N H 4 Ac 70 % DNA g 10 min,. 2 ml TE, DNA. 15 L RNaseA (10 mg/ ml ), 37 1 h,,, h DNA. DNA,70 %, 30 min,. 400L TE, 4. DNA TE 260 nm 280 nm, DNA, % DNA, DNA PCR PCR Touchdown PCR, : 1 PCR buffer, mmol/ L MgCl 2, mmol/ L dn TP,1. 0mol/ L SSR,1 U Taq,30 ng DNA. 20 L. : 94 1 min, 30 sec,72 45 sec, 68,1, ,20., (10 mmol/ L NaOH,95 % formamide,0. 05 %,0. 05 % ), 5 min,. 4 %6 %,100 W 0. 5 h,5l, 100 W 1. 5 h.,, 1 L (10 % ), 30 min., 1L ( 1 g/ L AgNO 3, % Formaldehyde). 30 min,, 1 L (2. 5 % Na 2 CO 3, % Na 2 SO 3, % formaldehyde), 1 L,3 min DNA Tab. 1 The results of the DNA extraction of 12 plant samples A 260 A 280 A 260 / A 280 (g/ g FW) # RS YP Moricandia nitens

3 1 :SSR DNA (112 :1. 58 ; ; 3. 3 # ; ; ; 6. 5 ; 7. ; 8. ; 9. RS21 ; 10. YP1 ; 11. Moricandia nitens ; 12. ; M :DNA/ Hind ) Fig. 1 DNA electrophosis examination of 12 plant species 2 SSR 12 (112 :1. 58 ; ; 3. 3 # ; ; ; 6. 5 ; 7. ; 8. ; 9. RS21 ; 10. YP1 ; 11. Moricandia nitens, ; 12. ; M :1kb ) Fig. 2 Amplification of 12 different species DNA with SSR primers of B rassica. napus, PCR DNA 12 DNA A 260 A 280 1, 1. 1, 12 DNA A 260 / A ,DNA. 1, DNA,23 kb. 12 DNA PCR SSR PCR Bn92A Bn72A SSR 12 DNA PCR, 2. 2, Bn92A,(, ) ; (RS21, YP1) ; ( Moricandia nitens), ()2 ; ( 58, 63), (27,5)2; (3 # )2 ; ( 98)2,150 bp. Bn72A YP1,

4 92 () bp.. [13,14 ] SSR Bn92A Bn72A. SSR,., SSR. 3,., 648 [ 7 ]., [8,9 ] [10,11 ] [1215 ] [16 ] [17 ] [18 ],2,.,,,,.. SSR,.. Asya [19 ],() SSR.,,,. : [1 ] Litt M, Luty J A. A hypervariable microsatellite reeveae by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene [ J ]. Am J Hum Genet, 1989, 44 : [ 2 ] Love J M, Knight A M. Towards construction of a high2 resolution map of the mouse genome using PCR2analyzed microsatellites [ J ]. Nucleic Acids Res., 1990, 18 : [3 ] Dietrich W F, Miller J, et al. A comprehensive genetic map of the mouse genome[j ]. Nature, 1996, 380 : [4 ] Akkaya M S, Cregan P B. Length polymorphisms of simple2sequence repeat DNA in soybean [ J ]. Genetics, 1992, 132 : [ 5 ] Kresovich S, Szewe2Mcfadden A K. Abundance and char2 acterization of simple2sequence repeats ( SSRs) isolated from a size2fractionate genomic library of B rassica napus L. (rapeseed) [J ]. Theor Appl Genet, 1995, 91 : [ 6 ] Szewc2Mcfadden A K. Kresovich S. Identification of polymorphic conserved simple2sequence repeats ( SSRs) in cultivated Brassica species [ J ]. Theor. Appl. Genet, 1996, 93 : [ 7 ] Obrien S, Seuaneze H N, Womax J. Mammalian genome organization: An evolutionary view [ J ]. Annu. Rev. Genet, 1988, 22 : [8 ] Bonierbale M W, Plaisted R L, Richter s,et al. RFL P maps based on a common set of clones reveal modes of chromosomal evolution in potato and tomato [J ]. Genet2 ics, 1988, 120 : [9 ] Tanksley S D. High density molecular linkage maps of the tomato and potato genomes : biological inferences and practical implications[j ]. Genetics, 1992, 132 : [10 ] Prince J, Pochard E, Tanksley S D. Construction of a molecular linkage map of pepper and a comparison of syteny with tomato [J ]. Genome, 1993, 36 : [11 ] Tanksley S D, Bernatzky R. Conservation of gene repertoire but not gene order in pepper and tomato [J ]. Proc Natl Acad Sci. USA, 1988, 85 : [12 ] Guimares C. Comparative mapping of sugarcane, maize and sorghum. Plant Genome IV [ M ]. San Diego, USA. : Garland Publishing, [13 ] Hulbert S H, Richter T E. Genetic mapping and char2 acterization of sorghum and related corps by means of maize DNA probes[j ]. Proc. Natl. Acad. Sci. USA, 1990, 87 : [14 ] Periera M G, Lee M, Bramel P. Construction of an RFL P map in sorghum and comparative mapping in maize[j ]. Genome, 1993, 37 : [15 ] Witkus R, Womak E. Comparative genome mapping of

5 1 :SSR 93 sorghum and maize[j ]. Genetic, 1992, 132 : [ 16 ] Ahn S, Tanksley S D. Comparative linkage maps of the maize and rice genomes[j ]. Mol. Gen. Genet, 1993, 247 : [17 ] Ahn S, Anderson J A. Homoeologous relationships of rice, wheat and maize chromosome [ J ]. Mol. Gen. Genet., 1993, 241 : [18 ] Teutonico R A, Osborn T C. Mapping of RFL P and qualitative trait loci in B rassica rapa and comparision to the linkage maps of B. napus, B. oleracea and A ra2 bidopsis thaliana[j ]. Theor. Appl. Genet, 1994, 89 : [19 ] Asya R, Yujuni K. Family of crucifurous[j ]. Planta, 1997, 34 : Common SSR Primers for Molecular Marker in Different Crops ZHOU Han2tao, ZHEN G Wen2zhu, ZHOU Yi2ting, XIA Tao ( School of Life Sciences, Xiamen University, Xiamen , China) Abstract : Using 2 pairs of SSR (Simple Sequence Repeats) primers form B rassica napus2bn92a Bn72A, syn2 thesized according to the reports on GEN E BAN K, DNAs extracted from 12 different crops (rice, maize, cot2 ton, rape, orange, cabbage, et al. ) were amplified bytouchdownpcr. The result shows that, the main bands of 150 bp and 250 bp amplified by Bn92A Bn72A respectively appear in all 12 crops and are the same size in B rassica napus by the same SSR primers. The results indicated that different kinds of genomes of crops have the certain extent comparability, and can use the common SSR primers for the molecular markers on genome comparative mapping. Key words : SSR ; molecular marker ; genome comparative mapping ; crops

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

Worksheet - COMPARATIVE MAPPING 1

Worksheet - COMPARATIVE MAPPING 1 Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.

Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C. Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH

More information

Castillo et al. Rice Archaeogenetics electronic supplementary information

Castillo et al. Rice Archaeogenetics electronic supplementary information Castillo et al. Rice Archaeogenetics electronic supplementary information Figure S1: PCR amplification for the nuclear genome region Sh4; and the sequence analysis. (a) Electrophoresis of 10 PCR products

More information

SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION

SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION SUGAR BEET (Beta vulgaris L.) PROMOTERS FOR DIRECTED TISSUE- SPECIFIC ROOT TRANSCRIPTION Senthilkumar Padmanaban, Haiyan Li, David P. Puthoff and Ann C. Smigocki USDA-ARS Molecular Plant Pathology Laboratory,

More information

MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING

MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING Viktor Korzun Lochow-Petkus GmbH, Grimsehlstr.24, 37574 Einbeck, Germany korzun@lochow-petkus.de Summary The development of molecular techniques

More information

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788

MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 MATCH Communications in Mathematical and in Computer Chemistry MATCH Commun. Math. Comput. Chem. 61 (2009) 781-788 ISSN 0340-6253 Three distances for rapid similarity analysis of DNA sequences Wei Chen,

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

Reliable PCR Components for Molecular Diagnostic Assays

Reliable PCR Components for Molecular Diagnostic Assays Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

Usefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers

Usefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers J. Appl. Genet. 44(3), 2003, pp. 419-423 Short communication Usefulness of polymorphic markers in exclusion of BRCA1/BRCA2 mutations in families with aggregation of breast/ovarian cancers Bohdan GÓRSKI,

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

An example of bioinformatics application on plant breeding projects in Rijk Zwaan An example of bioinformatics application on plant breeding projects in Rijk Zwaan Xiangyu Rao 17-08-2012 Introduction of RZ Rijk Zwaan is active worldwide as a vegetable breeding company that focuses on

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

DNA Isolation Kit for Cells and Tissues

DNA Isolation Kit for Cells and Tissues DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS

TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS J.-M. Lacape, T.-B. Nguyen, B. Hau, and M. Giband CIRAD-CA, Programme Coton, TA 70/03, Avenue Agropolis, 34398 Montpellier Cede

More information

A quick and simple method for the identi cation of meat species and meat products by PCR assay

A quick and simple method for the identi cation of meat species and meat products by PCR assay Meat Science 51 (1999) 143±148 A quick and simple method for the identi cation of meat species and meat products by PCR assay T. Matsunaga a, K. Chikuni b *, R. Tanabe b, S. Muroya b, K. Shibata a, J.

More information

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis

SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

(3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS

(3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS (3) UNRAVELING PEACH FRUIT MEALINESS AND COLD STORAGE BROWNING WITH GENOMIC TOOLS Ebenezer A. Ogundiwin 1, Antonio Granell 2, Thomas M. Gradziel 1, and Carlos H. Crisosto 1 1 Department of Plant Sciences,

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,

More information

Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.

Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Patent issues in Industrial Biotech:

Patent issues in Industrial Biotech: Patent issues in Industrial Biotech: Nucleic Acids, Life Forms & Natural Products Konrad Sechley PhD, Vancouver, Canada 18 April, 2016 OVERVIEW Gene patenting Life Forms & Natural Products Conclusions

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031

EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031 INSTRUCTION MANUAL EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031 Highlights Fastest method for complete bisulfite conversion of DNA for methylation analysis. Ready-to-use conversion reagent

More information

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue

ONLINE SUPPLEMENTAL MATERIAL. Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue ONLINE SUPPLEMENTAL MATERIAL Allele-Specific Expression of Angiotensinogen in Human Subcutaneous Adipose Tissue Sungmi Park 1, Ko-Ting Lu 1, Xuebo Liu 1, Tapan K. Chatterjee 2, Steven M. Rudich 3, Neal

More information

NetPrimer Manual. PREMIER Biosoft International. 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773

NetPrimer Manual. PREMIER Biosoft International. 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773 NetPrimer Manual PREMIER Biosoft International 3786 Corina Way, Palo Alto, CA 94303-4504 Tel: 650-856-2703 FAX: 650-618-1773 E-mail: sales@premierbiosoft.com 1 Copyright 2009 by PREMIER Biosoft International.

More information

Brief Communication. B. Freeman, 1 N. Smith, 1 C. Curtis, 1 L. Huckett, 1 J. Mill, 1 and I. W. Craig 1,2

Brief Communication. B. Freeman, 1 N. Smith, 1 C. Curtis, 1 L. Huckett, 1 J. Mill, 1 and I. W. Craig 1,2 Behavior Genetics, Vol. 33, No. 1, January 2003 ( 2003) Brief Communication DNA from Buccal Swabs Recruited by Mail: Evaluation of Storage Effects on Long-term Stability and Suitability for Multiplex Polymerase

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer

DNA Insertions and Deletions in the Human Genome. Philipp W. Messer DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.

More information

Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island

Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory

More information

How To Make A Tri Reagent

How To Make A Tri Reagent TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient

More information

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.

FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. Instruction manual for KOD FX Neo 1103 F1100K KOD FX Neo KFX-201 200 U 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products

More information

Applied molecular genetics testing for quality control in seed testing. Dr. Patrik Stolt ScanBi Diagnostics

Applied molecular genetics testing for quality control in seed testing. Dr. Patrik Stolt ScanBi Diagnostics Applied molecular genetics testing for quality control in seed testing Dr. Patrik Stolt ScanBi Diagnostics It is hard to find things you do not know that you are looking for! Short reminder about DNA/PCR

More information

MagExtractor -Genome-

MagExtractor -Genome- Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification

More information

1 General introduction. 1.1 Cauliflower importance

1 General introduction. 1.1 Cauliflower importance 1 General introduction 1.1 Cauliflower importance Cauliflower (Brassica oleracea var. botrytis) is a cool season crop and a member of the Brassicaceae family. It is thought that cauliflower originated

More information

Rubisco; easy Purification and Immunochemical Determination

Rubisco; easy Purification and Immunochemical Determination Rubisco; easy Purification and Immunochemical Determination Ulrich Groß Justus-Liebig-Universität Gießen, Institute of Plant Nutrition, Department of Tissue Culture, Südanlage 6, D-35390 Giessen e-mail:

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass

EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100

More information

DNA Technology Mapping a plasmid digesting How do restriction enzymes work?

DNA Technology Mapping a plasmid digesting How do restriction enzymes work? DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Development of Lygus Management Strategies for Texas Cotton

Development of Lygus Management Strategies for Texas Cotton Development of Lygus Management Strategies for Texas Cotton Ram Shrestha, Megha Parajulee, and Stanley Carroll Texas A&M AgriLife Research and Extension Center Lubbock, Texas 3 rd International Lygus Symposium,

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin

More information

Sequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction

Sequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction Sequential DEXAS: a method for obtaining DNA sequences from genomic DNA and blood in one reaction Michael Motz*, Gregor Sagner 1, Svante PaÈaÈbo and Christian Kilger 2 Nucleic Acids Research, 2003, Vol.

More information

Cloning and Expression of Recombinant Proteins

Cloning and Expression of Recombinant Proteins Cloning and Expression of Recombinant Proteins Dr. Günther Woehlke Dept. Physics E22 (Biophysics) Technical University Munich James-Franck-Str. D-85748 Garching Germany guenther.woehlke@mytum.de 1 Created

More information

Soybean Seeds Sampling and DNA Extraction. Report on the Validation of a DNA Extraction Method from Soybean Seeds

Soybean Seeds Sampling and DNA Extraction. Report on the Validation of a DNA Extraction Method from Soybean Seeds Soybean Seeds Sampling and DNA Extraction Report on the Validation of a DNA Extraction Method from Soybean Seeds 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer

More information

Global MicroRNA Amplification Kit

Global MicroRNA Amplification Kit Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

[29] Rapid Production of Single-Stranded Sequencing Template from Amplified DNA Using Magnetic Beads

[29] Rapid Production of Single-Stranded Sequencing Template from Amplified DNA Using Magnetic Beads [29] PRODUCTION OF ssdna SEQUENONO TEMPLATES 399 Dye terminator C 1 #1 Taq polymerase 4 units 9. Prepare the individual reactions to contain 12/zl DNA template, 7.25/d reaction premix, and 1/zl primer

More information

MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA

MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If

More information

Analyzing Complexity For NP-Complete Problem Through DNA Computing Algorithm

Analyzing Complexity For NP-Complete Problem Through DNA Computing Algorithm Global Journal of Computer Science and Technology Vol. 10 Issue 13 (Ver. 1.0 ) October 2010 P a g e 43 Analyzing Complexity For NP-Complete Problem Through DNA Computing Algorithm Shalini Rajawat 1, Dr

More information

Authentication of Basmati rice using SSR-PCR and QIAxcel Advanced

Authentication of Basmati rice using SSR-PCR and QIAxcel Advanced Application Note Authentication of Basmati rice using SSR-PCR and QIAxcel Advanced R. Cassier ADGENE Laboratoire, Thury Harcourt, France Introduction Basmati is one of the most popular types of rice in

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

INSTRUCTION MANUAL. EZ DNA Methylation Kit Catalog Nos. D5001 & D5002. Highlights. Contents

INSTRUCTION MANUAL. EZ DNA Methylation Kit Catalog Nos. D5001 & D5002. Highlights. Contents INSTRUCTION MANUAL EZ DNA Methylation Kit Catalog Nos. D5001 & D5002 Highlights Streamlined, proven procedure for bisulfite conversion of DNA. Desulphonation and recovery of bisulfite-treated DNA with

More information

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding

More information

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

More information

Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro

Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information.

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

BuccalAmp DNA Extraction Kit QuickExtract DNA Extraction Solution 1.0

BuccalAmp DNA Extraction Kit QuickExtract DNA Extraction Solution 1.0 QuickExtract DNA Extraction Solution 1.0 Cat. Nos. BQ0901S (CR, SC, RB, BS), BQ0908S (CR, SC, RB, BS), BQ0916S (CR, SC, RB, BS), QE09050, QEC091H, QEC89100, MB100BR, and MB100SP Please store the QuickExtract

More information

TransformAid Bacterial Transformation Kit

TransformAid Bacterial Transformation Kit Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

PNA BRAF Mutation Detection Kit

PNA BRAF Mutation Detection Kit - PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit

More information