Jable of Contents. Chapter 2 Tutorial: Create a Tree! 9. Chapter 1 Read Me First! 1
|
|
|
- Joseph Bailey
- 7 years ago
- Views:
Transcription
1 BIBLIOTECAFUNDA Jable of Contents Chapter 1 Read Me First! 1 A Brief Overview 1 New and Improved Software 2 The Easy Steps to Making a Tree 2 Learn More about the Principies 4 Computer Programs Discussed and Where to Obtain Them 4 MEGA 5 PHYML 5 MrBayes 5 Codeml 5 Utility Programs 6 Macintosh Only! 6 The Phylogenetic Trees Made Easy Website 6 Register for Updated Information 7 Some Conventions Used in This Book 7 Chapter 2 Tutorial: Create a Tree! 9 Why Create Phylogenetic Trees? 9 About this Tutorial 10 MEGA 10 Obtaining Related Sequences by a BLASTSearch 11 Step 1: Use BLAST to Search for Sequences Related to Your Sequence 12 Step 2: Decide Which Related Sequences to Include on Your Tree 14 Step 3: Download the Sequence 18 Aligning the Sequences 22 Make a Neighbor-Joining Tree 25 Summary 29
2 Chapter3 AcquiringandAligningthe Sequences 31 Selecting Homologs: What Sequences Can Be Put onto a Single Tree? 31 Finding Homologous Sequences by a BLASTSearch 32 Other Ways to Find Sequencesof Interest: Beware! The Risks Are High 40 Aligning the Sequences 45 Eliminate Duplicate Sequences51 Eliminate Obviously Wrong Sequences53 Check Average Amino Acid Identity to Estimate Reliability of the Alignment 55 Non-Coding DNA Sequences56 Interlude I Major Methods for Estimating Phylogenetic Trees 57 LEARN MORE ABOUTTREE-SEARCHINGMETHODS 58 Distance versus Character-Based Methods 60 Data FiJesUsed to JIIustrate Methods 61 Chapter 4 Neighbor-Joining Trees 63 Determinethe Suitability of the Datafor a Neighbor-joining Tree 63 LEARN MORE ABOUT DISTANCE METHODS 65 LEARN MORE ABOUT PHYLOGENETIC TREES 67 Estimate the Neighbor-joining Tree 70 LEARN MORE ABOUT EVOLUTIONARY MODELS 75 Estimating the Reliability of a Tree 80 LEARN MORE ABOUT ESTIMATING THE RELIABILITY OF PHYLOGENETIC TREES 81 Whatabout ProteinSequences?88
3 Chapter5 DrawingPhylogeneticTrees 89 Changing the Appearance of a Tree 89 Rooting a Tree 99 Finding an Outgroup 101 Subtrees 103 Saving Trees 105 Captions 106 Chapter6 Parsimony109 Search Methods 110 LEARN MORE ABOUT PARSIMONY 112 Multiple Equally Parsimonious Trees 115 Branch Lengths 117 Level of CNI Search 118 Consensus and Bootstrap Trees 118 What about Protein Sequences? 123 Chapter7 MaximumLikelihood125 Saving the Data in the PHYLlPFormat 125 LEARN MORE ABOUT MAXIMUM LIKELIHOOD 126 Installing and Starting PHYML 129 Running PHYML 130 Importingthe MLTreeDescription into MEGAand Drawing the Tree 132 Tree ReliabilityEstimated by the approximatelikelihoodratio Test Method (alrt) 136 LEARNMOREABOUTALRT 137 The Special Case of Zero Length Branches 139 TestAlternative Models 140 What about Protein Sequences? 141
4 Chapter8 BayesianInferenceof Trees with MrBayes 143 LEARN MORE ABOUT BAYESIAN ANALYSIS 144 Creatingthe ExecutionFiJe 146 Whatthe Statementsin the ExampleMrBayesBlock Do 148 WhatHappensduring MrBayesAnalysis? 149 Thesumt Command 152 WhatIfYou Don' t GetConvergence?152 Visualizingthe MrBayesTree 154 Whatabout ProteinSequences?157 Forthcoming Versionof MrBayes 157 Interlude 11 Which Method Should You Use? 159 Accuracy 160 Ease of Interpretation 160 Time and Convenience 161 Different Estimates of Tree Reliability 162 Chapter9 ReconstructingAncestral Sequences 165 Using MrBayes to Estimate Ancestral Sequences 166 The Alignment 166 Construct the Phylogeny 166 Estimate the Ancestral Sequence 166 Making Senseof the sump.anc File 169 Correcting Ancestral Sequences for Ancestral Gaps 173 The Emergency Sump Program 174 The Corrected Sequence 176 What about the Unreliable Sites? 176
5 Chapter10 Detecting Adaptive Evolution 177 UsingMEGA to Detect Adaptive Evo/ution 178 Using Codem/ to Detect Adaptive Evo/ution 183 Windows Installation 183 Macintosh OSXInstallation 183 Unix/Linux Users 183 The Files You Need to Run Codeml 183 The Codeml Control File 184 Questions That Underlie the Models 184 Run Codeml 186 Identify the Branches along Which Selection May Have Occurred 186 Test the Statistical Significance of the dn / ds Ratios 186 Chapter 11 Workingwith VariousComputer Platforms 189 The Line Endings Issue 189 MEGA for Macintosh Users 190 PPC-BasedMacs 190 Intel-Based Macs 191 Download and Install MEGA 191 MEGA for Unix/Linux Users 191 MEGA for Windows Users 191 Windows Users: Create a bin Fo/der and a Path to It 192 A Brief Visit to the Command Prompt Program for Windows Users 194 A Brief Visit to Unix for Macintosh Users 196 PHYML for Windows Users 197 PHYML for Macintosh Users 198 Install PHYML 198 PHYML for Unix/Linux Users 198 MrBayes for Windows Users 198 MrBayes for Macintosh Users 199 Compile MrBayes for Your Mac 199 Using the MrBayes Binary 199
6 MrBayes for Unix/Linux Users 200 Utility Programs for Windows Users 200 Installing the Utility Programs 200 Running the Utility Programs 200 Utility Programs for Macintosh Users 200 Installing the Utility Programs 200 Running the Utility Programs 201 Utility Programs for Linux and Unix Users 201 Compiling the Utility Programs 201 Running the Utility Programs 201 Specific Instructions for the Utility Programs in the Download Packages 202 Appendix 1 FUe Formats and Their Interconversion 205 Formats Used by Programs Discussed in This Book 205 The MEGA Format 205 TheFASTAFormat 206 The Nexus Format 207 PHYLIP 209 Other File Formats 211 The GCG/MSF Format 211 PileUp 211 The NBRF/PIR Format 212 Interconverting Formats 213 Appendix 11 Additional programs 215 Literature Cited 221 Index to Major Programs Discussed 223 Subject Index 229
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
Bayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
Introduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
Visualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat
Arbres formels et Arbre(s) de la Vie
Arbres formels et Arbre(s) de la Vie A bit of history and biology Definitions Numbers Topological distances Consensus Random models Algorithms to build trees Basic principles DATA sequence alignment distance
Contents. list of contributors. Preface. Basic concepts of molecular evolution 3
list of contributors Foreword Preface page xix xxiii XXV Section I: Introduction Basic concepts of molecular evolution 3 Anne-Mieke Vandamme 1.1 Genetic information 3 1.2 Population dynamics 9 1.3 Evolution
PAML FAQ... 1 Table of Contents... 1. Data Files...3. Windows, UNIX, and MAC OS X basics...4 Common mistakes and pitfalls...5. Windows Essentials...
PAML FAQ Ziheng Yang Last updated: 5 January 2005 (not all items are up to date) Table of Contents PAML FAQ... 1 Table of Contents... 1 Data Files...3 Why don t paml programs read my files correctly?...3
morephyml User Guide [Version 1.14] August 2011 by Alexis Criscuolo
![morephyml User Guide [Version 1.14] August 2011 by Alexis Criscuolo](/thumbs/33/15806725.jpg "morephyml User Guide [Version 1.14] August 2011 by Alexis Criscuolo")
morephyml User Guide [Version 1.14] August 2011 by Alexis Criscuolo ftp://ftp.pasteur.fr/pub/gensoft/projects/morephyml/ http://mobyle.pasteur.fr/cgi-bin/portal.py Please cite this paper if you use this
MEGA. Molecular Evolutionary Genetics Analysis VERSION 4. Koichiro Tamura, Joel Dudley Masatoshi Nei, Sudhir Kumar
MEGA Molecular Evolutionary Genetics Analysis VERSION 4 Koichiro Tamura, Joel Dudley Masatoshi Nei, Sudhir Kumar Center of Evolutionary Functional Genomics Biodesign Institute Arizona State University
Software review. Pise: Software for building bioinformatics webs
Pise: Software for building bioinformatics webs Keywords: bioinformatics web, Perl, sequence analysis, interface builder Abstract Pise is interface construction software for bioinformatics applications
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
User Manual for SplitsTree4 V4.14.2
User Manual for SplitsTree4 V4.14.2 Daniel H. Huson and David Bryant November 4, 2015 Contents Contents 1 1 Introduction 4 2 Getting Started 5 3 Obtaining and Installing the Program 5 4 Program Overview
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
Amino Acids and Their Properties
Amino Acids and Their Properties Recap: ss-rrna and mutations Ribosomal RNA (rrna) evolves very slowly Much slower than proteins ss-rrna is typically used So by aligning ss-rrna of one organism with that
PHYLOGENETIC ANALYSIS
Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
DNA Sequence Alignment Analysis
Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes
A short guide to phylogeny reconstruction
A short guide to phylogeny reconstruction E. Michu Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic ABSTRACT This review is a short introduction to phylogenetic
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
PhyML Manual. Version 3.0 September 17, 2008. http://www.atgc-montpellier.fr/phyml
PhyML Manual Version 3.0 September 17, 2008 http://www.atgc-montpellier.fr/phyml Contents 1 Citation 3 2 Authors 3 3 Overview 4 4 Installing PhyML 4 4.1 Sources and compilation.............................
Missing data and the accuracy of Bayesian phylogenetics
Journal of Systematics and Evolution 46 (3): 307 314 (2008) (formerly Acta Phytotaxonomica Sinica) doi: 10.3724/SP.J.1002.2008.08040 http://www.plantsystematics.com Missing data and the accuracy of Bayesian
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
The Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
Pairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Online Chapter B. Running Programs
Online Chapter B Running Programs This online chapter explains how you can create and run Java programs without using an integrated development environment (an environment like JCreator). The chapter also
(A GUIDE for the Graphical User Interface (GUI) GDE)
The Genetic Data Environment: A User Modifiable and Expandable Multiple Sequence Analysis Package (A GUIDE for the Graphical User Interface (GUI) GDE) Jonathan A. Eisen Department of Biological Sciences
Objectives. Chapter 2: Operating-System Structures. Operating System Services (Cont.) Operating System Services. Operating System Services (Cont.
Objectives To describe the services an operating system provides to users, processes, and other systems To discuss the various ways of structuring an operating system Chapter 2: Operating-System Structures
Core Bioinformatics. Titulació Tipus Curs Semestre. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Codi: 42397 Crèdits: 12 Titulació Tipus Curs Semestre 4313473 Bioinformàtica/Bioinformatics OB 0 1 Professor de contacte Nom: Sònia Casillas Viladerrams Correu electrònic:
2 Short biographies and contact information of the workshop organizers
1 Title of the workshop from sequence to surveillance 2 Short biographies and contact information of the workshop organizers Dr Peter Durr - peter.durr@csiro.au Veterinary epidemiologist, Australian Animal
Inference of Large Phylogenetic Trees on Parallel Architectures. Michael Ott
Inference of Large Phylogenetic Trees on Parallel Architectures Michael Ott TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Rechnertechnik und Rechnerorganisation / Parallelrechnerarchitektur Inference of
Core Bioinformatics. Degree Type Year Semester
Core Bioinformatics 2015/2016 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: Sonia.Casillas@uab.cat Teachers Use of
PHYLOGENY AND COMPARATIVE METHODS SYMBIOMICS WORKSHOP
PHYLOGENY AND COMPARATIVE METHODS SYMBIOMICS WORKSHOP March 4-7, 2013 Valencia, Spain Parc Cientific of the University of Valencia Goals The aim of this workshop is to provide the attendees with a broad
Network Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
Molecular Clocks and Tree Dating with r8s and BEAST
Integrative Biology 200B University of California, Berkeley Principals of Phylogenetics: Ecology and Evolution Spring 2011 Updated by Nick Matzke Molecular Clocks and Tree Dating with r8s and BEAST Today
The IDL Virtual Machine
The IDL Virtual Machine The IDL Virtual Machine is a fully functional runtime version of IDL that can execute IDL.sav files without an IDL license. It is designed to provide developers of IDL programs
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
Outline. hardware components programming environments. installing Python executing Python code. decimal and binary notations running Sage
Outline 1 Computer Architecture hardware components programming environments 2 Getting Started with Python installing Python executing Python code 3 Number Systems decimal and binary notations running
A comparison of methods for estimating the transition:transversion ratio from DNA sequences
Molecular Phylogenetics and Evolution 32 (2004) 495 503 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev A comparison of methods for estimating the transition:transversion ratio from
Installing C++ compiler for CSc212 Data Structures
for CSc212 Data Structures WKhoo@gc.cuny.edu Spring 2010 1 2 Testing Mac 3 Why are we not using Visual Studio, an Integrated Development (IDE)? Here s several reasons: Visual Studio is good for LARGE project.
Keywords: evolution, genomics, software, data mining, sequence alignment, distance, phylogenetics, selection
Sudhir Kumar has been Director of the Center for Evolutionary Functional Genomics in The Biodesign Institute at Arizona State University since 2002. His research interests include development of software,
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
A branch-and-bound algorithm for the inference of ancestral. amino-acid sequences when the replacement rate varies among
A branch-and-bound algorithm for the inference of ancestral amino-acid sequences when the replacement rate varies among sites Tal Pupko 1,*, Itsik Pe er 2, Masami Hasegawa 1, Dan Graur 3, and Nir Friedman
Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
IBM WebSphere Application Server V8.5 lab Basic Liberty profile administration using the job manager
IBM WebSphere Application Server V8.5 lab Basic Liberty profile administration using the job manager Scenario You are a system administrator responsible for managing web application server installations.
Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
Remote Access to Unix Machines
Remote Access to Unix Machines Alvin R. Lebeck Department of Computer Science Department of Electrical and Computer Engineering Duke University Overview We are using OIT Linux machines for some homework
STUDY GUIDE CHAPTER 4
STUDY GUIDE CHAPTER 4 True/False Indicate whether the statement is true or false. 1. A(n) desktop operating system is designed for a desktop or notebook personal computer. 2. A(n) mirrored user interface
CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu liwz@sdsc.edu 1. Introduction
Distributed Version Control
Distributed Version Control Faisal Tameesh April 3 rd, 2015 Executive Summary Version control is a cornerstone of modern software development. As opposed to the centralized, client-server architecture
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Installing Bacula Client on Mac OS X Server
Installing Bacula Client on Mac OS X Server This tutorial guides you through a Bacula install on a fresh installation of Mac OS X Server 10.5 (Leopard). This does not include setting up firewall settings.
Phylogenetic Models of Rate Heterogeneity: A High Performance Computing Perspective
Phylogenetic Models of Rate Heterogeneity: A High Performance Computing Perspective Alexandros Stamatakis Institute of Computer Science, Foundation for Research and Technology-Hellas P.O. Box 1385, Heraklion,
Section 3 Comparative Genomics and Phylogenetics
Section 3 Section 3 Comparative enomics and Phylogenetics At the end of this section you should be able to: Describe what is meant by DNA sequencing. Explain what is meant by Bioinformatics and Comparative
Evidence for evolution factsheet
The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.
Gerry Hobbs, Department of Statistics, West Virginia University
Decision Trees as a Predictive Modeling Method Gerry Hobbs, Department of Statistics, West Virginia University Abstract Predictive modeling has become an important area of interest in tasks such as credit
Bootstrap guide for the File Station
Bootstrap guide for the File Station Introduction Through the File Server it is possible to store files and create automated backups on a reliable, redundant storage system. NOTE: this guide considers
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
Online Resource 9. Figure S8: Amino acid alignments.
Online Resource 9 This file contains amino acid alignments of the Long Oskar and Lasp-binding domains from 18 Drosophilids including the D. virilis allele from Webster et al. (1994) using the PRANK MSA,
A data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
Problems and Measures Regarding Waste 1 Management and 3R Era of public health improvement Situation subsequent to the Meiji Restoration
Let s Learn Market Mechanism by Artificial Market Attached CD-ROM README file U-Mart project
Let s Learn Market Mechanism by Artificial Market Attached CD-ROM README file U-Mart project 1. Introduction The U-Mart system is a system that builds a virtual artificial futures market on a computer
Research Journal of Pharmaceutical, Biological and Chemical Sciences
Research Journal of Pharmaceutical, Biological and Chemical Sciences Protein coding gene, cels2 shows congruency with 16S rrna phylogeny in highly evolving streptomycetes Madison P Munar 1,2*, Young-Geun
ALTER: program-oriented conversion of DNA and protein alignments
Nucleic Acids Research Advance Access published May 3, 2010 Nucleic Acids Research, 2010, 1 5 doi:10.1093/nar/gkq321 ALTER: program-oriented conversion of DNA and protein alignments Daniel Glez-Peña 1,
JERZY A. LIS 1, JOANNA OLCHOWIK 2, MAGDALENA BULIŃSKA-BALAS 3. Introduction
Preliminary studies on the usefulness of DNA mini-barcodes for determining phylogenetic relationships within shieldbugs (Hemiptera: Heteroptera: ) JERZY A. LIS 1, JOANNA OLCHOWIK 2, MAGDALENA BULIŃSKA-BALAS
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS
BIO 3352: BIOINFORMATICS II HYBRID COURSE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title: Bioinformatics
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
INSTALLING MALTED 3.0 IN LINUX MALTED: INSTALLING THE SYSTEM IN LINUX. Installing Malted 3.0 in LINUX
MALTED: INSTALLING THE SYSTEM IN 1 Installing Malted 3.0 in INDEX: 1) How to install JAVA 1.1 Downloading Java Virtual Machine 1.2 Installing Java Virtual Machine 2) How to install Malted 2.1 Launching
CHAPTER 17: File Management
CHAPTER 17: File Management The Architecture of Computer Hardware, Systems Software & Networking: An Information Technology Approach 4th Edition, Irv Englander John Wiley and Sons 2010 PowerPoint slides
Evaluating the Performance of a Successive-Approximations Approach to Parameter Optimization in Maximum-Likelihood Phylogeny Estimation
Evaluating the Performance of a Successive-Approximations Approach to Parameter Optimization in Maximum-Likelihood Phylogeny Estimation Jack Sullivan,* Zaid Abdo, à Paul Joyce, à and David L. Swofford
A Rough Guide to BEAST 1.4
A Rough Guide to BEAST 1.4 Alexei J. Drummond 1, Simon Y.W. Ho, Nic Rawlence and Andrew Rambaut 2 1 Department of Computer Science The University of Auckland, Private Bag 92019 Auckland, New Zealand alexei@cs.auckland.ac.nz
PROGRAMMING FOR BIOLOGISTS. BIOL 6297 Monday, Wednesday 10 am -12 pm
PROGRAMMING FOR BIOLOGISTS BIOL 6297 Monday, Wednesday 10 am -12 pm Tomorrow is Ada Lovelace Day Ada Lovelace was the first person to write a computer program Today s Lecture Overview of the course Philosophy
Cincom Smalltalk. Installation Guide P46-0105-17 SIMPLIFICATION THROUGH INNOVATION
Cincom Smalltalk Installation Guide P46-0105-17 SIMPLIFICATION THROUGH INNOVATION 1995 2011 by Cincom Systems, Inc. All rights reserved. This product contains copyrighted third-party software. Part Number:
EMBnet Norway User introduction pack (instructions and services overview) George Magklaras Head Systems Engineer Version 3.
EMBnet Norway User introduction pack (instructions and services overview) George Magklaras Head Systems Engineer Version 3.2 (February 2008) How to connect a Windows workstation to the EMBnet servers using
Supported platforms & compilers Required software Where to download the packages Geant4 toolkit installation (release 9.6)
Supported platforms & compilers Required software Where to download the packages Geant4 toolkit installation (release 9.6) Configuring the environment manually Using CMake CLHEP full version installation
Cygwin: getting the setup tool
Cygwin: getting the setup tool Free, almost complete UNIX environment emulation for computers running MS Windows. Very handy. 1 First, go to the Cygwin Site: http://www.cygwin.org/cygwin/ Download the
Binary Search Trees. Data in each node. Larger than the data in its left child Smaller than the data in its right child
Binary Search Trees Data in each node Larger than the data in its left child Smaller than the data in its right child FIGURE 11-6 Arbitrary binary tree FIGURE 11-7 Binary search tree Data Structures Using
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
Module 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
Setting Up a Dreamweaver Site Definition for OIT s Web Hosting Server
page of 4 oit UMass Office of Information Technologies Setting Up a Dreamweaver Site Definition for OIT s Web Hosting Server This includes Web sites on: https://webadmin.oit.umass.edu/~user http://people.umass.edu/
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Phylogenetic Analysis using MapReduce Programming Model
2015 IEEE International Parallel and Distributed Processing Symposium Workshops Phylogenetic Analysis using MapReduce Programming Model Siddesh G M, K G Srinivasa*, Ishank Mishra, Abhinav Anurag, Eklavya
6 Creating the Animation
6 Creating the Animation Now that the animation can be represented, stored, and played back, all that is left to do is understand how it is created. This is where we will use genetic algorithms, and this
Unipro UGENE Manual. Version 1.20.0
Unipro UGENE Manual Version 1.20.0 December 16, 2015 Unipro UGENE Online User Manual About Unipro About UGENE Key Features User Interface High Performance Computing Cooperation Download and Installation