(ATP binding cassette transporter, ABC) 6

Transcription

1 1084 Chinese Journal of Pathophysiology 2003,19 (8) : [ ] (2003) A 1 THP - 1 3, #,,,, (,, ) [ ] : THP - 1, ABCA1 THP - 1 : RT - PCR ABCA1 mrna : THP - 1, 22 (R) - THP - 1, DIDS THP - 1 ;, 22 (R) - THP - 1 ABCA1 mrna, DIDS THP - 1 ABCA1 mrna : ABCA1, ABCA1 [] ATP ;;, LDL [] R363 [] A (ATP binding cassette transporter, ABC) 6 A B C D E F, 48,A 12 1 [1 ] ABCA1 9q31,150 kb, FJ P ( ), CP100MX ( Tokyo Japan) ; THP - 1 ; bp, - Promega ABCA ; (BSA) apoa - 1 Phorbol myristate 254 kd [2 ] AB2 acetate ( PMA) 22 ( R) - hydroxycholesterol ( 22 ( R) - CA1 2 2 Hch) 4,4 - diisothiocyanostilbene - 2,2 - disulfonic (nucleotide binding domains, NBD1 NBD2), acid (DIDS) Sigma ;RNA ATP, (Trizol) ;ABCA1 GAPDH 6,1 ( ) ; (regulatory domains, RD) [3 ] ABCA1 1994, 2 ( low density lipoprotein, LDL) 1999, THP , ABCA1 22 (R) - [4 ], (22 (R) - hydroxycholesterol) 4,4 - di2 210 ml isothiocyanostilbene - 2,2 - disulfonic acid (DIDS),, mrna, g g/ L, ABCA1 210 ml, [ ] [ ] [ ] (01SSY1003) # Tel : ; E - mail : mail. com r/ min 18 h,, r/ min 4 20 h, LDL LDL 200mol/ L EDTA PBS 48 h,,bca, ( PBS)

2 g/ L, LDL PBS 72 h,200mol/ L CuSO 4, ABCA1 PBS,37 16 h, 200mol/ L 6 O PBS 24 h,pbs 4 24 h, min, O 8 min, 6 min, LDL,10 %,0. 25 % 1 %HCH,, LDL,,,, 0. 5 % 3 7 THP % RPMI 1640 ( gx s),, 37 5 %CO 2 t HEPES 10 mmol/ L U/L, 160 nmol/ L (phorbol myristate acetate, PMA) THP h, 1 THP - 1 [5, 6 ] 4,50 mg/ L ox - LDL THP - 1 [5 ],THP 48 h, O,, Bq/ L [ 3 H] 50 mg/ L, (ox - LDL) 10 % 2 apoa - 1 THP - 1 RPMI h, PBS, 2 g/ L RPMI 1640 PMA THP - 1, 24 h, PBS, 6 : (1) Medium, 10 mg/ L A - 1 (apoprotein A - 1) ; (2) BSA, 2 g/ L BSA ; (3) 12 h, HDL, 50 mg/ L HDL ; (4) apoa - 1 [ 3 H ],, 10 mg/ L apoa - 1 ; (5) ox - LDL, counts/ min counts/ min (counts/ min + 50 mg/ L aox - LDL ; (6) ox - LDL + counts/ min), 100 % apoa - 1, 50 mg/ L ox - LDL 10 5 mg/ L apoa - 1 THP - 1 ( / ) %2149 %5132 %6157 %5178 %9143 % ( 1) mg/ L ox - LDL 48 h, 24 h, PBS,10 mg/ L apoa h, Trizol RNA RNA 2g cdna, 1 L PCR 94, 5 min, 94 1 min, 60 1 min, 72 1 min, 34, 72, 10 minabca1 ( GenBank : AF285167) : 5 - GCTGCTGA AGCCAGGGCATGGG - 3, 5 - GTGGGGCAGTGGC2 CATACTCC - 3, PCR 306 bp GAPDH : 5 - TCACCATCTTCCAGGAGCGAG - 3, 5 - TGTCGCTGTTGAAGTCAGAG - 3, PCR 697 bp, 10 L 1. 5 %,, UVP, GAPDH 6,,PBS 3,50 %1 Fig 1 Effects of ox - LDL, HDL and apoa - 1 on cholesterol efflux in THP - 1 macrophages. gx s. n = 3. 3 P < vs medium group ; # P < vs HDL, apoa - 1 and ox - LDL group, respectively. 1 HDL apoa - 1 THP - 1

3 ( R) - THP mg/ L ox - LDL THP h,22 (R) - 24 h, apoa (R) - 0mol/ L 1. 25mol/ L 2. 5mol/ L 5mol/ L 10mol/ L 20mol/ L apoa - 1,9. 8 % % % % % %( 2) 24 h,abca1 GAPDH,, ( 4) Fig 2 Effects of 22 (R) - hydroxycholesterol on cholesterol efflux in THP - 1 macrophage - derived foam cell ( gx s. n = 3). 2 22( R) - THP THP - 1 4, 4- diisothiocyanostilbene - 2, 2- disulfonic acid (DIDS) ABCA1 50 mg/ Lox - LDL THP h,dids 24 h, apoa - 1, DIDS 0mol/ L 25mol/ L 50mol/ L 100mol/ L 200mol/ L 400mol/ L THP - 1, 9. 8 % 8. 6 % 7. 4 % 6. 3 % 4. 6 % 4. 3 %( 3) Fig 4 ABCA1 mrna expression in THP - 1 macrophage - derived foam cells increased by 22 (R) - hydroxycholesterol ( gx s. n = 3). M: Marker ; 1 : Control ; 2 : 1. 25mol/ L ; 3 : 2. 5 mol/ L ; 4 : 5mol/ L ; 5 : 10mol/ L ; 6 : 20mol/ L. 3 P < vs control group. 4 22( R) - THP - 1 ABCA1 mrna Fig 3 Effects of DIDS on cholesterol efflux in THP - 1 macrophage - derived foam cells ( gx s. n = 3). 3 DIDS THP ( R) - THP - 1 ABCA1 mrna Fig 5 ABCA1 mrna expression in THP - 1 macrophage - derived foam cells inhibited by DIDS ( gx s. n = 3). M: Marker ; 1 : 0. 4mmol/ L ; 2 : 0. 2mmol/ L ; 3 : 0. 1 mmol/ L ; 4 : 0. 05,THP - 1 ABCA1 mrnathp - 1 mmol/ L ; 5 : mmol/ L ; 6 : control. 3 control group. P < vs 0mol/ L 1. 25mol/ L 5 DIDS THP - 1 ABCA1 2. 5mol/ L 5mol/ L 10mol/ L 20mol/ L 22 (R) - mrna

4 DIDS THP - 1 HDL - C, ABCA1 mrna ABCA1, THP mol/ L 25 mol/ L 50 mol/ L 100mol/ L 200mol/ L 400mol/ L DIDS 24 h,abca1 GAPDH,, ABCA ( 5), ABCA1,, A1 (ATP binding cas2 ABCA1 LXR,RXR sette transporter A 1, ABCA1), ABCA1, ATP,, ABCA1,(RCT) HDL AB2, RCT [7 ] CA1, PPARs LXRs FXR ABCA1, 50 ABCA1 mrna,, ABCA1 [8 ] THP - 1,,,,; HDL apoa - 1 THP - 1 ; apoa - 1, THP - 1,HDL, ABCA1,, [ ] [ 1 ] Dean M, Hamon Y, Chimini G. The human ATP binding cas2 sette(abc) transpoter superfamily[j ]. Lipid Res, 2001, 42 (8) : [2 ] Jones NL, Reagan JW, Willingham MC. The pathogenesis of foam cell formatiom : modified LDL stimulates uptake of co - incubated LDL via macropinocytosis [ J ]. Arteriosel Thromb Vasc Biol, 2000,20 (3) : [3 ] Oram JF. Tangier disease and ABCA1 [J ]. Biochim Biophys Acta, 2000, 1529 (1) : , 22 (R) - THP - 1 [4 ],,,. ABCA1 mrna, [J ]., 2001,17 (10) : ABCA1 [5 ] Lin GR, Bornfeldt KE. Cyclic AMP - specific phosphodi2 esterase 4 inhibitors promote ABCA1 expression and choles2 terol efflux [J ]. Biochem Biophys Res Commun, 2002,290 (2) : [6 ],,,. HDL [J ]., 2001,, Glomset [9 ] HDL 29 (2) : [7 ] Oram JF, Lawn RM. ABCA1 : The gatekeeper for eliminating,, excess tissue cholesterol [J ]. J Lipid Res, 2001, 42 ( 8) : ABCA1,apoA - 1 [8 ],. ABCA1, SR [J ]., 2003, 23 (2) : BI HDL,ABCA1 HDL [10 ] [9 ] Glomset JA. High - density lipoproteins in human health and disease[j ]. Adv Intern Med, 1980, 25 (1) : Tangier WHAM [10 ] Kozarsky KF, Donahee MH, Glick JM, et al. Gene transfer and hepatic overexpression of the HDL receptor SR - BI re2 ABCA1, duces atherosclerosis in the cholesterol - fed LDL receptor -, ABCA1 deficient mouse [J ]. Arterioscler Thromb Vasc Biol, 2000, 20 (3) :

5 1088 Action of ATP binding cassette transporter A 1 on cholesterol efflux in THP - 1 macrophage - derived foam cells TANG Chao - ke, YANG Yong - zong, YI Guang - hui, WANG Yan, WEI Dang - heng, WANG Zuo ( Institute of Cardiovascular Disease of Nanhua University, Hengyang , China) [ ABSTRACT] AIM : To study the action of ATP binding cassette transporter (ABC) A 1 on cholesterol efflux in THP - 1 macrophage - derived foam cells. METHODS : After exposure of the cultured THP - 1 macrophage - derived foam cells to 22 (R) - hydroxycholesterol and 4,4 - diisothiocyanostilbene - 2,2 - disulfonic acid (DIDS) at different concentration for 24 hours, cholesterol efflux and ABCA1 mrna level were determined by FJ P type liquid scintil2 lator and reverse trancriptase - polymerase chaim reaction ( RT - PCR), respectively. RESUL TS : Oxidized LDL promot2 ed cholesterol efflux in THP - 1 macrophages and 22 ( R) - hydroxycholesterol increased cholesterol efflux in THP - 1 macrophage - derived foam cells in a dose - dependent manner and DIDS inhibited cholesterol efflux in THP - 1 macrophage - derived foam cells in a dose - dependent manner. Exposure of the cultured THP - 1 macrophage - derived foam cells to 22 ( R) - hydroxycholesterol and DIDS at different concentration for 24 hours, resulted in increase and de2 crease in the expression of ABCA1 mrna in THP - 1 macrophage - derived foam cells in a dose - dependent manner, respectively. CONCL USION : ABCA1 playes an important role in cholesterol efflux in THP - 1 macrophage - derived foam cells. [ KEY WORDS] ATP - binding cassette transporters ; Cholesterol ; Lipoproteins, LDL,www. bjmu. edu. cn