Gene annotation pipeline. Note: Code is highlighted in green, changes to parameter files are highlighted in gray.
|
|
|
- Felicity Moody
- 9 years ago
- Views:
Transcription
1 Gene annotation pipeline Note: Code is highlighted in green, changes to parameter files are highlighted in gray. References: Training SNAP (ab initio gene prediction) Computation time: ~8 hours total (you may be able to do each step on standby) You will need: 1) A fasta file with chicken, turkey, zebra finch and pigeon proteins (my file was called avianuniprot.fasta) 2) Approximately 10 Mb of your longest contigs (I used all scaffolds > bp, my file was called kmer70_min _scaffolds) module load MAKER/2.28b maker CTL nano maker_opts.ctl Edit the file so the following applies and save/exit: genome=kmer70_min _scaffolds.fasta protein=avianuniprot.fasta protein2genome=1 mpiexec -n 48 maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl &> log_file.txt cd kmer70_min _scaffolds.maker.output maker2zff n d kmer70_min _scaffolds_master_datastore_index.log This will create two files: genome.ann and genome.dna The following commands give you an idea of what your data looks like:
2 fathom genome.ann genome.dna -gene-stats fathom genome.ann genome.dna -validate To train SNAP: cd.. mkdir snap copy genome.ann and genome.dna files to snap folder cd snap fathom -categorize 1000 genome.ann genome.dna fathom -export plus uni.ann uni.dna forge export.ann export.dna hmm-assembler.pl Pult. > Pult.hmm cd.. nano maker_opts.ctl Edit the file so that the following applies and save/exit: snaphmm=snap/pult.hmm protein2genome=0 mpiexec -n 48 maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl &> log_file.txt Wait for MAKER to finish running and manually end job. This will be much faster than the first run.
3 cd kmer70_min _scaffolds.maker.output delete the previous genome.ann and genome.dna files that are in the maker.output directory maker2zff n d kmer70_min _scaffolds_master_datastore_index.log mkdir snap2 copy genome.ann and genome.dna files to snap2 folder fathom -categorize 1000 genome.ann genome.dna fathom -export plus uni.ann uni.dna forge export.ann export.dna hmm-assembler.pl Pult. > Pult2.hmm cd.. SNAP is now trained. 1 st MAKER run Computation time: hours (run on fnrgenetics, I usually set the run time for the job as 300 hrs) You will need: 1) A fasta file with chicken, turkey, zebra finch and pigeon proteins (my file was called avianuniprot.fasta) 2) The SNAP file you just generated (my file was called Pult2.hmm) 3) EST sequences from a closely-related species (I used falcon ESTs, my file was called falcontrinity.fasta) 4) All of your scaffolds with a minimum length of bp (my file was called kmer70_min10000_scaffolds.fasta) 5) MIKE_compare_annotations_3.1.pl script
4 module load MAKER/2.28b maker CTL nano maker_opts.ctl Edit the file so the following applies and save/exit: genome=kmer70_min10000_scaffolds.fasta alttest=falcontrinity.fasta protein=avianuniprot.fasta snaphmm=snap2/pult2.hmm augustus_species=chicken keep_preds=1 tries=1 Note that alttest is used when you re providing ests from a closely-related species. If you have est sequences for your own species, use est= instead of alttest=. This will allow MAKER to run MUCH faster, as it won t be translating in 6 different reading frames. mpiexec -n 48 maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl &> log_file.txt You have finished your first MAKER run. Use fasta_merge to create genome-level fasta files with annotations based on different types of evidence (snap, augustus, ab initio + blast evidence, etc.). Use gff3_merge to create a genome-level gff file. I also make a zff file just so I can generate summary statistics. fasta_merge -d kmer70_min10000_scaffolds_revisedassembly_master_datastore_index.log gff3_merge -d kmer70_min10000_scaffolds_revisedassembly_master_datastore_index.log maker2zff n d kmer70_min _scaffolds_master_datastore_index.log I use several scripts to generate summary statistics for the genome-level fasta and gff files. It is possible for incomplete gff files to be generated if there isn t enough tmp room, so it is important to make sure everything matches up before moving onto the next step. perl MIKE_compare_annotations_3.1.pl kmer70_min10000_scaffolds_revisedassembly.all.gff
5 fathom genome.ann genome.dna -gene-stats perl fastastats.pl I kmer70_min10000_scaffolds_revisedassembly.fasta InterProScan and downstream processing You will need: 1) The all.maker.proteins.fasta file from you MAKER run (mine was called kmer70_min10000_scaffolds.all.maker.proteins.fasta) 2) The.gff file from your MAKER run (mine was called kmer70_min10000_scaffolds_revisedassembly.all.gff) 3) InterProScan installed locally in your scratch drive (you might check the bioinformatics modules as well, InterProScan is supposed to be added at some point) 4) quality_filter.pl and iprscan_parser.pl scripts./interproscan.sh -appl PfamA -iprlookup -goterms -f tsv I kmer70_min10000_scaffolds.all.maker.proteins.fasta If needed, modify the merged tsv file so that the first column is only the maker id perl -lane = split(/\t/, $_); $array[0] = $F[0]; print merged_iprscan_output.tsv > merged_iprscan_output_fixed_ids.tsv Update the gff3 file module load MAKER/2.28b ipr_update_gff kmer70_min10000_scaffolds_revisedassembly.all.gff merged_iprscan_output_fixed_ids.tsv NOTE: This modifies the gff3 file in place so if you kill it before it is done you will truncate your gff3 file, so it is a good idea to make a backup copy. Now you can use the quality_filter_2.pl script to make gff files with genes annotated with different types of evidence. The updated gff file is the max build with all possible gene annotations (including ab initio predictions for which there is no other evidence). The maker default build includes gene annotations generated from ab initio predictions + protein or EST evidence. The maker standard build includes gene annotations generated from ab initio predictions + protein or EST evidence or an InterProScan protein domain hit.
6 Make the default, standard, and max builds quality_filter.pl -d <ipr_updated_gff3_file> > maker_default.gff quality_filter.pl -s <ipr_updated_gff3_file> > maker_standard.gff The maker max is the original file 2 nd MAKER run: Computation time: hours (run on fnrgenetics, I usually set the run time for the job as 48 hrs) This second MAKER retains your MAKER standard annotations while discarding the ab initio predictions that don t have any other evidence. Start by getting a gff3 file with only the gene models and none of the evidence or appended fasta sequence. You can use gff3_merge for this. gff3_merge -g -n MAKER_standard.gff The output will be a file named genome.all.gff. This file only has the MAKER gene models and the appended fasta sequence has been removed. You need to copy this file to the same directory that holds the maker_opts.ctl, genome, protein, etc. files from your first MAKER run. Next edit the maker_opts.ctl file and turn off all of the gene predictors (i.e. get rid of your snap2 file and augustus chicken setting) and put the genome.all.gff file in as model_gff in the gene prediction section and set map_forward=1. snaphmm= augustus_species= model_gff=genome.all.gff #annotated gene models from an external GFF3 file (annotation pass-through) map_forward=1 #map names and attributes forward from old GFF3 genes, 1 = yes, 0 = no keep_preds=0 #Add unsupported gene prediction to final annotation set, 1 = yes, 0 = no If you run this in the same directory you did your original run in MAKER will be able to find its kmer70_min10000_scaffolds_revisedassembly.maker.output directory and won't have to realign the evidence and will make a directory for each scaffold with a gff3 file that contains the gene models you passed in and the evidence. This will run much faster than a de novo annotation because it doesn't have to realign the evidence or redo the repeat masking.
7 mpiexec -n 48 maker maker_opts.ctl maker_bopts.ctl maker_exe.ctl &> log_file_2ndrun.txt You have finished your second MAKER run. Use fasta_merge to create genome-level fasta files. fasta_merge -d kmer70_min10000_scaffolds_revisedassembly_master_datastore_index.log
CD-HIT User s Guide. Last updated: April 5, 2010. http://cd-hit.org http://bioinformatics.org/cd-hit/
CD-HIT User s Guide Last updated: April 5, 2010 http://cd-hit.org http://bioinformatics.org/cd-hit/ Program developed by Weizhong Li s lab at UCSD http://weizhong-lab.ucsd.edu [email protected] 1. Introduction
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
Database manager does something that sounds trivial. It makes it easy to setup a new database for searching with Mascot. It also makes it easy to
1 Database manager does something that sounds trivial. It makes it easy to setup a new database for searching with Mascot. It also makes it easy to automate regular updates of these databases. 2 However,
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
This document presents the new features available in ngklast release 4.4 and KServer 4.2.
This document presents the new features available in ngklast release 4.4 and KServer 4.2. 1) KLAST search engine optimization ngklast comes with an updated release of the KLAST sequence comparison tool.
Step by Step Guide to Importing Genetic Data into JMP Genomics
Step by Step Guide to Importing Genetic Data into JMP Genomics Page 1 Introduction Data for genetic analyses can exist in a variety of formats. Before this data can be analyzed it must imported into one
Creating a DUO MFA Service in AWS
Amazon AWS is a cloud based development environment with a goal to provide many options to companies wishing to leverage the power and convenience of cloud computing within their organisation. In 2013
Version Control with Subversion and Xcode
Version Control with Subversion and Xcode Author: Mark Szymczyk Last Update: June 21, 2006 This article shows you how to place your source code files under version control using Subversion and Xcode. By
DNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
Copyright Texthelp Limited All rights reserved. No part of this publication may be reproduced, transmitted, transcribed, stored in a retrieval
Copyright Texthelp Limited All rights reserved. No part of this publication may be reproduced, transmitted, transcribed, stored in a retrieval system, or translated into any language, in any form, by any
Microsoft Business Contact Manager 2010 - Complete
Microsoft Business Contact Manager 2010 - Complete Introduction Prerequisites Section 1: Getting Started with Business Contact Manager Lesson 1.1: Setting up Business Contact Manager What is Business Contact
WS_FTP Professional 12
WS_FTP Professional 12 Tools Guide Contents CHAPTER 1 Introduction Ways to Automate Regular File Transfers...5 Check Transfer Status and Logs...6 Building a List of Files for Transfer...6 Transfer Files
Importing Contacts to Outlook
Importing Contacts to Outlook 1. The first step is to create a file of your contacts from the National Chapter Database. 2. You create this file under Reporting, Multiple. You will follow steps 1 and 2
Data Mining. SPSS Clementine 12.0. 1. Clementine Overview. Spring 2010 Instructor: Dr. Masoud Yaghini. Clementine
Data Mining SPSS 12.0 1. Overview Spring 2010 Instructor: Dr. Masoud Yaghini Introduction Types of Models Interface Projects References Outline Introduction Introduction Three of the common data mining
ProSightPC 3.0 Quick Start Guide
ProSightPC 3.0 Quick Start Guide The Thermo ProSightPC 3.0 application is the only proteomics software suite that effectively supports high-mass-accuracy MS/MS experiments performed on LTQ FT and LTQ Orbitrap
Getting Started with HPC
Getting Started with HPC An Introduction to the Minerva High Performance Computing Resource 17 Sep 2013 Outline of Topics Introduction HPC Accounts Logging onto the HPC Clusters Common Linux Commands Storage
Sequence Database Administration
Sequence Database Administration 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases
IMPORTANT Please Read Me First
IMPORTANT Please Read Me First 3/02/2006 Table of Contents Table of Contents Part 1 Mac Single User Installation 1 Part 2 Windows Single User Installation 2 Part 3 Mac Server Installation 3 Part 4 Windows
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Exercises for the UCSC Genome Browser Introduction
Exercises for the UCSC Genome Browser Introduction 1) Find out if the mouse Brca1 gene has non-synonymous SNPs, color them blue, and get external data about a codon-changing SNP. Skills: basic text search;
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Moxa Device Manager 2.3 User s Manual
User s Manual Third Edition, March 2011 www.moxa.com/product 2011 Moxa Inc. All rights reserved. User s Manual The software described in this manual is furnished under a license agreement and may be used
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Prepare the environment Practical Part 1.1
Prepare the environment Practical Part 1.1 The first exercise should get you comfortable with the computer environment. I am going to assume that either you have some minimal experience with command line
12 SPS DATABASE ADMINISTRATION
Chapter 12 SPS DATABASE ADMINISTRATION Table of Contents Chapter 12... 1 SPS DATABASE ADMINISTRATION... 1 Table of Contents... 1 12-1 Manually dumping a database... 1 12-2 Logging in to Sybase Central
Installation Guide for WebSphere Application Server (WAS) and its Fix Packs on AIX V5.3L
Installation Guide for WebSphere Application Server (WAS) and its Fix Packs on AIX V5.3L Introduction: This guide is written to help any person with little knowledge in AIX V5.3L to prepare the P Server
Introduction to Operating Systems
Introduction to Operating Systems It is important that you familiarize yourself with Windows and Linux in preparation for this course. The exercises in this book assume a basic knowledge of both of these
Linux command line. An introduction to the Linux command line for genomics. Susan Fairley
Linux command line An introduction to the Linux command line for genomics Susan Fairley Aims Introduce the command line Provide an awareness of basic functionality Illustrate with some examples Provide
LifeScope Genomic Analysis Software 2.5
USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use
PROGRAMMING FOR BIOLOGISTS. BIOL 6297 Monday, Wednesday 10 am -12 pm
PROGRAMMING FOR BIOLOGISTS BIOL 6297 Monday, Wednesday 10 am -12 pm Tomorrow is Ada Lovelace Day Ada Lovelace was the first person to write a computer program Today s Lecture Overview of the course Philosophy
MetaPathways v1.0 Installation
MetaPathways v1.0 Installation Niels W. Hanson, Kishori M. Konwar, Antoine P. Pagé, and Steven J. Hallam This document explains the basic installation and setup of the MetaPathways v1.0 pipeline on a typical
How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)
The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html
3 Setting up Databases on a Microsoft SQL 7.0 Server
3 Setting up Databases on a Microsoft SQL 7.0 Server Overview of the Installation Process To set up GoldMine properly, you must follow a sequence of steps to install GoldMine s program files, and the other
Oracle 10g Feature: RMAN Incrementally Updated Backups
Oracle 10g Feature: RMAN Incrementally Updated Backups Author: Dave Anderson, SkillBuilders Date: September 13, 2004 Introduction This article explains one of the features presented by Dave Anderson at
Turning HTE Agilent LC/MS Data to Knowledge in 1hr
With permission Reaction Analytics Inc. 2011 Page 1 Turning HTE Agilent LC/MS Data to Knowledge in 1hr Neal Sach With permission Reaction Analytics Inc. 2011 Page 2 Contents Acquiring Data Fast demo method
Business Portal for Microsoft Dynamics GP. Key Performance Indicators Release 10.0
Business Portal for Microsoft Dynamics GP Key Performance Indicators Release 10.0 Copyright Copyright 2007 Microsoft Corporation. All rights reserved. Complying with all applicable copyright laws is the
-> Integration of MAPHiTS in Galaxy
Enabling NGS Analysis with(out) the Infrastructure, 12:0512 Development of a workflow for SNPs detection in grapevine From Sets to Graphs: Towards a Realistic Enrichment Analy species: MAPHiTS -> Integration
BackTrack Hard Drive Installation
BackTrack Hard Drive Installation BackTrack Development Team jabra [at] remote-exploit [dot] org Installing Backtrack to a USB Stick or Hard Drive 1 Table of Contents BackTrack Hard Drive Installation...3
Ruby On Rails. CSCI 5449 Submitted by: Bhaskar Vaish
Ruby On Rails CSCI 5449 Submitted by: Bhaskar Vaish What is Ruby on Rails? Ruby on Rails is a web application framework written in Ruby, a dynamic programming language. Ruby on Rails uses the Model-View-Controller
Data formats and file conversions
Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases
Installing IBM Websphere Application Server 7 and 8 on OS4 Enterprise Linux
Installing IBM Websphere Application Server 7 and 8 on OS4 Enterprise Linux By the OS4 Documentation Team Prepared by Roberto J Dohnert Copyright 2013, PC/OpenSystems LLC This whitepaper describes how
Exchange Account (Outlook) Mail Cleanup
Overview Exchange account users in the OET Domain each have a mailbox on the OET Microsoft Exchange Server. Exchange mailboxes have a physical size limit imposed by Microsoft which cannot be overridden
1 System requirements (minimum)
Metrohm AG CH-9101 Herisau Switzerland Phone +41 71 353 85 85 Fax +41 71 353 89 01 [email protected] www.metrohm.com Installation 1 System requirements (minimum) Operating system RAM Memory Interface Windows
Section 5: Preparing the Data Analysis Environment
Overview This section covers all the tasks that need to be conducted to setup and prepare for the analysis of the STEPS survey data. Intended audience This section is designed for use by people who have
FileMaker Pro and Microsoft Office Integration
FileMaker Pro and Microsoft Office Integration page Table of Contents Executive Summary...3 Introduction...3 Top Reasons to Read This Guide...3 Before You Get Started...4 Downloading the FileMaker Trial
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Client Marketing: Sets
Client Marketing Client Marketing: Sets Purpose Client Marketing Sets are used for selecting clients from the client records based on certain criteria you designate. Once the clients are selected, you
RAST Automated Analysis. What is RAST for?
RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic
File Server Migration
2 June 2014, HAPPIEST MINDS TECHNOLOGIES File Server Migration Author Suresh Elumalai SHARING. MINDFUL. INTEGRITY. LEARNING. EXCELLENCE. SOCIAL RESPONSIBILITY. Copyright Information This document is an
TM SysAid Chat Guide Document Updated: 10 November 2009
SysAidTM Chat Guide Document Updated: 10 November 2009 Introduction 2 Quick Access to SysAid Chat 3 Enable / Disable the SysAid Chat from the End User Portal. 4 Edit the Chat Settings 5 Chat Automatic
Version Control Script
Version Control Script Mike Jackson, The Software Sustainability Institute Things you should do are written in bold. Suggested dialog is in normal text. Command- line excerpts and code fragments are in
Lab 2 : Basic File Server. Introduction
Lab 2 : Basic File Server Introduction In this lab, you will start your file system implementation by getting the following FUSE operations to work: CREATE/MKNOD, LOOKUP, and READDIR SETATTR, WRITE and
ORACLE USER PRODUCTIVITY KIT USAGE TRACKING ADMINISTRATION & REPORTING RELEASE 3.6 PART NO. E17087-01
ORACLE USER PRODUCTIVITY KIT USAGE TRACKING ADMINISTRATION & REPORTING RELEASE 3.6 PART NO. E17087-01 FEBRUARY 2010 COPYRIGHT Copyright 1998, 2009, Oracle and/or its affiliates. All rights reserved. Part
Contents. Welcome to the Priority Zoom System Version 17 for Windows. This document contains instructions for installing the system.
Welcome to the Priority Zoom System Version 17 for Windows. This document contains instructions for installing the system. Contents 1. Introduction... 2 2. Installing the Server... 2 3. Installing a Client...
Tutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
Backup and Restore with 3 rd Party Applications
Backup and Restore with 3 rd Party Applications Contents Introduction...1 Backup Software Capabilities...1 Backing up a Single Autodesk Vault Site...1 Backup Process...1 Restore Process...1 Backing up
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes
Chapter 2. imapper: A web server for the automated analysis and mapping of insertional mutagenesis sequence data against Ensembl genomes 2.1 Introduction Large-scale insertional mutagenesis screening in
Server & Workstation Installation of Client Profiles for Windows
C ase Manag e m e n t by C l i e n t P rofiles Server & Workstation Installation of Client Profiles for Windows T E C H N O L O G Y F O R T H E B U S I N E S S O F L A W General Notes to Prepare for Installing
Click Studios. Passwordstate. Upgrade Instructions to V7 from V5.xx
Passwordstate Upgrade Instructions to V7 from V5.xx This document and the information controlled therein is the property of Click Studios. It must not be reproduced in whole/part, or otherwise disclosed,
CPAS Overview. Josh Eckels LabKey Software [email protected]
CPAS Overview Josh Eckels LabKey Software [email protected] CPAS Web-based system for processing, storing, and analyzing results of MS/MS experiments Key goals: Provide a great analysis front-end for
PCRecruiter Resume Inhaler
PCRecruiter Resume Inhaler The PCRecruiter Resume Inhaler is a stand-alone application that can be pointed to a folder and/or to an email inbox containing resumes, and will automatically extract contact
Setting Up Windows Perfmon to Collect Performance Data
Setting Up Windows Perfmon to Collect Performance Data In order to provide a comprehensive view of your environment, pick the busiest week of a typical month to collect your disk performance data. To set
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
IceWarp to IceWarp Server Migration
IceWarp to IceWarp Server Migration Registered Trademarks iphone, ipad, Mac, OS X are trademarks of Apple Inc., registered in the U.S. and other countries. Microsoft, Windows, Outlook and Windows Phone
Resources You can find more resources for Sync & Save at our support site: http://www.doforms.com/support.
Sync & Save Introduction Sync & Save allows you to connect the DoForms service (www.doforms.com) with your accounting or management software. If your system can import a comma delimited, tab delimited
Package hoarder. June 30, 2015
Type Package Title Information Retrieval for Genetic Datasets Version 0.1 Date 2015-06-29 Author [aut, cre], Anu Sironen [aut] Package hoarder June 30, 2015 Maintainer Depends
Mascot Search Results FAQ
Mascot Search Results FAQ 1 We had a presentation with this same title at our 2005 user meeting. So much has changed in the last 6 years that it seemed like a good idea to re-visit the topic. Just about
SQL Server Replication Guide
SQL Server Replication Guide Rev: 2013-08-08 Sitecore CMS 6.3 and Later SQL Server Replication Guide Table of Contents Chapter 1 SQL Server Replication Guide... 3 1.1 SQL Server Replication Overview...
AWS Schema Conversion Tool. User Guide Version 1.0
AWS Schema Conversion Tool User Guide AWS Schema Conversion Tool: User Guide Copyright 2016 Amazon Web Services, Inc. and/or its affiliates. All rights reserved. Amazon's trademarks and trade dress may
Niche Market Finder. User Guide
Niche Market Finder User Guide What Is Niche Market Finder Used For The main task of Niche Market Finder is to identify niches that you can easily dominate with your sites, especially with the help of
Job Streaming User Guide
Job Streaming User Guide By TOPS Software, LLC Clearwater, Florida Document History Version Edition Date Document Software Trademark Copyright First Edition 08 2006 TOPS JS AA 3.2.1 The names of actual
TCB No. 2012-008 September 2012. Technical Bulletin. GS FLX+ System & GS FLX System. Installation of 454 Sequencing System Software v2.
TCB No. 2012-008 September 2012 Technical Bulletin GS FLX+ System & GS FLX System Installation of 454 Sequencing System Software v2.8 Summary This document describes how to upgrade the 454 Sequencing System
Together with SAP MaxDB database tools, you can use third-party backup tools to backup and restore data. You can use third-party backup tools for the
Together with SAP MaxDB database tools, you can use third-party backup tools to backup and restore data. You can use third-party backup tools for the following actions: Backing up to data carriers Complete
Bubble Full Page Cache for Magento
User Guide Author: Version: Website: Support: Johann Reinke 2.0 http://www.bubbleshop.net [email protected] Table of Contents 1 Introducing Bubble Full Page Cache... 3 1.1 Features... 3 1.2 Compatibility...
Fruit Machine. Level. Activity Checklist Follow these INSTRUCTIONS one by one. Test Your Project Click on the green flag to TEST your code
Introduction: This is a game that has three sprites that change costume. You have to stop them when they re showing the same picture (like a fruit machine!). Activity Checklist Follow these INSTRUCTIONS
Vector HelpDesk - Administrator s Guide
Vector HelpDesk - Administrator s Guide Vector HelpDesk - Administrator s Guide Configuring and Maintaining Vector HelpDesk version 5.6 Vector HelpDesk - Administrator s Guide Copyright Vector Networks
CanReg5 Webinar 6: Customization and Management
CanReg5 Webinar 6: Customization and Management Morten Ervik International Agency for Research on Cancer, Lyon, France Lyon, France, 11 December 2012 Outline Customization Management Summary Outline Customization
Partek Flow Installation Guide
Partek Flow Installation Guide Partek Flow is a web based application for genomic data analysis and visualization, which can be installed on a desktop computer, compute cluster or cloud. Users can access
?<BACBC;@@A=2(?@?;@=2:;:%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
NGS data format NGS data format @SRR031028.1708655 GGATGATGGATGGATAGATAGATGAAGAGATGGATGGATGGGTGGGTGGTATGCAGCATACCTGAAGTGC BBBCB=ABBB@BA=?BABBBBA??B@BAAA>ABB;@5=@@@?8@:==99:465727:;41'.9>;933!4 @SRR031028.843803
Exchange Brick-level Backup and Restore
WHITEPAPER BackupAssist Version 4 Exchange Mailbox Add-on www.backupassist.com 2 Contents 1. Introduction and Overview... 3 1.1 What does the Exchange Mailbox Add-on do?... 3 1.2 Who needs the Exchange
Finding and Opening Documents
In this chapter Learn how to get around in the Open File dialog box. See how to navigate through drives and folders and display the files in other folders. Learn how to search for a file when you can t
AFN-FixedAssets-062502
062502 2002 Blackbaud, Inc. This publication, or any part thereof, may not be reproduced or transmitted in any form or by any means, electronic, or mechanical, including photocopying, recording, storage
Getting Census Data into ArcMap or ArcView. Obtaining Shapefiles from ESRI and Data from the Census Bureau
Obtaining Shapefiles from ESRI and Data from the Census Bureau 1) Download the boundary shapefile from the ESRI website: http://arcdata.esri.com/data/tiger2000/tiger_download.cfm. Select the area that
A Program for PCB Estimation with Altium Designer
A Program for PCB Estimation with Altium Designer By: Steve Hageman AnalogHome.com One thing that I have had to do over and over on my new PCB jobs is to make an estimate of how long I think the layout
How to output SpoolFlex files directly to your Windows server
How to output SpoolFlex files directly to your Windows server This document will quickly cover how to setup your AS/400 or iseries system to communicate with a Windows based file server. Under normal circumstances
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Installing Sun's VirtualBox on Windows XP and setting up an Ubuntu VM
Installing Sun's VirtualBox on Windows XP and setting up an Ubuntu VM laptop will need to have 10GB of free space to install download the latest VirtualBox software from www.sun.com make sure you pick
