Station 1 1. Name the stage of cell division shown in panel 1. 2. Name the stage of cell division shown in panel 2. 3. Name the stage of cell division shown in panel 3. 4. Name the stage of cell division shown in panel 4. 5. In what order do these stages of cell division progress? (write in the form of: 1, 2, 3, 4) 6. This structure emanates from the centromere and contacts the spindle fibers during mitosis: a. microsatellite b. telomere c. euchromatin d. kinetochore e. histone
Station 2 True or False: 7. One complete DNA molecule consists of a single helix. 8. In eukaryotic cells, DNA replication starts at many sites along the chromosome. 9. The backbone" of DNA is composed of repeating sugars and bases. 10. During replication, DNA Helicase builds the new DNA strand. 11. All genetic mutations change the sequence of amino acids in a protein. 12. Cytosine and Thymine are both pyrimidines. 13. Each Okazaki fragment produced on the lagging strand during DNA replication is primed with an RNA primer.
Station 3 14. The gametes of a plant of genotype SsYy should have the genotypes: a. Ss and Yy b. SY and sy c. SY, Sy, sy, and sy d. Ss, Yy, SY and sy e. SS, ss, YY, and yy 15. Which of the following genetic crosses would be predicted to give a phenotypic ratio of 9:3:3:1? a. SSYY x ssyy b. SsYY x SSYy c. SSyy x ssyy d. ssyy x ssyy e. SsYy x SsYy 16. What is the expected phenotypic ratio of the progeny of a SsYy x ssyy cross? (Write in the form of #:#:#:#) 17. In a dihybrid cross, AaBb x AaBb, what fraction of the offspring will be homozygous for both recessive traits? 18. Following a SsYy x SsYy cross, what fraction of the offspring are predicted to have a genotype that is heterozygous for both characteristics?
Station 4 19. Karyotype A shows an individual that is (write in the form of 46, XY): 20. What is the common name for the disease indicated by Karyotype A (write "none" if no disease is indicated)? 21. Would the person with karyotype A be phenotypically male or female? 22. Karyotype B shows an individual that is (write in the form of 46, XY): 23. What is the common name for the disease indicated by Karyotype B (write "none" if no disease is indicated)? 24. Would the person with karyotype B be phenotypically male or female?
Station 5 25. What is the mode of inheritance in pedigree 1? 26. What is the mode of inheritance in pedigree 2? 27. What is the mode of inheritance in pedigree 3? 28. Which of the following list of conditions could be inherited as shown in pedigree 1 (Choose all that apply)? 29. Which of the following list of conditions could be inherited as shown in pedigree 2 (Choose all that apply)? List of conditions for above two questions: A. Cystic fibrosis B. Down syndrome C. Hemophilia D. Lyme disease E. Sickle cell anemia F. Tay-sachs G. Huntington disease H. Red-green color blindness
Station 6 During G1 of interphase, a cell has 16 chromosomes. How many chromosomes will be found per cell after the following stages of cell division? 30. Metaphase of mitosis 31. Telophase of mitosis 32. Anaphase II of meiosis 33. About 90% of trisomy 21 Down conceptions are due to nondisjunction during a. meiosis I in the female. b. meiosis II in the female. c. meiosis I in the male. d. meiosis II in the male 34. Nondisjunction in which parent leads to the sex chromosome aneuploidy XYY? a. Mother b. Father c. Either parent d. Both parents 35. Nondisjunction of chromosome 13 during meiosis II in human females can result in all of the following chromosome complements in a zygote except (assume the oocyte is fertilized by a sperm with a normal chromosome set) e. monosomic for chromosome 13 f. euploid for chromosome 13 g. trisomic for chromosome 13 h. no chromosome 13
Station 7 Dragons are diploid organisms with inheritance patterns similar to humans. 36. In this dragon pedigree, the "wings" trait is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant 37. In this dragon pedigree, the color trait is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant 38. In this dragon pedigree, the "breathing fire" trait is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant 39. In this dragon pedigree, the legs trait (dragons can have 0, 2 or 4 legs) is best described as: a. Autosomal dominant b. Autosomal recessive c. Sex-linked dominant d. Sex-linked recessive e. Codominant f. Incompletely dominant
Station 8 40. Process A is called: 41. The process shown in B (the cytoplasm) is called: 42. C is called: 43. D is called: 44. E is called: 45. F is composed of:
Station 9 46. The first amino acid in a protein is always a. adenine b. lysine c. threonine d. serine e. none of these 47. If the bases in a chromosome are 30% adenine, what percentages of the bases is cytosine? a. 10% b. 20% c. 40% d. 60% e. 80% 48. Which of these does NOT true of an autosomal dominant trait? a. usually appears in both sexes with equal frequency b. both sexes transmit the trait to their offspring c. tends to skip generations d. when one parent is unaffected and the other is affected, approximately half of the offspring will be affected 49. A couple seeks testing and counseling after they have a child with cystic fibrosis. Testing reveals that the mother is a carrier, but the father is not. How can these results be explained? a. The man tested is not the father b. A mutation altered the child s normal allele c. Uniparental disomy d. All of the above are possible 50. In pepper plants, the allele for hot flavor is dominant to the allele for mild flavor. A farmer crosses a homozygous hot plant with a mild plant. What percentage of the offspring from this cross will have hot flavor? a. 25% b. 50% c. 75% d. 100%
Station 10 Ms. Smith, Ms. Smithie, and Ms. Smythe all entered the same hospital and gave birth to baby girls on the same day, and all three babies were taken to the nursery to receive care. Someone later claimed that the hospital mixed up the babies. It is your job to make sure that each pair of parents has the correct baby, so you order blood typing to be done on all the parents and all the babies. Here are the results: Parent Blood Type Baby Blood Type Ms. Smith A Baby A O+ Mr. Smith B Baby B A Ms. Smithie B Baby C A+ Mr. Smithie O+ Ms. Smythe A+ Mr. Smythe B 51. Which parents gave birth to Baby A? a. Smith b. Smithie c. Smythe d. None of these 52. Which parents gave birth to Baby B? a. Smith b. Smithie c. Smythe d. None of these 53. Which mother is homozygous for her ABO blood group genotype? a. Ms. Smith b. Ms. Smithie c. Ms. Smythe d. All of these are equally likely 54. The ABO blood group is a trait which is: a. autosomal recessive b. autosomal dominant c. incompletely dominant d. incompletely penetrant e. codominant
Station 11 Name the following: 55. Diagram used to predict the outcome of a genetic cross 56. The study of heredity 57. Observable characteristics of an organism 58. An individual with two different alleles for a trait 59. The first two individuals that mate in a genetic cross 60. Characteristic of an organism that is influenced by several genes 61. Cross involving one pair of contrasting traits 62. Condition in which a trait in an individual is intermediate between the phenotype of its two parents
Station 12 Translate the following DNA sequences into protein. Write answers in the form of Asp-Met-Tyr-STOP. 63. 5 - AATGAAATGCCGATCGTAG 64. 5 - ATGCATCCGTACTAACATCC 65. 3 - AGTATGTACCTAGACGTTATT
Answer KEY for Heredity B 2013 Tiebreakers: Number of total correct answers in station 1, 2, etc. Station 1 1. telophase 2. metaphase 3. anaphase 4. prophase 5. 4, 2, 3, 1 6. D Station 4 19. 47, XXY 20. Klinefelter Syndrome 21. male 22. 47, XY 23. Patau Syndrome or Trisomy 13 24. male Station 2 7. F 8. T 9. F 10. F 11. F 12. T 13. T Station 5 25. Autosomal recessive 26. X-linked recessive 27. Autosomal dominant 28. A, E, F (must have all) 29. C, H (must have all) Station 3 14. D 15. E 16. 1:1:1:1 17. 1/16 18. 1/4 or 4/16 Station 6 30. 16 31. 32 32. 8 33. A 34. B 35. D Station 7 36. B 37. E 38. D 39. F Station 10 51. C 52. A 53. C 54. E Station 8 40. Transcription 41. Translation 42. mrna 43. Ribosome 44. trna 45. amino acids Station 11 55. Punnett Square 56. Genetics 57. Phenotype 58. Heterozygous 59. P generation 60. Polygenic trait 61. Monohybrid cross or monohybrid 62. Incomplete dominance Station 9 46. E 47. B 48. C 49. D 50. C Station 12 63. Met-Lys-Cys-Arg-Ser- STOP 64. Met-His-Pro-Tyr-STOP 65. Met-Asp-Leu-Gln-STOP
Response Sheet Please write clearly!! Illegible answers will not be graded. Note: The back of the answer sheet may be used as a scratch paper. Station 1 1. 2. 3. 4. 5. 6. Station 4 19. 20. 21. 22. 23. 24. Station 2 (circle one) 7. TRUE or FALSE 8. TRUE or FALSE 9. TRUE or FALSE 10. TRUE or FALSE 11. TRUE or FALSE 12. TRUE or FALSE 13. TRUE or FALSE Station 5 25. 26. 27. 28. 29. Station 3 14. 15. 16. 17. 18. Station 6 30. 31. 32. 33. 34. 35. Station 7 36. 37. 38. 39. Station 10 51. 52. 53. 54. Station 8 40. 41. 42. 43. 44. 45. Station 11 55. 56. 57. 58. 59. 60. 61. 62. Station 9 46. 47. 48. 49. 50. Station 12 63. 64. 65.