Table 1: Bio-markers developed for the diagnosis and study of bacterial virulence genes.



Similar documents
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

Understanding the immune response to bacterial infections

Online EFFECTIVE AS OF JANUARY 2013

Laboratory Techniques for the Diagnosis of TB what s available? Dr. Annette Jepson

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Nuevas tecnologías basadas en biomarcadores para oncología

Innovations in Molecular Epidemiology

restriction enzymes 350 Home R. Ward: Spring 2001

19th Swiss TB Symposium Münchenwiler,

Natalia Taborda Vanegas. Doc. Sci. Student Immunovirology Group Universidad de Antioquia

Applied molecular genetics testing for quality control in seed testing. Dr. Patrik Stolt ScanBi Diagnostics

Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md

Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI. Ombretta Turriziani Dipartimento di Medicina Molecolare

CHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL IDENTIFICATION OF DNA DNA AND HEREDITY DNA CAN GENETICALLY TRANSFORM CELLS

OpenMedicine Foundation (OMF)

Identification and characterisation of Verocytotoxinproducing Escherichia coli (VTEC) by PCR amplification of virulence genes

Performance Evaluation and Clinical Application of MTB NAAT in Orange County, CA. Minoo Ghajar Orange County Public Health Laboratory

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics

SYMPOSIUM. June 15, Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA Boston University

Chapter 43: The Immune System

QUALITY AND SAFETY TESTING

Clinical Research Infrastructure

Corvinus University of Budapest Faculty of Food Science Department of Microbiology and Biotechnology

How To Understand How Gene Expression Is Regulated

TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river

How to construct transgenic mice

Autoimmunity and immunemediated. FOCiS. Lecture outline

About Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR

Speed Matters - Fast ways from template to result

ALPHA (TNFa) IN OBESITY

Quando si parla di PCR quantitativa si intende:

Gene Mapping Techniques

PNA BRAF Mutation Detection Kit

Biotechnology: DNA Technology & Genomics

Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005

Viral Hepatitis Case Report

Essentials of Real Time PCR. About Sequence Detection Chemistries

Milk protein genetic variation in Butana cattle

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Interleukin-10 gene promoter polymorphism and risk of liver cirrhosis

COMPANY INTRODUCTION.

Targeted Therapy What the Surgeon Needs to Know

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE E15

Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.

Genomics GENterprise

How many of you have checked out the web site on protein-dna interactions?

First Strand cdna Synthesis

Genetics 301 Sample Final Examination Spring 2003

Community Psychology Master program at Birzeit University, Palestine

Mini-Medical School on Infectious Diseases. Session #1 - Basic Science

Thomson Reuters Biomarker Solutions: Hepatitis C Treatment Biomarkers and special considerations in patients with Asthma

How to construct transgenic mice

Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm

Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases

Infectious Diarrhea. Michael Yin

HBV DNA < monitoring interferon Rx

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

Core Functions and Capabilities. Laboratory Services

DIAGNOSTIC PRODUCTS CATALOGUE 2015

DNA Isolation Kit for Cells and Tissues

BacReady TM Multiplex PCR System

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

Sur les traces du Campylobacter au Luxembourg

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables

Forensic DNA Testing Terminology

Insulin Receptor Substrate 1 (IRS1) Gene Variation Modifies Insulin Resistance Response to Weight-loss Diets in A Two-year Randomized Trial

Annex to the Accreditation Certificate D-PL according to DIN EN ISO/IEC 17025:2005

Structure and Function of DNA

7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)

Tuberculosis: a Health Disparity Among Asians in Massachusetts as Compared to the General Population BY SARAH NZIKOBA, STEPHANIE TRAN, PHUNG VUONG

Molecular Diagnosis of Hepatitis B and Hepatitis D infections

PPD LABORATORIES CENTRAL LAB: SUPERIOR SERVICE, QUALITY DATA WITHOUT COMPROMISES

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests?

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

The CVN Development Programme a 4-month update

Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome

General presentation

Introduction To Real Time Quantitative PCR (qpcr)

Reliable PCR Components for Molecular Diagnostic Assays

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

ESCMID Online Lecture Library. by author

Transcription:

Table 1: Bio-markers developed for the diagnosis and study of bacterial virulence genes. Biomarcadores Target gene description Primers sequence (5-3 ) Product (pb) Amplificação aaic a,c ilha ativadora do gene aggr, E. coli 1 enteroagregativa (EAEC) S: ATTGTCCTCAGGCATTTCAC 215 20 a 95ºC, 20 a 57ºC, 1 a 72ºC AS: ACGACACCCCTGATAAACAA 2 aggr b,c regulador de aderência agregativa, EAEC S: ATGAAATTAAAACAAAATATCGA 798 30 a 95ºC, 30 a 58ºC, 1 a 72ºC AS: TCATTGGCTTTTAAAATAAGTCAA 3 hipo a,c hipurato hidrolase de C. jejuni S: ATGATGGCTTCTTCGGATAG 176 AS: GCTCCTATGCTTACAACTGC 30 a 95ºC, 30 a 51ºC, 45" a 72ºC 4 ask a,c aspartato quinase de C. coli S: GGTATGATTTCTACAAGCGAG 502 AS: ATAAAAGACTATCGTCGCGTG 5 glya a,c serina hidroximetiltransferase de C. lari S: TAGAGAGATAGCAAAAGAGA 251 30 a 95ºC, 30 a 46ºC, 45" a 72ºC AS: TACACATAATAATCCCACCC Virulence gene 6 pet b,c toxina codificada por plasmídio, EAEC S: TGACAGTGGATCAGGCGTGT 558 AS: TTCTGTGCGCCAAGAATGAC 7 pic a,d proteína envolvida em colonização, EAEC S: TTCAGCCGAAAGACGAAATCG 518 30 a 95ºC, 30 a 55ºC, 1 a 72ºC AS: TCTGCGCATTCATACCAACAT asta b,d toxina termo-estável agregativa, EAST1, 8 EAEC S: GCCATCAACACAGTATATCCGA 112 30 a 95ºC, 30 a 55ºC, 1 a 72ºC 9 aap b,d proteína anti-agregativa, dispersina, EAEC AS: CGATATTATTTAACCCATTCGG 356

Continuation of Table 1: Bio-markers developed for the diagnosis and study of bacterial virulence genes. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplificação 10 cdta a,d toxina citoletal distensora (CDT) porção, C. S: TTGGCGATGCTAGAGTTTGG jejuni 175 AS: ACCGCTGTATTGCTCATAGGG 11 cdtb a,d CDT porção B, C. jejuni S: CTCGCGTTGATGTAGGAGCTA AS: GCAGCTAAAAGCGGTGGAGTA 12 cdtc a,d CDT porção C, C. jejuni S: AGCCTTTGCAACTCCTACTGG AS: GCTCCAAAGGTTCCATCTTC 13 flaa a,d flagelina A, C. jejuni S: AGCTGCTTCGCAACTTTCTACGGT AS: TGCACTCTCGGCTGCAAAGTCT 14 plda a,d fosfolipase A, C. jejuni S: AAGAGTGAGGCGAAATTCCA AS: GCAAGATGGCAGGATTATCA 15 ciab a,d antígeno de invasão de Campylobacter S: TCATGCGGTGGCATTAGAATGGG AS: GCGACCGATGATAACATCAAGGCT 16 racr a,d regulador de resposta DNA-ligante, C. jejuni S: TGGGGCTTCAAATCGGTGCTGA AS: GCGACCGATGATAACATCAAGGCT 17 dnaj a,d proteína chaperona DnaJ, C. jejuni S: AGGCTTTGGCTCATCACGTCG AS: GGTCGCTTCACCGCGTATGG 18 SAT a,c autotransportador de toxina secretada, patotipos de E. coli Legend: a Gene cromossomal; b Gene plasmidial, c S: iniciador senso; AS: iniciador anti-senso pb: pares de bases PCR comum; d PCR Multiplex. S: TCAGAAGCTCAGCGAATCATTG AS: CCATTATCACCAGTAAAACGCACC 418 270 325 385 658 326 574 30 a 95ºC, 30 a 56ºC, 45" a 72ºC 30 a 95ºC, 30 a 59ºC, 45" a 72ºC 30 a 95ºC, 30 a 64ºC, 45" a 72ºC 931 30 a 95ºC, 30 a 58ºC, 1' a 72ºC

Table 2: Validated bio-markers from the INCT_Biomedicine and their use in international networks RECODISA and MAL_ED. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) PCR conditions Reference 1 ipah a,c E. coli enteroinvasiva (EIEC) S: TGGAAAAACTCAGTGCCTCT AS: CCAGTCCGTAAATTCATTCT 2 aata b,c proteína transportadora antiagregação, E. coli enteroagregativa (EAEC) S: CTGGCGAAAGACTGTATCAT AS: CAATGTATAGAAATCCGCTGTT 423 630 3 stx1 a,d shiga-toxina 1, E. coli enterohemorrágica (EHEC) S: CAGTTAATGTGGTGGCGAAGG AS: CACCAGACAATGTAACCGCTG 348 4 stx2 a,d shiga-toxina 2, EHEC S: ATCCTATTCCCGGGAGTTTACG AS: ATCCTATTCCCGGGAGTTTACG 5 eae a,d intimina, E. coli enteropatogênica (EPEC) S: CCCGAATTCGGCACAAGCATAAGC AS: CCCGGATCCGTCTCGCCAGTATTCG 584 881 30 a 95ºC, 30 a 57ºC, 45" a 72ºC MalEd Project, 2009. 6 bfpa b,d proteína bfpa, EPEC S: GGAAGTCAAATTCATGGGGGTAT AS: GGAATCAGACGCAGACTGGTAGT 7 LT b,d toxina termolábil, E. coli enterotoxigênica (ETEC) S: CACACGGAGCTCCTCAGTC AS: CCCCCAGCCTAGCTTAGTTT 300 508 8 ST b,d toxina termoestável, ETEC S: GCTAAACCAGTAGAGGTCTTCAAAA AS: CCCGGTACAGAGCAGGATTACAACA Virulence gene 9 aap b,d dispersina, EAEC S: ATGAAAAAAATTAAGTTTGTTATCTT 356 30 a 95ºC, 30 a Sheik et al, 2002. 55ºC, 1 a 72ºC 10 asta b,d EAST1, EAEC AS: GGTCGCGAGTGACGGCTTTGT 112 Piva et al, 2003. Legend: a Gene cromossomal; b Gene plasmidial, c S: iniciador senso; AS: iniciador anti-senso pb: pares de bases PCR comum; d PCR Multiplex. Referrences: Sheikh J, Czeczulin JR, Harrington S, et al. A novel dispersin protein in enteroaggregative Escherichia coli. J Clin Invest 2002; 110:1329-37. Piva IC, Pereira AL, Ferraz LR, et al. Virulence markers of enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasilia, Brazil. J Clin Microbiol 2003; 41:1827-32. 147

Table 3: Bio-markers developed in INCT_Biomedicina for diagnosis and assessment of genetic polymorphism. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification 1 Análise de polimorfismo de um único nucleotídeo no S: GAGTGTAGTTGTTAGACGGAGAC estudo de Intolerância à Lactose (C/T -13910) AS: ATCAAACATTATACAAATGCAAC 210 30 a 95ºC, 30 a 54ºC, 1 a 72ºC 2 Análise de polimorfismo de um único nucleotídeo para o S: GGTAGCCTACATTGATTTGC gene do Receptor Toll-Like-5 AS: GAGAATCTGGAGATGAGGTACCCG 277 30 a 95ºC, 30 a 60ºC, 1 a 72ºC Table 4: Bio-markers validated for the study of polymorphisms in regulatory genes of cytokines. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification Reference 1 Análise de polimorfismo de um único nucleotídeo para o gene de Interleucina 8 humana (IL-8) 2 Análise de polimorfismo de um único nucleotídeo no estudo de Intolerância à Lactose (G/A -22810) S: ACTATATCTGTCACATGGTACTATG AS: CTTATCAAATACGGAGTATGACG 166 30 a 95ºC, 30 a 54ºC, 1 a 72ºC S: AACAGGCACGTGGAGGAGTT AS: CCCACCTCAGCCTCTTGAGT 448 30 a 95ºC, 30 a 60ºC, 1 a 72ºC Jiang et al., 2003 Bünning et al., 2003 References: JIANG, Z. D. et al. Genetic susceptibility to enteroaggregative Escherichia coli diarrhea: polymorphism in the interleukin-8 promotor region. J. Infect. Dis. 2003; 188: 506-511. BÜNING, C et al. The C/C (-13910) and G/G (-22018) genotypes for adult-type hypolactasia are not associated with inflammatory bowel disease. Scand J Gastroenterol 2003; 38:538-542.

Table 5: Bio-markers developed to study transport proteins and joints strong in intestinal barrier function. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification 1 Claudina-1 S: TCTACGAGGGACTGTGGATG AS: TCAGATTCAGCAAGGAGTCG 84 20 a 95ºC, 20 a 55ºC, 45 a 72ºC 2 Claudina-2 para camundongo S: CCCACCACCACCAGCTTAAT AS: GAAATGGCTTCCAGGTCAGC 170 20 a 95ºC, 20 a 60ºC, 45 a 72ºC 3 Claudina-2 para rato S: AGGACTTCCTGCTGACATCCA AS: TCCACCCACTACAGCCACTCT 4 Zona Ocludens-1 para camundongo S: GACCATCGCCTACGGTTTGA AS: AGGTCTCGGGGATGCTGATT 5 Zona Ocludens-1 para rato S: CTCGCACGTATCACAAGCTGA AS: CCTCAGGATATGGCTCCTTCC 6 Ocludina para camundongo S: AAGAGCAGCCAAAGGCTTCC AS: CGTCGGGTTCACTCCCATTA 7 Ocludina para rato S: AACAGCCCCCTAATGTGGAAG AS: GAGTAGGCCATTGGACTGTCG 8 Beta-catenina para camundongo S: TGGTGTCTGCCATTGTACGC AS: CCACTGGTGACCCAAGCATT 9 Beta-catenina para rato S: CTGGCAGCAGCAATCTTACCT AS: AAAGGACTTGGGAGGTGTCCA 10 Transportador de peptídeo intestinal-1 (PEPT-1) para rato S: CCTGAAGAAGATGACCGTTGG AS: GCTGGGGAAGACTGGAAGAGT 11 GAPDH para camundongo S: AGCCTCGTCCCGTAGACAAA AS: TGAATTTGCCGTGAGTGGAG 12 GAPDH para rato S: GTTACCAGGGCTGCCTTCTCT AS: AACTTGCCGTGGGTAGAGTCA 13 Transportador de peptídeo intestinal-1 (PEPT-1) para coelho 14 Co-transportador Sódio-Glicose intestinal para coelho (SGLT-1) S: GGGAGTCTGCTGTCCACAATC AS: GTACATCCCACTGCCGATGAT S: CTGACTGGGTTCGCTTTTCAC AS: GCATCTCGGAAGATGTGGAAG 154 30 a 95ºC, 30 a 60ºC, 1' a 72ºC 116 20 a 95ºC, 20 a 60ºC, 45 a 72ºC 137 30 a 95ºC, 30 a 60ºC, 1' a 72ºC 199 20 a 95ºC, 20 a 60ºC, 45 a 72ºC 112 30 a 95ºC, 30 a 60ºC, 1' a 72ºC 165 20 a 95ºC, 20 a 60ºC, 45 a 72ºC 119 30 a 95ºC, 30 a 60ºC, 1' a 72ºC 103 30 a 95ºC, 30 a 60ºC, 1' a 72ºC 183 20 a 95ºC, 20 a 60ºC, 45 a 72ºC 116 30 a 95ºC, 30 a 60ºC, 1' a 72ºC 153 20 a 95ºC, 20 a 64,6ºC, 45 a 72ºC 155 20 a 95ºC, 20 a 65ºC, 45 a 72ºC

15 GAPDH para coelho S: GCCGTGGGCAAGGTCATCCC AS: GCAGCTTTCTCCAGGCGGCA 113 20 a 95ºC, 20 a 64,6ºC, 45 a 72ºC Table 6: Bio-markers validated for the study of intestinal glutamine transport. Biomarkers Target gene description Sequência dos iniciadores (5-3 ) Product (pb) 1 Transportador de aminoácidos intestinal (SN-1) para coelho 2 Transportador de aminoácidos intestinal (SN-2) para coelho S: GGCAGGGGTTTCCTACAGA AS: CGATGTCTTCCCCTCGAA S: CTGGGACAGAGGGCATTC AS: CGGATTTGATGATGAACAGGT 69 106 Amplification 20 a 95ºC, 20 a 62,2ºC, 45 a 72ºC 20 a 95ºC, 20 a 62,2ºC, 45 a 72ºC Reference Talukder et al., 2008 References: Talukder et al. Functional characterization, localization, and molecular identification of rabbit intestinal N-amino acid transporter. Am J Physiol Gastrointest Liver Physiol 2008; 294: G1301 G1310. Table 7: Bio-markers developed for the study of receptor guanylyl cyclases and natriuretic peptide C. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification 1 Receptor de Guanilato ciclase A de rato (GC-A) S:GAACCGAAGCTTCCAAGGTG 218 30 a 95ºC, 30 a 58ºC, 1' a 72ºC AS: GTGGATATCCCAGAGGCCAGT 2 Receptor de Guanilato ciclase B de rato (GC-B) S: CATCTGCATCGTCACCGAGT AS: TCCACCACGCAGTTAGAGGAC 3 Receptor de Guanilato ciclase C de rato (GC-C) S: GGCGGGATACAATCCAGAGAG AS: ACGGTGCCGTAGAACTTGGTC 4 Receptor de Peptídeo Natriurético C de rato (NPR-3) S: CCTACAATTTCGACGAGACCAAA AS: TCGCTCACTGCCCTGGAT 5 RNA ribossômico cadeia 18S de rato (18S rrna) S: ACATCCAAGGAAGGCAGCAG AS: GCTGGAATTACCGCGGCTG 186 30 a 95ºC, 30 a 59ºC, 1' a 72ºC 166 30 a 95ºC, 30 a 63ºC, 1' a 72ºC 201 30 a 95ºC, 30 a 59ºC, 1' a 72ºC 179 30 a 95ºC, 30 a 60ºC, 1' a 72ºC

Table 8: Bio-markers developed for the diagnosis of bacterial resistance. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) PCR conditions 1 katg - catalase-peroxidase, Mycobacterium tuberculosis S: GTCGGCGGTCACACTTTC 86 30 a 95ºC, 30 a 64ºC, 1 a 72ºC AS: GCTACCACGGAACGACGAC 2 rpob subunidade beta da RNA polimerase direcionada ao DNA, M. tuberculosis S: TACGGTCGGCGAGCTGATCC 165 30 a 95ºC, 30 a 61ºC, 1 a 72ºC AS: TACGGCGTTTCGATGAACC 3 inha - enoil-(acil proteína carreadora) redutase, M. tuberculosis S: TGCTCGAACTCGACGTGCAA 209 30 a 95ºC, 30 a 62ºC, 1 a 72ºC AS: CGAAGCATACGAATACGCCGA