Procedures For DNA Sequencing



Similar documents
Introduction. Preparation of Template DNA

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

For information regarding shipping specifications, please refer to the following link:

DNA Sequencing Handbook

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Troubleshooting Sequencing Data

Sanger Sequencing: Sample Preparation Guide

DNA Sequencing Setup and Troubleshooting

SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre JANUARY 21, Version 3.4

BigDye Terminator v3.1 Cycle Sequencing Kit. Protocol. DRAFT August 27, :32 pm, A_v3.1Title.fm

DNA Sample preparation and Submission Guidelines

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

DNA Core Facility: DNA Sequencing Guide

DNA Sequencing Troubleshooting Guide.

Dye-Blob message: Example: Generally, this is due to incomplete excess dye removal of the cycle sequence reaction.

ZR DNA Sequencing Clean-up Kit

Gene Expression Assays

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

SERVICE REQUEST OF DNA SEQUENCING

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

Automated DNA Sequencing. Chemistry Guide

360 Master Mix. , and a supplementary 360 GC Enhancer.

Essentials of Real Time PCR. About Sequence Detection Chemistries

Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

DNA Sequence Analysis

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

DNA Sequencing Troubleshooting Guide

BacReady TM Multiplex PCR System

1/12 Dideoxy DNA Sequencing

PicoMaxx High Fidelity PCR System

Introduction To Real Time Quantitative PCR (qpcr)

Application Guide... 2

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

PrimeSTAR HS DNA Polymerase

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Troubleshooting Overview

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

TIANquick Mini Purification Kit

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Real-Time PCR Vs. Traditional PCR

DNA FRAGMENT ANALYSIS by Capillary Electrophoresis

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Automated High Throughput Purification of BigDye TM Terminator Fluorescent DNA Sequencing Reactions Using Wizard MagneSil TM Paramagnetic Particles

UltraClean PCR Clean-Up Kit

ABI PRISM BigDye Primer Cycle Sequencing Ready Reaction Kit With AmpliTaq DNA Polymerase, FS

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

DNA SEQUENCING (using an ABI automated sequencer)

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

RT rxns. RT rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

Aurora Forensic Sample Clean-up Protocol

Description: Molecular Biology Services and DNA Sequencing

Preparing Samples for Sequencing Genomic DNA

Real-time quantitative RT -PCR (Taqman)

ab Hi-Fi cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Artisan Scientific is You~ Source for: Quality New and Certified-Used/Pre:-awned ECJuiflment

NimbleGen DNA Methylation Microarrays and Services

DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation

GenScript BloodReady TM Multiplex PCR System

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

Electrophoresis, cleaning up on spin-columns, labeling of PCR products and preparation extended products for sequencing

Reverse Transcription System

TransformAid Bacterial Transformation Kit

DNA Detection. Chapter 13

First Strand cdna Synthesis

TaqMan Fast Advanced Master Mix. Protocol

The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

ABSTRACT. Promega Corporation, Updated September Campbell-Staton, S.

Qubit dsdna HS Assay Kits

Forensic DNA Testing Terminology

SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit

GenomeLab Sequencing Chemistry Protocol

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA

Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Genomic DNA Extraction Kit INSTRUCTION MANUAL

AxyPrep TM Mag PCR Clean-up Protocol

An Overview of DNA Sequencing

HiPer RT-PCR Teaching Kit

Reconstituting and Diluting Primers and TaqMan Probes

MinElute Handbook. Sample & Assay Technologies. March 2008

Genomic Services and Development Unit User Manual

Automation in Genomics High-throughput purification of nucleic acids from biological samples. Valentina Gualdi Operational Scientist PGP

CUSTOM DNA SEQUENCING SERVICES

How is genome sequencing done?

The Biotechnology Education Company

CompleteⅡ 1st strand cdna Synthesis Kit

Transcription:

Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337 E-mail:pmgf@osu.edu www.biosci.ohio-state.edu/~pmgf Version 1.1 Dec., 2001 Introduction This Facility serves the entire Ohio State University community as well as researchers at other academic institutions and industrial concerns in the state of Ohio and beyond. Resources will be devoted to study genomes from high through put DNA sequencing to global gene expression to protein expression (proteomics). For DNA sequencing, PMGF uses an Applied Biosystems 3700 DNA Analyzer and BigDye cycle sequencing terminator chemistry. The sequencing reaction utilizes dideoxynucleotides, Taq DNA polymerase and a thermal cycler to generate the extension products that are separated by capillary electrophoresis on the Analyzer. The extension products are detected by exciting the unique dyes attached to each dideoxynucleotide with a laser, followed by a measurement of the fluorescent emission with a CCD (charge-coupled device) camera. Subsequently, the signal is interpreted by the Applied Biosystems Sequencing Analysis program in order to determine the sequence of the nucleotides in the DNA template. Preparation of Template DNA The quality of the sequencing results is directly proportional to the quality of the template, i. e. clean DNA is absolutely critical. The 3700 DNA Analyzer offers an extremely rapid and efficient means to automate DNA sequencing, however DNA of the highest quality is required because of the potential problems associated with capillary electrophoresis (which is used to separate extension products by the 3700 DNA Analyzer). The capillary tubes are easily fouled or even blocked by contaminating organic solvents, proteins, carbohydrates, and detergents. The samples are injected by electrokinesis so any residual contaminating anions such as RNA, SDS, or salt will decrease the amount of extension products entering the capillary and therefore decrease the signal. The template concentration is also critical so the concentration should be measured by a quantitative method such as (1) absorbance at 260 nm, (2) fluorescence in a fluorometer, or (3) fluorescence in an agarose gel with standards. Double-stranded DNA For plasmids, cosmids, and BACs the strain of E. coli used as the host can have a significant impact on the quality of the template DNA. Strains HB101 and DH5alpha are the best, while XL-1 and MV1190 are okay. The JM101 series of strains are inconsistent at best, and strains optimized for protein 1

expression should be avoided entirely. Template DNA must be prepared by one of the two following methods: (1) cesium chloride differential centrifugation, or (2) a solid phase, DNA extraction kit from a manufacturer such as Qiagen, Promega, or Applied Biosystems. The template should be provided in water or 10mM Tris buffer, but not TE since EDTA will inhibit the sequencing reaction. Please send the following amounts at the appropriate concentration for each sequencing reaction. These amounts are sufficient to repeat the reaction if there is a problem with the initial reaction. Template Quantity (ng) Concentration (ng/µl) Plasmid (<25 kb) 1000 50-500 Phage, Cosmid, BAC 2000 100-500 Bacterial genomic 3000 200-1000 Symmetric PCR Product PCR products must be purified to remove residual primers, nucleotides and salts. The following products are examples of what can be used for PCR purification: (1) Centricon-100 columns (P/N N930-2119), or (2) QIAquick PCR Purification Kit (P/N 28104). Please send the following amounts at the appropriate concentration for each sequencing reaction. These amounts are sufficient to repeat the reaction if there is a problem with the initial reaction. PCR Product(bp) Quantity(ng) Concentration(ng/µl) 100-200 2-6 1-6 200-500 6-20 1-10 500-1000 10-40 2-20 1000-2000 20-80 4-40 >2000 80-200 10-100 Primers Standard Primers The Facility will provide the primers listed below at no additional cost. The use of standard primers is recommended, when possible, since custom primers can introduce variability due to (1) the nature of the priming site, and (2) the quality of the primer. Primer Abbreviation Sequence (5 to 3 ) M13/pUC forward F CGCCAGGGTTTTCCCAGTCACGAC M13/pUC reverse R AGCGGATAACAATTTCACACAGG T7 promoter T7P TAATACGACTCACTATAGGG T3 promoter T3 ATTAACCCTCACTAAAGGGA SP6 promoter SP TATTTAGGTGACACTATAG T7 terminator T7T TGCTAGTTATTGCTCAGCGGTG Custom Primers The recommendations below are provided to help design DNA sequencing primers: 1) The primer should be at least 10 bases from the area of interest. 2) The primer should be at least 18 bases long and preferably 20 to 25. 3) Avoid runs of identical nucleotides and especially 4 or more guanines. 4) Keep the G/C content in the range of 30 to 80% and preferably about 50%. 2

5) The T m should be above 45 C. 6) For primers with a G/C content lower than 50%, it may be necessary to extend the primer to keep the T m greater than 45 C. 7) The use of primers longer than 18 bases minimizes the chance of secondary hybridization to the template DNA. 8) The terminal base at the three prime end should be a G or C. 9) Several computer programs for primer selection are available free on the internet and can be useful in identifying potential secondary structure problems, possible primer dimer formation, and if a secondary hybridization site exists on the target DNA. Custom primers must be provided by the customer. Ten pmoles of primer in water or Tris buffer are required for each reaction, and it must be at a concentration of 2pmol/ml (or 2mM). Except if the template is a BAC or genomic DNA, then provide 50 pmoles at a concentration of 10pmol/µl. 96-well Format Sequencing For high through put needs samples may be submitted in 96-well plates. The round or V-bottom plates (any manufacturer is acceptable) must be well sealed and labeled. The plate positions must be filled by columns, e.g. fill column one positions A through H, then column 2 positions A through H, etc. Position H12 must not be used in order to accommodate the Facility s control reaction, therefore 1 to 95 reactions may be done per plate. Each well should have a total volume of 10µl. Template Each well should have 400-500ng plasmid or one half of the appropriate amount of PCR product that is listed above. Primer Each well should have 4pmoles of primer. If one standard primer is to be used for all of the reactions in one plate, then the primer can be provided by the Facility and should be listed on the order form. The total volume should still be 10µl per well. If the primer(s) is custom or a combination of more than one standard primer, then the customer will provide the primer(s). File Names Files will be named with the following format: initials of customer (dash) name of plate (underline) well position (underline) capillary number. For example, the file name for plate one at well position G1 for George Carlin would be: cg-1_g01_004.ab1. Alternatively you can provide the template name/file name for each sequence on an Excel spread sheet file. If you choose to do this contact the Facility for a properly formatted Excel spread sheet file. Sequencing Data For a DNA sequencing reaction of good quality the Analyzer will read 600 to 700 nucleotides accurately. Files will be named with the following format: initials of customer (dash) name of template (dash) name of primer (underline) well position (underline) capillary number. For example, the file name for template 1 at well position G1 for George Carlin would be: cg-1-t7p_g01_004.ab1. 3

The results for each sequence will be provided in two different files: (1) a generic text file (.seq) with the base sequence, and (2) an ABI Sample file (.ab1) that contains the nucleotide sequence, electropherogram, as well as other information about the run conditions. The generic text file can be opened by most word processing programs whereas the ABI sample files requires specific software to view, print and edit the sequence. The program Editview 1.01 works with Macintosh operating systems and can be obtained free of charge at the following website: www.appliedbiosystems.com/support/software/ Since the sequencing files are formatted for Windows Macintosh users will need the 3100 Utility Conversion to convert the files to a Macintosh format. This program can be obtained free of charge at the following website: www.appliedbiosystems.com/support/software/3100/conversion.cfm The program Chromas is very similar to Editview, but works with Windows operating systems and can be attained from the following website: www.technelysium.com.au/chromas.html You should receive the results in 2 to 3 days unless there are unforeseen delays. In that event, you will be notified as soon as possible after the samples arrive at the facility. Single Reaction In addition a color print out of the electropherogram can be sent to you by mail if requested on the order form. 96-well Format In addition, the files can be placed on a compact disc (CDR) for ease of data handling at no additional charge if requested on the order form. The files may be copied from the Facility s ftp site, but the results are not secure on this site. Preparing and Sending an Order The template DNA and primers can be sent to the above address by mail or by special courier, i. e. yourself, and placed in the refrigerator marked for DNA Sequencing Samples in room 420 of the Biological Sciences Building from 9:00 am to 5:00 pm Monday through Friday. Single Reactions A DNA Sequencing Order Form must be completed for each order in order to properly process the request and receive the results. The DNA Sequencing Order Form can be obtained from the website or at the facility. Each of the lines, 1 through 20, represents an individual sequencing reaction that is defined as one template and one primer. The names on the form must be identical to the names on the sample tubes. The number of characters in the template or primer name should not exceed 6. The size of the template refers to the total size of the molecule and not the insert size, because it is important to know the approximate molar concentration of the priming site in order to do the sequencing reaction properly. The use of short names is appreciated. 96-well Format A DNA Sequencing Order Form (96-well format) must be completed for each order in order to properly process the request and receive the results. The DNA Sequencing Order Form(96-well format) can be obtained from the website or at the facility. Each of the lines, 1 through 20, represents 4

a plate with up to 95 samples. Be sure the name on the plate is identical to the name on the order form. Please list the last well, and the standard primer if provided by the Facility. Non-OSU customers Those customers outside of Ohio State University do not need to complete the boxed area, but instead should place the purchase order number in the Project Line and include a billing address on the form as well your address. A copy of the purchase order would be appreciated. Hours The facility is open from 9:00 am to 5:00 pm Monday through Friday except for University holidays. 5