Analysis of Genetic Diversity in Indigenous Çine Çaparı Sheep under Conservation by Microsatellite Markers [1]
|
|
|
- Fay Carter
- 10 years ago
- Views:
Transcription
1 Kafkas Univ Vet Fak Derg 19 (3): , 2013 DOI: /kvfd JOURNAL HOME-PAGE: ONLINE SUBMISSION: RESEARCH ARTICLE Analysis of Genetic Diversity in Indigenous Çine Çaparı Sheep under Conservation by Microsatellite Markers [1] İbrahim CEMAL * Onur YILMAZ * Orhan KARACA * Pelin BİNBAŞ ** Nezih ATA * [1] This research was supported by Adnan Menderes University Scientific Research Fund (ADU-BAP) (Project No: ZRF-07030) * Adnan Menderes Üniversitesi, Ziraat Fakültesi, Zootekni Bölümü, TR Aydın - TÜRKİYE ** Fot Gıda, TR Fethiye, Muğla - TURKEY Makale Kodu (Article Code): KVFD Summary In this study, 123 animals from 3 different flocks (ADU-ÇÇKP conservation flock and two breeders flocks) were genotyped with 10 microsatellite markers to investigate genetic diversity in the endangered native Çine Çaparı sheep breed. The number of alleles per microsatellite marker ranged from 7 (OarCP34) to 17 (OarFCB193), with an average of 11.5 alleles per locus. Total number of alleles for the investigated 10 microsatellite markers was found to be 104, 72 and for ADÜ-ÇÇKP, EA and MV flocks, respectively. The considerable difference in the allele numbers of the flocks indicates high genetic variability in the ADÜ-ÇÇKP flock versus the other two breeders flocks. The observed alleles have different size from other shows the existence of private alleles for flocks. According to the polymorphism information content (PIC) values, the highest and lowest polymorphism was detected to be and for OarFCB193 and OarFCB304 markers, respectively. The mean expected heterozygosity (He) and the mean observed heterozygosity (Ho) for the whole Çine Çaparı population under conservation were and 0.789, respectively. The highest genetic similarity (0.8262) was observed between the ADU-ÇÇKP conservation flock and Erdoğan Aktürk s flock. The results obtained in the present study will help to interpret the genetic structure of indigenous Çine Çaparı sheep and will be of benefit to the efforts for conservation of this breed. Keywords: Genetic resources, Sheep, Çine Çaparı, Diversity, Microsatellites Koruma Altındaki Çine Çaparı Koyunlarda Genetik Çeşitliliğin Mikrosatellit İşaretleyiciler İle Analizi Özet Çalışmada, Adnan Menderes Üniversitesi Çine Çaparı Koruma Programı (ADÜ-ÇÇKP) kapsamında oluşturulan koruma sürüsü ile 2 yetiştiricide bulunan toplam 123 baş hayvanda 10 mikrosatellit lokusu kullanılarak genotipleme yapılmıştır. Sürüler arası genetik benzerlik ve uzaklıklar incelenmiştir. Mikrosatellit işaretleyici başına elde edilen allel sayısı 7 (OarCP34) ile 17 (OarFCB193) arasında değişmekle birlikte lokus başına ortalama allel sayısı 11.5 tur. Populasyon bütününü oluşturan ADÜ-ÇÇKP, EA ve MV sürülerinde belirlenen toplam allel sayıları sırasıyla 104, 72 ve olarak belirlenmiştir. Allel sayıları bakımından sürüler arası gözlenen bu ciddi fark iki yetiştirici sürüsüne oranla ADÜ-ÇÇKP koruma sürüsünde yüksek genetik çeşitliliğe işaret etmektedir. Diğer allelere oranla farklı büyüklükte allelerin gözlenmesi sürülere özgün özel allellerin varlığına işaret etmektedir. Polimorfik bilgi içeriği (PIC) değerleri dikkate alındığında en yüksek ve en düşük polimorfizm değerleri OarFCB193 ve OarFCB304 lokusları için sırasıyla and olarak belirlenmiştir. Ele alınan tüm lokuslara dayalı değerlendirme sonucunda gözlenen (Ho) ve beklenen (He) heterozigotluk ortalamaları sırasıyla ve olarak elde edilmiştir. En yüksek genetik benzerlik (0.8262) ADÜ-ÇÇKP koruma sürüsü ile Erdoğan Aktürk e ait sürü arasında ortaya çıkmıştır. Bu çalışmadan elde edilen sonuçlar yerli Çine Çaparı koyunlarda genetik yapının tanımlanmasına yardımcı olmakla birlikte gelecekte bu ırkın korunmasına yönelik çabalara fayda sağlayacaktır. Anahtar sözcükler: Genetik kaynaklar, Koyun, Çine Çaparı, Çeşitlilik, Mikrosatellit INTRODUCTION Agricultural biodiversity includes the diversity of the cultivated plants and domestic animals utilized by humankind for the production of food and other goods and services. The livestock species (over 40 species) contributing İletişim (Correspondence) [email protected]
2 384 Analysis of Genetic Diversity in... to today s agriculture and food production are shaped by a long history of domestication and development. The term animal genetic resources (AnGR) is used to include all animal species, breeds and strains (and their wild relatives) that are of economic, scientific and cultural interest to humankind in terms of food and agricultural production for the present or in the future 1-3. Being part of the Fertile Crescent, Turkey has an important position for domestication. Therefore, native breeds of sheep, goat and cattle have an important level of diversity. Sheep in Turkey s animal husbandry have great genetic potential together with high numbers and with wide breeds and local type diversity which is formed according to different ecological conditions. The large genetic changes observed in sheep populations in Western Anatolia with the intensification of agriculture have threatened the existence of native Turkish sheep breeds in last decades 4. In a short period of time including the last two to three decades, some breeds have become extinct (the Ödemiş breed) or endangered (the Dağlıç, Çine Çaparı, Sakız, Kıvırcık breeds). The fat-tailed Çine Çaparı is a local native sheep breed originating in the mountains (especially in mountain Madran) of the Aydın province in Turkey. In the last 20 to 30 years, the number of purebred Çine Çaparı sheep has declined very much due to the backcrossing of the breed with rams of the Kıvırcık and prolific Sakız (Chios) breeds. Consequently, this process has put them in danger of extinction. A conservation program termed the Adnan Menderes University - Çine Çaparı Conservation Program (ADÜ-ÇÇKP) was established in 1996 to characterize and conserve this endangered breed. Studies to establish a conservation flock at Adnan Menderes University were also initiated in the same year. In mountainous villages only two flocks including purebred animals remained. Members of all other flocks were turned to a synthetic form, namely Karya. The main reasons for breeders to keep this breed are the easiness of management and its resistance to diseases and high temperatures. Studies for the characterization and conservation of indigenous breeds in Turkey in the last decade are encouraging. The efforts made to characterize and conserve the Çine Çaparı sheep breed are a good example of conservation activities in Turkey. The trend of a decrease in the animal number was changed to a trend of an increase with the efforts of researchers at Adnan Menderes University and the support of the Ministry of Food, Agriculture and Animal Husbandry. The ongoing studies have stopped the process of extinction of the breed and have guaranteed the future of the breed. Microsatellites are valuable genetic markers due to their dense distribution in the genome, great variation, codominant inheritance and easy genotyping. In recent years, they have been extensively used in parentage testing, linkage analyses, population genetics and other genetic studies 5,6. The aim of this study was to determine the withinbreed genetic diversity in endangered Çine Çaparı sheep using 10 microsatellite markers and to obtain the genetic similarities and distances among animals within and between flocks. MATERIAL and METHODS DNA samples of 123 animals from 3 existing flocks were genotyped with 10 microsatellite markers (OarCP34, OarFCB193, OarFCB304, OarJMP29, OarFCB128, BM8125, OarJMP58, OarVH72, MAF65, and DYMS1) that selected from the list recommended by FAO 7. Forward markers were marked with three fluorescent dyes (D2, D3, D4). Three multiplex groups were formed with 8 out of the 10 microsatellites. Annealing temperatures of MAF65 and DYMS1 were not appropriate for the other 3 multiplex groups. Therefore, these two microsatellites were amplified by Polymerase Chain Reaction (PCR) separately. Table 1 shows details for the considered microsatellites. DNA was isolated from blood samples using a DNA extraction kit. Specific genomic regions were amplified by Polymerase Chain Reaction (PCR) in accordance with the touchdown PCR technique. The thermal cycling conditions are given in the Table 2. For every microsatellite locus, the amplification reaction took place in a total volume of 25 μl and contained the following constituents in the final concentrations indicated in brackets; dntp s (0 2 mm for each one), MgCl 2 (2.0 mm), primers (0.25 mm for each one), and Taq DNA polymerase (1 unit reaction 1 ). Approximately 100 ng of genomic DNA was used as template for each of PCR amplification. Fragment analysis was achieved using the automatic laser-induced fluorescence DNA sequencer (Beckman Coulter CEQ 8000 Genetic Analysis System). Obtained data was analyzed by the Beckman Coulter CEQ Fragment Analysis Software. The frequency of particular alleles of the microsatellite sequences were used to calculate the number of alleles (n A ), the number of effective alleles (n E ), the polymorphic information content (PIC), the observed heterozygosity (Ho), the expected heterozygosity (He) and average heterozygosity (Ĥ) Nei s genetic similarities and genetic distances between flocks 12 and F statistics 8 were also estimated. A dendrogram based on Nei s genetic distances was obtained using UPGMA (Unweighted Pair Group Method with Arithmetic Mean) method. We used the microsatellite loci analyzed to find out if the examined herd of Çine Caparı was in a genetic equilibrium conformable to the Hardy- Weinberg principle. Propriety of allele frequencies Hardy- Weinberg Equilibrium (HWE) was checked by χ 2 test (P<0.01), which estimated observed genotype frequencies and expected numeric values of the same genotypes. These parameters were calculated using GenAlEx 13, PowerStatsV12 14, MEGA 4 15, Arlequin and POPGENE 17 softwares.
3 385 CEMAL, YILMAZ, KARACA BİNBAŞ, ATA Table 1. Details of considered microsatellites Tablo 1. Çalışmada kullanılan mikrosatelitlere ait bilgiler Locus Name Primers Base Pair (bp) Multiplex Group OarCP34 OarFCB304 OarFCB193 OarJMP29 OarFCB128 BM8125 OarJMP58 OarVH72 DYMS1 MAF65 F: GCTGAACAATGTGATATGTTCAGG R: GGGACAATACTGTCTTAGATGCTGC F: CCCTAGGAGCTTTCAATAAAGAATCGG R: CGCTGCTGTCAACTGGGTCAGGG F: TTCATCTCAGACTGGGATTCAGAAAGGC R: GCTTGGAAATAACCCTCCTGCATCCC F: GTATACACGTGGACACCGCTTTGTAC R: GAAGTGGCAAGATTCAGAGGGGAAG F: ATTAAAGCATCTTCTCTTTATTTCCTCGC R: CAGCTGAGCAACTAAGACATACATGCG F: CTCTATCTGTGGAAAAGGTGGG R: GGGGGTTAGACTTCAACATACG F: GAAGTCATTGAGGGGTCGCTAACC R: CTTCATGTTCACAGGACTTTCTCTG F: GGCCTCTCAAGGGGCAAGAGCAGG R: CTCTAGAGGATCTGGAATGCAAAGCTC F: AACAACATCAAACAGTAAGAG R: CATAGTAACAGATCTTCCTACA F: AAAGGCCAGAGTATGCAATTAGGAG R: CCACTCCTCCTGAGAATATAACATG Individual Individual Table 2. Thermal cycling conditions according to Touchdown PCR Tablo 2. Touchdown PZR koşulları Loci Denaturation ( C) Time (sec) Annealing ( C) Time (sec) Extension ( C) Time (sec) OarCP34 OarFCB193 OarFCB304 OarJMP29 OarFCB128 BM8125 OarJMP58 OarVH MAF DYMS RESULTS One hundred and fifteen alleles were determined from 10 microsatellites markers. Total number of alleles for the investigated 10 microsatellite markers was found to be 104, 72 and for ADÜ-ÇÇKP, EA and MV flocks, respectively. In the all loci, the number of alleles ranged from 7 (OarCP34) to 17 (OarFCB193), with an average of 11.5 alleles per locus. The frequency of alleles varied according to locus; the allele size range (ASR), number of allele (n A ), number of effective allele (n E ), the polymorphic information content (PIC), the observed heterozygosity (Ho), the expected heterozygosity (He) and average heterozygosity (Ĥ) are given in Table 3 according to all flocks. Among the ten microsatellite loci studied, the highest observed heterozygosity value was for OarFCB193, and the lowest value was 0.0 for DYMS1. The number of alleles for the OarFCB193, DYMS1, OarJMP29, BM8125, OarJMP58, OarFCB304, OarFCB128, MAF65, OarVH72 and OarCP34 loci were found to be 7, 14, 13, 13, 11, 10, 9, 8 and 7, respectively. Loci in all flocks were examined in terms of polymorphic information content (PIC) and the results showed that OarFCB193 (0.875), OarFCB128 (0.765) and BM8125 (0.765) loci take highest values. The number of alleles (n A ), number of effective alleles (n E ), the polymorphism information content (PIC), the observed heterozygosity (Ho), the expected heterozygosity (He) and average heterozygosity (Ĥ) according to all three flocks are given in Table 4. Considering the number of alleles, OarFCB193 showed the highest polymorphism of the three flocks. Ho and He
4 386 Analysis of Genetic Diversity in... Table 3. Allele size range (ASR) (bp), n A, n E, PIC, Ho, He and Ĥ values in considered microsatellites in all flocks Tablo 3. Tüm sürüler için kullanılan mikrosatellitlere ait genel gözlenen boyut aralığı (GBA, bp), örnek sayısı (N), n A, n E, PIC, Ho, He ve Ĥ değerleri Loci N ASR (bp) n A n E Ho He Ĥ PIC OarCP / OarFCB / OarFCB / OarJMP / OarFCB / BM / OarJMP / OarVH / MAF / DYMS / Mean St. dev ASR: allele size range, n A : number of alleles, n E : number of effective allele, PIC: polymorphic information content, Ho: observed heterozygosity, He: expected heterozygosity Ĥ: average heterozygosity Table 4. n A, n E, PIC, Ho, He and Ĥ values in considered microsatellites according to flocks Tablo 4. Sürülere göre kullanılan mikrosatellitlere ait n A, n E, PIC, Ho, He ve Ĥ değerleri ADU-CCKP EA Flock MV Flock Loci N n A n E Ho He Ĥ PIC N n A n E Ho He Ĥ PIC N n A n E Ho He Ĥ PIC OarCP OarFCB OarFCB OarJMP OarFCB BM OarJMP OarVH MAF DYMS Mean St.dev n A : number of alleles, n E : number of effective allele, PIC: polymorphic information content, Ho: observed heterozygosity, He: expected heterozygosity Ĥ: average heterozygosity values obtained from the study were seen to vary between and with 0.0 and 0.788, respectively in all populations. The average heterozygosity value was for all loci. The observed alleles with different sizes indicate the existence of unique or private alleles for flocks within this breed. 44 out of the 115 alleles were observed in only one of three flocks as private alleles. Determined private alleles are given in Table 5. In general, these private alleles are found at either end of the allelic range with a low frequency (between 0.06 and 0.143), were observed to be 33 in ADÜ-ÇÇKP, 7 in EA and 4 in MV flock. In particular, null allele frequencies were found to be remarkable for OarFCB128, OarJMP58, MAF65 and DYMS1 loci (Table 6). The high (>0.05) null allele frequencies observed for OARFCB128, OARJMP58, MAF65 and DYMS1 loci indicated the presence of null alleles and loss of heterozygosity. In spite of higher null allele frequencies of MAF65 and DYMS1 loci, the frequencies very close to 0.05 for OarFCB128 and OarJMP58 loci could be tolerated. The Hardy-Weinberg equilibrium (HWE) was tested for all populations and results are given in Table 7. The assessment of genetic equilibrium in the examined herd, based on the analysis of observed and expected frequencies of individual genotypes, showed highly significant differences between the expected and observed values for the OarFCB304, OarFCB128, OarJMP58, MAF65 and DYMS1
5 387 CEMAL, YILMAZ, KARACA BİNBAŞ, ATA Table 5. Number and frequency of common alleles in whole population and private alleles in three flocks Tablo 5. Ortak allelerin tüm populasyondaki ve özgün allellerin sürülerdeki sayı ve frekansları Common Alleles Private Alleles Loci n A Frequency ADÜ-ÇÇKP Flock EA Flock MV Flock No (Min-Max) No Size: Freqeency No Size: Freqeency No Size: Freqeency OarCP : OarFCB OarFCB OarJMP29 13 BM OarJMP : : : : : : : : : : : : : : : : : : : : : : : : : : : : :0.006 OarVH : : MAF65 9 DYMS1 14 OarFCB n A : number of alleles : : : : : : : : : : : :0.007 (P<0.001) in the ADÜ-ÇÇKP flock; OarJM29, OarFCB128, BM8125 and DYMS1 (P<0.001) in the EA flock; OarJMP58, DYMS1 (P<0.001) and MAF65 (P<0.05). The other markers were in the Hardy-Weinberg (HW) equilibrium in all 3 flocks. Genetic similarity and genetic distance values are presented in Table 8. A dendrogram of genetic distances between the three flocks is given in Fig. 1. Both Table 1 and Fig. 1 show that the highest and lowest genetic similarities were found between ADÜ-ÇÇKP and EA (0.826) and EA and MV flocks (0.710), respectively. When the drawn dendrogram was examined, it was found that the MV flock was in a separate group from ADÜ-ÇÇKP and EA flocks. A Factorial Correspondence Analysis (FCA) chart was drawn in order to demonstrate how much individuals in the three flocks were separated. Factorial correspondence analysis of the Çine Caparı sheep in the three flocks based on the 10 microsatellite loci is given in Fig. 2.
6 388 Analysis of Genetic Diversity in... Table 6. Null allele frequencies obtained from 10 STR loci Tablo 6. İncelenen 10 mikrosatellit lokusuna ait null allel frekansları Loci Null Allele Frequency OARCP OARFCB OARFCB OARJMP OARFCB * BM OARJMP * OARVH MAF * DYMS * * null alleles with high frequency F statistics are widely used for defining population structure. Fis, Fit and Fst values of between the flocks averaged over ten microsatellites are shown in Table 9. Fis values were found to be between and in general. High values of Fis for all loci in the MV flock indicate for the existence of high inbreeding. It is mainly stem from small size of this flock. The results (Table 9) indicated that using the microsatellites in this population was useful for the planned objectives. When ADÜ-ÇÇKP, EA and MV flocks are evaluated for this parameter, five loci in the ADÜ-ÇÇKP flock, seven loci in the EA flock and six loci in the MV flock showed high heterozigosity rates. Low Fst values imply that flocks are similar due to some gene flow between them. This result is strongly supported with efforts are given within ADÜ-ÇÇKP at past years to change rams between flocks to limit inbreeding. Table 7. Chi-Square test values belong to 10 microsatellites in all population Tablo 7. Tüm sürülerde incelenen 10 mikrosatellit lokusuna ait Ki-kare test değerleri Loci ADÜ-ÇÇKP EA MV DF χ 2 Prob Sig. DF χ 2 Prob Sig. DF χ 2 Prob Sig. OarCP NS NS NS OarFCB NS NS NS OarFCB P< NS NS OarJMP NS P< NS OarFCB P< P< NS BM NS P< NS OarJMP P< NS P<0.001 OarVH NS NS NS MAF P< NS P<0.05 DYMS P< P< P<0.001 DF: Degree of freedom, NS: Non-significance Table 8. Genetic similarity (above diagonal) and genetic distance (below diagonal) in three flocks Tablo 8. Üç sürüdeki genetik benzerlik (diyagonal üzeri) ve genetik mesafe (diyagonal altı) Flocks ADÜ-ÇÇKP EA MV ADÜ-ÇÇKP **** EA **** MV **** DISCUSSION The considerable differences in allele numbers in flocks indicate high genetic variability in the ADÜ-ÇÇKP flock versus the other two breeders flocks (EA and MV). The observed allele numbers show the existence of unique alleles for flocks. The results show that number of alleles, which was observed in three small Çine Çaparı sheep flocks, was higher than some reported studies 18,19 and relatively lower than Fig 1. Dendrogram based on Nei s genetic distances among three flocks Şekil 1. Üç sürü arası Nei nin genetik uzaklıklarına dayalı elde edilen dendrogram
7 389 CEMAL, YILMAZ, KARACA BİNBAŞ, ATA Fig 2. Factorial correspondence analysis of Cine Capari sheep in three flocks Şekil 2. Üç sürüdeki Çine Çaparı koyunlara ait faktöriyel birleştirici analizine ait grafik Table 9. Fis, Fit and Fst values for whole Çine Çaparı population and for each flock Tablo 9. Çine Çaparı populasyonunun tamamı ile her biri sürüye ait Fis, Fit ve Fst değerleri General ADÜ-ÇÇKP EA MV Loci N Fis Fit Fst N Fis Fit N Fis Fit N Fis Fit OarCP OarFCB OarFCB OarJMP OarFCB BM OarJMP OarVH MAF DYMS Mean some of the other researches 20,21. The size of Çine Çaparı population is very small, so it has led to a low number of alleles. In addition, differences between the literature and the present study are natural due to the use of different breeds and using a number of microsatellites. In conservation studies, the most important criterion to decide the priority of the breed is the high level of heterozygosity that it exhibits. The average heterozygosity values (Ĥ) (ranging between ) were higher than reported studies in other sheep breeds These results occurred due to high heterozygosity levels in the studied loci. In addition to the high genetic diversity in this breed is one of the supporting observations for the proximity of the breeds to the centre of domestication. Genetic distance and genetic similarity values obtained from the study were similar to the values in a previous study conducted for the same genotype 27. It is understood from Fig. 2 that among all the individuals in every flock a group formed between themselves. Individuals of the MV flock seem to have a relatively higher level of decomposition of the other flocks. Although ADÜ- ÇÇKP and EA flocks show dense clustering, some of the animals involved themselves between the two clusters, some others entered into other clusters depending on the brood transfers among the flocks. The results obtained from factorial corresponding analysis indicated that clustering will become clearer if we use a large number of microsatellites for identification. Four loci in the ADÜ-ÇÇKP flock, 4 loci in the EA flock and 3 loci in the MV flock were not in the Hardy-Weinberg (HW) equilibrium in the studied population. This situation may have occurred as a result of a controlled reproduction program for many years to prevent inbreeding in this population. All Fis values obtained from the studies showed that pure breeding did not apply in these flocks. Although Fst values diverged from 1, this value was 0 at the basis of the flocks. This result points out that individuals came from a common ancestor in terms of these loci.
8 390 Analysis of Genetic Diversity in... The minimum allele number was observed in the MV flock. This result is natural due to the fact that the population number has decreased dramatically in the MV flock. When Table 6 is examined, the MAF65 and DYMS1 loci, which had high null allele frequency, should not be used in genetic diversity studies in this population to prevent incorrect interpretation of results. The spread of specific alleles in all populations can be ensured by the transfer of rams among flocks. In this way, unique or private alleles will be spread over all populations. The present study results indicate that although the Çine Çaparı sheep population size is very small, genetic diversity was significantly high in the gene pool. Results show that the conservation flock founded at Adnan Menderes University has higher genetic diversity than the other 2 farmers flocks according the results of 10 loci studied. These results stem from the establishment of the conservation flock with animals from different flocks and from implementation of planning mating for many years according to relationships between members of the flock. Maintenance of controlled breeding practices considering pedigree and molecular genetic data and transferring studs between flocks will maintain genetic diversity in this breed in the future. ACKNOWLEDGEMENTS We would like to thank to people who founders and contributors of Adnan Menderes University Çine Çaparı Sheep Conservation Program (ADU-ÇÇKP). REFERENCES 1. Rege JEO, Gibson JP: Animal genetic resources and economic development: Issues in relation to economic valuation. Ecol Econ,, , Ertuğrul M, Dellal G, Elmacı C, Akın O, Karaca O, Altın T, Cemal İ: Hayvansal gen kaynaklarının koruma ve kullanımı. Türkiye Ziraat Mühendisliği VI. Teknik Kongresi, 3-7 Ocak, Ankara, FAO: The State of the World s Animal Genetic Resources for Food and Agriculture. In, Pilling D, Rischkowsky B (Eds): Brief. ftp://ftp.fao.org/ docrep/fao/010/a1260e/a1260e00.pdf, Accessed: Karaca O, Cemal İ: Batı Anadolu koyunculuğunda genetik kaynakların korunma ve kullanımı. Ege Bölgesi 1. Tarım Kongresi, 7-11 Eylül, Adnan Menderes Üniversitesi, Aydın, s , Goldstein DB, Pollock DD: Launching microsatellites: A review of mutation processes and methods of phylogenetic inference. J Hered, 88, , Hoda A, Bytyqi H, Dobi P, Mehmeti H: Genetic diversity of Bardhoka breed in Albania and Kosova analyzed by microsatellite markers. Res J Agric Sci, 41 (2): , FAO: Food and agriculture organisation of the United Nations secondaryguidelines for development of national farm animal genetic resources management plans. Measurement of domestic animal diversity (MoDAD): Recommended microsatellite markers, Accessed: Nei M: Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89, , Botstein D, White RL, Skolnick M, Davis RW: Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet, 32, , Nei M: Molecular evolutionary genetics. In, Nei M (Ed): Molecular Evolutionary Genetics. Columbia University Press, New York, Nei M, Kumar S: Molecular evolution and phylogenetics. In, Nei M, Kumar S (Eds): Molecular Evolution and Phylogenetics. Oxford University Press, London, Nei, M: Genetic distance between populations. Am Nat, 136, , Peakall R, Smouse PE: GenAlEx 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes, 6, , Brenner C, Morris J: Paternity index calculations in single locus hypervariable DNA probes: validation and other studies. Proceedings for the 1 th International Symposium on Human Identification. Promega Corporation, Madison, pp , Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol, 24, , Excoffier L, Lischer HEL: Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour, 10, , Yeh FC, Yang RC, Boyle TBJ, Ye ZH, Mao JX: POPGENE the userfriendlyshareware for population genetic analysis. University of Alberta, Canada, Accessed: Farid A, O Reilly E, Kelsey JCR: Genetic analysis of ten sheep breeds using microsatellite markers. Can J Anim Sci, 80, 9-17, Soysal Mİ, Koban E, Özkan E, Altunok V, Bulut Z, Nizamlıoglu M, Togan I: Evolutionary relationship among three native and two crossbreed sheepbreeds of Turkey: Preliminary results. Revue Med Vet, 156 (5): , Gutiérrez-Gil B, Uzun M, Arranz JJ, San Primitivo F, Yildiz S, Cenesiz M, Bayón Y: Genetic diversity in Turkish sheep. Acta Agr Scand A-An, 56, 1-7, Zhong T, Han JL, Guo J, Zhao QJ, Fu BL, He XH, Jeon JT, Guan WJ, Ma YH: Genetic diversity of Chinese indigenous sheep breeds inferred from microsatellite markers. Small Ruminant Res, 90, 88-94, Tascon DC, LittleJohn RP, Almeida PAR, Crawford AM: Genetic variation within Merino sheep breed: Analysis of closely related populations using microsatellites. Anim Genet, 31, , Grigaliunaite I, Tapio M, Viinalas H, Grislis Z, Kantanen J, Miceikiene I: Microsatellite variation in the Baltic sheep breeds. Vet Med Zoot, 21, 66-73, Yılmaz O, Karaca, O: Karya Koyunlarda Mikrosatellit İşaretleyicilerle Babalık Testi. Kafkas Univ Vet Fak Derg, 18 (5): , Handley LJL, Byrne K, Santucci F, Townsend S, Taylor M, Bruford MW, Hewitt GM: Genetic structure of European sheep breeds. Heredity, 99, , Pramod S, Kumarasamy P, Chandra ARM, Sridevi P, Rahumathulla PS: Molecular characterization of vembur sheep (Ovis aries) of South India based on microsatellites. Indian J Sci Technol, 2, 55-58, Binbaş P, Cemal İ: Yerli gen kaynağı Çine Çaparı koyunlarda genetik çeşitliliğin RAPD belirteçleri ile belirlenmesi. 5. Ulusal Zootekni Bilim Kongresi, 5-8 Eylül 2007, Yüzüncü Yıl Üniversitesi, Van, 2007.
Analysis of Genetic Polymorphism with Microsatellite Method in Turkey Local Sheep Breeds
Kafkas Univ Vet Fak Derg 18 (1): 75-79, 2012 DOI:10.9775/kvfd.2011.4872 RESEARCH ARTICLE Analysis of Genetic Polymorphism with Microsatellite Method in Turkey Local Sheep Breeds Summary In this study,
EDUCATION & THESIS ACADEMIC POSITIONS HELD AWARDS & FELLOWSHIPS
Name- Surname : Onur YILMAZ Birth date : 13.10.1977 Adress : Adnan Menderes University Faculty of Agriculture Department of Animal Science Biometry & Genetics Unit Aydın, Turkey Phone : +90 256-772 70
TURKHAYGEN-I PROJECT DATABANK: USING DATABASE AND INFORMATICS TECHNOLOGY ON BIOLOGICAL DATA ORGANIZATION
In vitro Conservation and Priliminary Molecular Identification of Some Turkish Domestic Animal Resources-I TURKHAYGEN-I PROJECT DATABANK: USING DATABASE AND INFORMATICS TECHNOLOGY ON BIOLOGICAL DATA ORGANIZATION
Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.
Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH
Association of Calpastatin (CAST) Gene Polymorphism with Weaning Weight and Ultrasonic Measurements of Loin Eye Muscle in Kıvırcık Lambs [1]
Kafkas Univ Vet Fak Derg 20 (5): 675-680, 2014 DOI: 10.9775/kvfd.2014.10816 Journal Home-Page: http://vetdergi.kafkas.edu.tr Online Submission: http://vetdergikafkas.org RESEARCH ARTICLE [1] 1 Association
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
DNA MARKERS FOR ASEASONALITY AND MILK PRODUCTION IN SHEEP. R. G. Mateescu and M.L. Thonney
DNA MARKERS FOR ASEASONALITY AND MILK PRODUCTION IN SHEEP Introduction R. G. Mateescu and M.L. Thonney Department of Animal Science Cornell University Ithaca, New York Knowledge about genetic markers linked
GENETIC CHARACTERIZATION OF INDIGENOUS ANATOLIAN WATER BUFFALO BREED USING MICROSATELLITE DNA MARKERS
GENETIC CHARACTERIZATION OF INDIGENOUS ANATOLIAN WATER BUFFALO BREED USING MICROSATELLITE DNA MARKERS SOYSAL, M. _. 1 E. OZKAN 2 S. KOK 3 Y.T.TUNA 4 E.K.GURCAN 4 SUMMARY One indigenous water buffalo population
Determining Scientific Performance of Some of Laboratory Animal Journals in Veterinary Science with the Ethical Approach
Kafkas Univ Vet Fak Derg 17 (1): 83-87, 2011 DOI:10.9775/kvfd.2010.2429 RESEARCH ARTICLE Determining Scientific Performance of Some of Laboratory Animal Journals in Veterinary Science with the Ethical
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Genetic polymorphism of Hucul horse population based on 17 microsatellite loci*
Regular paper Vol. 60, No 4/2013 761 765 on-line at: www.actabp.pl Genetic polymorphism of Hucul horse population based on 17 microsatellite loci* Agnieszka Fornal *, Anna Radko and Agata Piestrzyńska-Kajtoch
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
GENETIC EVIDENCE FOR THE DISTINCTNESS OF KANGAL DOGS
Bull Vet Inst Pulawy 49, 249-254, 2005 GENETIC EVIDENCE FOR THE DISTINCTNESS OF KANGAL DOGS VAHDETTİN ALTUNOK, EVREN KOBAN 1, LOUNÈS CHIKHI 2, ALISON SCHAFFER 3, NIELS C. PEDERSEN 3, MEHMET NİZAMLIOĞLU
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Evolution (18%) 11 Items Sample Test Prep Questions
Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science
GRASSLAND AND FORAGE CROP CULTIVATION IN TURKISH AGRICULTURE. Engin TAN
ANADOLU, J. of AARI 12 (2) 2002, 100-109 MARA GRASSLAND AND FORAGE CROP CULTIVATION IN TURKISH AGRICULTURE Engin TAN Adnan Menderes Üniversitesi Ziraat Fakültesi Tarla Bitkileri Bölümü Aydın-TURKEY Rıza
Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
DNA for Defense Attorneys. Chapter 6
DNA for Defense Attorneys Chapter 6 Section 1: With Your Expert s Guidance, Interview the Lab Analyst Case File Curriculum Vitae Laboratory Protocols Understanding the information provided Section 2: Interpretation
Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing
Short Communication Y-STR haplotype diversity and population data for Central Brazil: implications for environmental forensics and paternity testing T.C. Vieira 1,2,3,4, M.A.D. Gigonzac 2,3,4, D.M. Silva
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING
MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING Viktor Korzun Lochow-Petkus GmbH, Grimsehlstr.24, 37574 Einbeck, Germany [email protected] Summary The development of molecular techniques
HLA data analysis in anthropology: basic theory and practice
HLA data analysis in anthropology: basic theory and practice Alicia Sanchez-Mazas and José Manuel Nunes Laboratory of Anthropology, Genetics and Peopling history (AGP), Department of Anthropology and Ecology,
ISSN 1810-0708 FAO ANIMAL PRODUCTION AND HEALTH. guidelines MOLECULAR GENETIC CHARACTERIZATION OF ANIMAL GENETIC RESOURCES
9 ISSN 1810-0708 FAO ANIMAL PRODUCTION AND HEALTH guidelines MOLECULAR GENETIC CHARACTERIZATION OF ANIMAL GENETIC RESOURCES 9 FAO ANIMAL PRODUCTION AND HEALTH guidelines MOLECULAR GENETIC CHARACTERIZATION
SUSTAINABILITY AND GENE CONSERVATION AS GUIDING PRINCIPLES OF THE HUNGARIAN-VIETNAMESE POULTRY RESEARCH FOR DEVELOPMENT
SUSTAINABILITY AND GENE CONSERVATION AS GUIDING PRINCIPLES OF THE HUNGARIAN-VIETNAMESE POULTRY RESEARCH FOR DEVELOPMENT Szalay, I.T. Dong Xuan, K. D. T. Association of Hungarian Small Animal Breeders for
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Investing in genetic technologies to meet future market requirements and assist in delivering profitable sheep and cattle farming
Investing in genetic technologies to meet future market requirements and assist in delivering profitable sheep and cattle farming B+LNZ GENETICS The Government through its Ministry of Business, Innovation
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Cooperation tendencies and alternative milk marketing channels of dairy producers in Turkey: A case of Menemen
Cooperation tendencies and alternative milk marketing channels of dairy producers in Turkey: A case of Menemen Družstevní tendence a alternativní marketingové kanály využívané producenty mléka v Turecku:
Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics
Basic Principles of Forensic Molecular Biology and Genetics Population Genetics Significance of a Match What is the significance of: a fiber match? a hair match? a glass match? a DNA match? Meaning of
Genetic conservation of microsatellite sequences in Suidae* *
Ann. Anim. Sci., Vol. 9, No. 3 (2009) 243 248 Genetic conservation of microsatellite sequences in Suidae* * A n n a K o z u b s k a - S o b o c i ń s k a 1, B a r b a r a R e j d u c h 1, M a r i a O c
Association between Dopamine Gene and Alcoholism in Pategar Community of Dharwad, Karnataka
International Journal of Scientific and Research Publications, Volume 3, Issue 10, October 2013 1 Association between Dopamine Gene and Alcoholism in Pategar Community of Dharwad, Karnataka SOMASHEKHAR
Genomic Selection in. Applied Training Workshop, Sterling. Hans Daetwyler, The Roslin Institute and R(D)SVS
Genomic Selection in Dairy Cattle AQUAGENOME Applied Training Workshop, Sterling Hans Daetwyler, The Roslin Institute and R(D)SVS Dairy introduction Overview Traditional breeding Genomic selection Advantages
REVIEWS. Computer programs for population genetics data analysis: a survival guide FOCUS ON STATISTICAL ANALYSIS
FOCUS ON STATISTICAL ANALYSIS REVIEWS Computer programs for population genetics data analysis: a survival guide Laurent Excoffier and Gerald Heckel Abstract The analysis of genetic diversity within species
Polymorphism of selected microsatellite DNA sequences in Simmental cattle chosen for identification of QTLs for meat traits
Animal Science Papers and Reports vol. 24 (2006) Supplement 2, 71-77 Institute of Genetics and Animal Breeding, Jastrzębiec, Poland Presented at the III Conference Genetic and environmental possibilities
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
vision evolving guidelines
vision To foster a collective, industry supported strategy for the future of the Holstein Breed which will act as a tool for Canadian dairy producers to maximize profitability and genetic improvement.
ARTICLE IN PRESS. Small Ruminant Research xxx (2010) xxx xxx. Contents lists available at ScienceDirect. Small Ruminant Research
Small Ruminant Research xxx (2010) xxx xxx Contents lists available at ScienceDirect Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres A genetic linkage map for the South African
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
MCB41: Second Midterm Spring 2009
MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for
Introductory genetics for veterinary students
Introductory genetics for veterinary students Michel Georges Introduction 1 References Genetics Analysis of Genes and Genomes 7 th edition. Hartl & Jones Molecular Biology of the Cell 5 th edition. Alberts
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.
The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
PEDIGREE ANALYSIS OF THE FORMER VALACHIAN SHEEP
2011 CVŽV ISSN 1337-9984 PEDIGREE ANALYSIS OF THE FORMER VALACHIAN SHEEP M. ORAVCOVÁ*, E. KRUPA Animal Production Research Centre Nitra, Slovak Republic ABSTRACT The objective of this study was to assess
FIRST ANNOUNCEMENT AND CALL FOR PAPERS
Tekirdag, TURKIYE (4-8 October 2011) FIRST ANNOUNCEMENT AND CALL FOR PAPERS 8th Conference on the Conservation of Animal Genetic Resources SUSTAINABLE CONSERVATION OF LIVESTOCK BREEDS DIVERSITY FOR THE
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
POPGENE VERSION 1.31. Quick User Guide
POPGENE VERSION 1.31 Microsoft Window-based Freeware for Population Genetic Analysis Quick User Guide A joint Project Development by Francis C. Yeh and Rong-cai Yang, University of Alberta And Tim Boyle,
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Available study programs at Czech University of Life Sciences Prague
EU subject code University subject Name of course/program Mobility Language Homepage 1,1 1,1 Environmental Engineering in Agriculture II Rural Communication and Extension 1,1 Tropical Forestry and Agroforestry
Worksheet: The theory of natural selection
Worksheet: The theory of natural selection Senior Phase Grade 7-9 Learning area: Natural Science Strand: Life and living Theme: Biodiversity, change and continuity Specific Aim 1: Acquiring knowledge of
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Doğu Çamur Accepted: July 2010. ISSN : 1308-7231 [email protected] 2010 www.newwsa.com Karabuk-Turkey
ISSN:1306-3111 e-journal of New World Sciences Academy 2010, Volume: 5, Number: 3, Article Number: 2A0059 TECHNOLOGICAL APPLIED SCIENCES Ali Etem Gürel Received: January 2010 Doğu Çamur Accepted: July
INTRODUCTION. The identification system of dairy cattle; The recording of production of dairy cattle; Laboratory analysis; Data processing.
POLISH FEDERATION OF CATTLE BREEDERS AND DAIRY FARMERS INTRODUCTION Polish Federation of Cattle Breeders and Dairy Farmers was established in 1995 as a merger of 20 regional breeding organizations from
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Biodiversity Concepts
Biodiversity Concepts WHAT IS BIODIVERSITY? Biodiversity is the variety of life on Earth. For any kind of animal or plant each individual is not exactly the same as any other; nor are species or ecosystems.
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Cost-Benefit Analysis of Angora Goat Production in Turkey: The Cases of Konya and Karaman Provinces
Kafkas Univ Vet Fak Derg 16 (2): 251256, 2010 DOI:10.9775/kvfd.2009.643 RESEARCH ARTICLE CostBenefit Analysis of Angora Goat Production in Turkey: The Cases of Konya and Karaman Provinces Yusuf ÇELİK *
Forensic Science International: Genetics
Forensic Science International: Genetics 3 (2009) e111 e116 Contents lists available at ScienceDirect Forensic Science International: Genetics journal homepage: www.elsevier.com/locate/fsig Announcement
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING Theo Meuwissen Institute for Animal Science and Aquaculture, Box 5025, 1432 Ås, Norway, [email protected] Summary
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
AGE, EMPLOYMENT AND EDUCATIONAL REFORM: AN ALTERNATIVE VIEW OF UNEMPLOYMENT IN TURKEY
Ankara Üniversitesi SBF Dergisi, Cilt 66, No. 4, 2011, s. 21-31 AGE, EMPLOYMENT AND EDUCATIONAL REFORM: AN ALTERNATIVE VIEW OF UNEMPLOYMENT IN TURKEY Dr. Nevin Çavuşoğlu Philip Heap Dr. Robert Horn James
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing European Network of GMO Laboratories (ENGL)
Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing European Network of GMO Laboratories (ENGL) 13 October 2008 Date of application: 13 April 2009 INTRODUCTION The scope
The impact of genomic selection on North American dairy cattle breeding organizations
The impact of genomic selection on North American dairy cattle breeding organizations Jacques Chesnais, George Wiggans and Filippo Miglior The Semex Alliance, USDA and Canadian Dairy Network 2000 09 Genomic
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
A COMPARATIVE WIND POWER PLANT FEASIBILITY STUDY FOR GÖKÇEADA, TURKEY
Journal of Naval Science and Engineering 2009, Vol. 5, No.3, pp. 55-63 A COMPARATIVE WIND POWER PLANT FEASIBILITY STUDY FOR GÖKÇEADA, TURKEY Egemen SULUKAN Department of Professional Sciences, Turkish
(D) 181-183, 186-187, 190-193 TFYI 187 TPK 190
NEVADA Life Science Content Standards for Grade 8 Life s Structure and Function A From Bacteria to Plants B Animal Diversity C Human Body Systems D OBJECTIVES Content Standard 6.0: Structure and Function
AN APPLICATION OF THE DOLLAR AND GOLD PRICES IN TURKEY WITH MULTIVARIABLE SETAR MODEL
ÇOK DEĞİŞKENLİ SETAR MODELİ İLE TÜRKİYE DE DOLAR VE ALTIN FİYATLARINA DAİR BİR UYGULAMA Dr. Ümran M. KAHRAMAN Necmettin Erbakan Üniversitesi [email protected] Öznur AYDINER Kırklareli Üniversitesi [email protected]
Determination of Pomological Characteristics of Niksar District Pomegranates (Punica granatum L.) of the Tokat Province
Determination of Pomological Characteristics of Niksar District Pomegranates (Punica granatum L.) of the Tokat Province Y. Özkan Gaziosmanpaşa Univ., Fac. of Agric. Department of Horticulture 60240-Tokat/Turkey
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
Individualization of tiger by using microsatellites
Forensic Science International 151 (2005) 45 51 www.elsevier.com/locate/forsciint Individualization of tiger by using microsatellites Yan Chun Xu a,b, *,BoLi a, Wan Shui Li c, Su Ying Bai a, Yu Jin a,
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
SHEEP PRODUCTION AND MARKETING IN AĞRI PROVINCE
Scientific Bulletin Economic Sciences, Volume 14/ Special Issue ETAEc 2015 SHEEP PRODUCTION AND MARKETING IN AĞRI PROVINCE Esra KADANALI 1, Şekip YAZGAN 2, Vedat DAĞDEMİR 3 1 Ağri İbrahim Çeçen University,
