Stephen E. Mshana. Thesis for Doctoral degree (PhD) 2011

Size: px
Start display at page:

Download "Stephen E. Mshana. Thesis for Doctoral degree (PhD) 2011"

Transcription

1 Molecular Epidemiology of Extended-Spectrum Beta- Lactamases (ESBL) Producing Enterobacteriaceae from the Bugando Medical Centre, Mwanza, Tanzania and the University of Giessen Medical Hospital, Germany Stephen E. Mshana A Thesis Submitted in Fulfillment for the Requirement of the Award of Doctor of Philosophy (PhD) of the St. Augustine University of Tanzania 2011

2 Department of Microbiology/Immunology, Weill Bugando University College of Health Sciences a Constituent College of St Augustine University of Tanzania MOLECULAR EPIDEMIOLOGY OF EXTENDED-SPECTRUM BETA- LACTAMASES (ESBL) PRODUCING ENTEROBACTERICEAE FROM THE BUGANDO MEDICAL CENTRE, MWANZA, TANZANIA AND THE UNIVERSITY OF GIESSEN MEDICAL HOSPITAL, GERMANY Stephen Mshana 2011 ii

3 All previously published papers were reproduced with permission from the publisher. Published by Weill Bugando University College of Health and allied Sciences Stephen E. Mshana, 2011 ISBN Printed by Druckerei Nicolai Shiffernberger Weg 113, Giessen, Germany iii

4 MOLECULAR EPIDEMIOLOGY OF EXTENDED-SPECTRUM BETA- LACTAMASES (ESBL) PRODUCING ENTEROBACTERICEAE FROM THE BUGANDO MEDICAL CENTRE, MWANZA, TANZANIA AND THE UNIVERSITY OF GIESSEN MEDICAL HOSPITAL, GERMANY ACADEMIC THESIS Stephen E. Mshana Supervisors: Prof Trinad Chakraborty Professor/Director Institute of Medical Microbiology Giessen Germany Prof Eligius F Lyamuya Associate Professor/Deputy VC ARC Muhimbili University of Health Sciences Department of Microbiology/Immunology iv

5 DECLARATION AND COPYRIGHT I, Stephen E. Mshana hereby declare that the work presented in this thesis has not been presented to any other University for similar degree award. Signed.. Date.. This thesis is copyright material protected under the Berne Convention, the copyright Act 1999 and International and national enactment, in that behalf on intellectual property. It may not be reproduced by any means, in full or part, except for short extract in fair dealing, for research or private study, critical scholarly review or disclosure with acknowledgement, without written permission of the Directorate of Postgraduate Studies on behalf of both the author and St Augustine University of Tanzania (SAUT). v

6 TABLE OF CONTENTS DECLARATION AND COPYRIGHT...v TABLE OF CONTENTS...vi LIST OF FIGURES...ix LIST OF TABLES...x DEDICATION...xii ACKNOWLEDGEMENT...xiii ABSTRACT...xiv CHAPTER ONE INTRODCUTION BACKGROUND STATEMENT OF THE PROBLEM RATIONALE OF THE STUDY AIMS OF THE THESIS...23 CHAPTER TWO LITERATURE REVIEW Definition of ESBLs and classification ESBLs types Epidemiology of ESBL Detection of ESBL Plasmid incompatibility groups Escherichia coli and Klebsiella pneumonia Phylogenetic groups and ESBL Treatment options 34 CHAPTER THREE Material and methods Study area vi

7 3.2 Isolates Susceptibility testing Amplification of ESBLs genes and ISEcp1 element Sequencing Recombinant techniques Pulse-Field Gel Electrophoresis (PFGE) Phylogenetic analysis Multilocus sequence typing (MLST) Biofilm assay Data analysis Quality control Ethical consideration Limitations CHAPTER FOUR Results Escherichia coli from Giessen ESBL producing Isolates and Susceptibility Results Characterization of isolates using PFGE and Phylogenetic grouping Plasmid analysis and replicon typing ISEcp1 and Cloning results Klebsiella pneumoniae isolates from Giessen, Germany Isolates, ESBL alleles and susceptibility results Location of bla CTX-M Escherichia coli isolates from Bugando Medical Centre Genetic relatedness Location and transferability of ESBL genes : Klebsiella pneumoniae isolates from Bugando Medical Centre Bacterial isolates and susceptibility pattern vii

8 4.4.2 ESBL alleles Genetic relatedness Location of ESBL genes Enterobacter spp from Bugando Medical Centre Comparison of Molecular Epidemiology of ESBL producing isolates between BMC and IMMG CHAPTER IVE Discussion Isolates, ESBL alleles and Susceptibility results Genetic relatedness of the isolates Location of ESBL alleles Conclusion and recommendation REFERENCES 89 viii

9 LIST OF FIGURES Figure 1: Disk Approximation method Figure 2: Illustration for CTX-M-15 and ISEcp1 and 2.7kb plasmid Figure 3: Dichotomous decision tree to determine the phylogenetic group of an Escherichia coli strain by using the results of PCR amplification of the chua and yjaa genes and DNA fragment TSPE4.C Figure 4: Agarose gel showing chua, yjaa and TSPE.C2 DNA fragments. 46 Figure 5: PFGE dendrogram of ESBL-producing Escherichia coli as evaluated by Dice and UPGMA analysis Figure 6: Agarose gel showing S1 nuclease PFGE-based sizing of plasmids for 5 isolates Figure 7: LB plate showing Large (L) and small (S) colonies Figure 8: Agarose gel electrophoresis of products obtained by PCR from 3 large colonies and 3 small colonies Figure 9: Dendogram (UPGMA, DICE) showing the similarity for 24 Klebsiella pneumoniae ESBL Producers Figure 10: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates Figure 11: PFGE dendrogram of CTX-M-15 producing Escherichia coli Figure 12: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates Figure 13: PFGE dendrogram of ESBL producing Klebsiella pneumoniae 68 Figure 14: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates Figure 15: PFGE dendrogram rooted from XbaI digested Enterobacter cloacae strain 263 of Figure 16: Neighbor joining tree of Enterobacter spp based on 16SrRNA DNA sequences in relation to the strain 247 BMC ix

10 LIST OF TABLES Table 1: Modified Bush Jacoby Medeiros Classification of β-lactamases. 25 Table 2: Example of Biochemical tests which were used to identify enterobacteriaceae Table 3: Primers used for amplification and sequence of ESBL genes and IS element Table 4: Interpretation of phylogenetic groups of Klebsiella pneumoniae Table 5: Characteristics of Klebsiella pneumoniae isolates Table 6: Characteristics of Escherichia coli selected as donors from different Table 7: Representative strains of Klebsiella pneumoniae Table 8: Demographics and clinical characteristics of neonates infected with Enterobacter spp nov Table 9: Biochemical properties and percentage homology of genetic markers between strain 247BMC and other closely related Enterobacter spp Table 10: Comparison of Escherichia coli ESBL producing isolates from Giessen and that from Bugando medical Centre Table 11: Comparison of Klebsiella pneumoniae ESBL producing isolates from Giessen and that from Bugando medical Centre x

11 LIST OF ABBREVIATIONS BMC: Bla: CLSI: DAAD: DNA: ESBL: MIC: MLST: NCCLS: PCR: PFGE: RNA: SHV: TEM: WBUCHS: WHO: Bugando Medical Centre Beta-lactamase gene Clinical and Laboratory Standards Institute (formerly NCCLS) Deutscher Akademischer Austausch Dienst Deoxyribonucleic acid Extended-spectrum beta-lactamase Minimum inhibitory concentration Multilocus sequence typing National Committee for Clinical Laboratory Standards (Now CLSI) Polymerase chain reaction Pulsed Field Gel Electrophoresis Ribonucleic acid Sulfhydryl Variable Temoniera Weill Bugando University College of Health Sciences World Health Organization xi

12 DEDICATION This thesis is dedicated to good health of all neonates at Bugando Medical Centre xii

13 ACKNOWLEDGEMENT I am grateful to the patients who participated in the studies. The work has been supported financially or otherwise by WBUCHS, Institute of Medical Microbiology Giessen and DAAD Prof Trinad Chakraborty, Dr Can Imirzalioglu, Prof Eligius Lyamuya and Prof Eugen Doman have supervised my work in the most qualified, inspiring, supportive and patient way possible. They have facilitated every aspect of my work and always have been available for discussion, whether in person or via . I sincerely thank my colleagues in Tanzania Dr Erasmus Kamugisha, Dr Mange Manyama, Dr Benson Kidenya, Dr Mariam Mirambo and Dr Peter Rambau for their technical support. Also I would like to acknowledge the technical support provided by the members of the Department of Microbiology/Immunology of WBUCHS and Institute of Medical Microbiology Giessen. I thank Mary Louise Shushu, Claudia Neumann, Hezron Bassu, Alpha Boniface, Isabell Trur, Kirsten Bommersheim and Alexandra Amend-Foerster for their excellent technical assistance. Last, but not least, I thank my wife Neema Mshana my daughter Patricia Stephen and my parents (Sarah Mchami and Eliatosha Mshana), who have supported me wholeheartedly through this process, without them I would not have accomplished this work. xiii

14 ABSTRACT Antimicrobial resistance is fast becoming a global concern with rapid increases in multi-drug-resistant Gram negative bacteria. The prevalence of extended spectrumbeta lactamase (ESBL)-producing clinical isolates increases the burden of implementing infectious disease management globally especially in developing countries. Escherichia coli and Klebsiella pneumoniae producing ESBLs are a major problem in hospitals worldwide, causing hospital and community acquired infections. They are usually resistant to multiple common antibiotics thus limiting treatment options. This thesis presents work done on the molecular epidemiology of ESBL producing isolates from a tertiary Hospital in Tanzania and compared it with that of a University Hospital in Giessen, Germany. Characterization was done on a total of non-repetitive 64 Escherichia coli and 24 Klebsiella pneumoniae isolates from Germany and a total 32 Escherichia coli and 92 non-repetitive Klebsiella pneumoniae as well as 18 strains comprising a novel Enterobacter spp from Tanzania. All isolates were from clinical specimens including urine, wound swab, pus and blood. Identification and phenotypic analysis was done using in-house biochemical assays, API 20E, VITEK and wherever necessary 16s rdna was used for taxonomic determination. Antimicrobial susceptibility testing of the isolates was performed using disc diffusion method and occasionally by the E-test. Genotyping of ESBL alleles, phylogenetic grouping using species-specific primers, and plasmid incompatibility group typing were determined using specific oligonucleotide primers following by amplification using xiv

15 the polymerase-chain reaction (PCR). Multilocus sequence-typing (MLST) by DNA sequencing and pulsed-field gel electrophoresis (PFGE) were used to determine clonality of the isolates. Location of ESBL alleles in the respective strains was identified using transformation, conjugation techniques and subsequently confirmed by southern blot hybridization using bla CTX-M-15 specific probes. Escherichia coli formed the majority of ESBL-producing isolates from Giessen University Hospital (56%), while at Bugando Medical Centre most of ESBL producing isolates were Klebsiella pneumoniae (69%). Thirty two Escherichia coli from Bugando Medical Centre formed 22 PFGE clusters while only 6 PFGE clusters were seen among 63 Escherichia coli from Giessen University hospital (p=0.0011). Also Multiple ST clones were observed in isolates from Bugando Medical Centre. The bla CTX-M-15 allele, encoding an extended spectrum ß-lactamase, was found to be predominant allele in these two hospitals, in Escherichia coli this allele was carried in multiple conjugative IncF plasmids. In Klebsiella pneumoniae the bla CTX-M-15 was found in the chromosomal location in isolates from Germany while the allele in Klebsiella pneumonia isolates from Bugando Medical Centre was found in multiple conjugative plasmids with size ranging from 25kb to 483kb. As with Escherichia coli a high diversity of Klebsiella pneumoniae isolates from Bugando Medical Centre was observed. In conclusion, high prevalence of ESBL producing Escherichia coli and Klebsiella pneumoniae was observed in a tertiary hospital in Tanzania. The bla CTX-M-15 was predominant allele in Giessen and at Bugando Medical Centre Mwanza, K. xv

16 pneumoniae harboring bla CTX-M-15 is a common nosocomial pathogen in a tertiary hospital in Tanzania and the gene is carried in multiple conjugative plasmids. There is significant variation of molecular epidemiology of ESBL isolates in these two hospitals. More work should be done globally especially in developing countries in the diagnosis and surveillance of ESBL producing isolates. xvi

17 LIST OF PUBLICATIONS I. Mshana SE., Kamugisha E, Mirambo M, Chakraborty T, and Lyamuya E. Prevalence of multiresistant Gram-negative organisms in a tertiary hospital in Mwanza, Tanzania. BMC Research Notes 2009, 2:49 II. Mshana, SE, Imirzalioglu C, Hossain H, Hain T, Domann E, Chakraborty T. Conjugative IncFI plasmids Carrying CTX-M-15 among Escherichia coli ESBL producing isolates at a University hospital in Germany. BMC Infectious Diseases 2009, 9:97 (Highly accessed) III. Kayange N, Kamugisha E, Jeremiah S, Mwizamholya DL and Mshana SE. Predictors of positive blood culture and deaths among neonates with suspected neonatal sepsis in a tertiary hospital, Mwanza- Tanzania. BMC Pediatrics 2010, 10:39 (Highly accessed). IV. Mshana SE, Imirzalioglu C, Hain T, Domann E, Lyamuya EF, Chakraborty T. Multiple ST clonal complexes, with a predominance of ST131, of Escherichia coli harbouring bla CTX-M-15 in a tertiary hospital in Tanzania. Clinical Microbiology and Infection 2011, DOI: /j x V. Mshana SE,, Gerwing L, Minde M, Hain T, Domann E, Lyamuya EF and Chakraborty T, Imirzalioglu C. Outbreak of a novel Enterobacter spp carrying bla CTX-M-15 in a neonatal unit of a tertiary Hospital Tanzania. International Journal of Antimicrobial and Chemotherapy 2011, 38 (3), VI. Mshana SE, Torsten Hain, Eugen Domann, Eligius F Lyamuya, Trinad Chakraborty and Can Imirzalioglu. Predominance of Klebsiella pneumoniae ST14carrying CTX-M-15 causing neonatal sepsis in Tanzania. BMC Infectious Diseases 2013, 13:466(Highly accessed). xvii

18 1.0 INTRODCUTION 1.1 BACKGROUND CHAPTER ONE Emergence of resistance to β-lactam antibiotics began even before the first β- lactam, penicillin was developed. The first β-lactamase was identified in Escherichia coli prior to the release of penicillin for use in medical practice [1]. Most of gram-negatives bacteria possess naturally occurring chromosomally mediated β-lactamases; due to the selective pressure exerted by β-lactam producing soil organisms found in the environment [2]. The first plasmid mediated β- lactamase was discovered in 1965 in Escherichia coli isolated from a patient named Temoniera in Greece hence designated TEM [3]. Its presence on various plasmids and its association with a transposon has facilitated the spread of TEM-1 to other bacteria within a few years after its isolation. Indeed TEM-1 has spread worldwide and is now found among different species of the family Enterobacteriaceae [4]. Another common plasmid mediated β-lactamase found in Klebsiella spp and Escherichia coli is SHV-1(named after the Sulfhydryl-variable active site). The first report of plasmid encoded β-lactamase capable of hydrolyzing the extended spectrum cephalosporins was published in 1983 [5]. A Klebsiella ozaenae isolate from Germany passed a β-lactamase SHV-2 which efficiently hydrolyzed cefotaxime and to a lesser extent ceftazidime [5]. Recently another type of ESBL (CTX-M) has been described, these enzymes preferentially hydrolyze cefotaxime over ceftazidime and they also hydrolyze cefepime with high efficiency [6, 7]. 18

19 Today over 100 CTX-M ESBL types have been describe, these ESBLs have been found worldwide in many different genera of the family Enterobacteriaceae and Pseudomonas aeruginosa [7]. In clinical strains, CTX-M-encoding genes have commonly been located on plasmids that vary in size from 7kb-260kb [7-11]. Few studies which have done replicons types of these plasmids have established that majority of these plasmids are IncFII plasmids, either alone or in association with Inc FIA and FIB [8, 9]. One study had reported the presence of IncFI alone in one isolate in Turkey [10]. Other Inc groups like IncI1, IncN have been reported [8]. Most of these plasmids are conjugative with conjugation frequency ranges from and they have been found to have multiple resistant genes [11]. Recently, the intercontinental emergence of the ciprofloxacin-resistant E. coli O25:H4 ST-131 clonal group producing bla CTX-M-15 and characterized by an extensive virulence profile has been described in the hospital and community settings of several countries including France, Portugal, Canada, Korea, Spain, Lebanon, and Switzerland, Russia, Hungary, Austria and Germany [12, 13]. Because of its wide distribution, the O25:H4 ST-131 clonal group represents a highly epidemic group that is able to acquire different mechanisms of resistance, sometimes including ESBL production [12]. Extensive studies investigating the association of the Multilocus sequence typing (MLST) clonal complex ST131 and bla CTX-M-15 have been done in developed countries, while very few studies have been done in developing countries [12, 13]. Worldwide dissemination of bla CTX-M-15 19

20 seems to be linked to this clonal complex which is a member of the phylogenetic group B2 and characterized by co-resistance to several classes of antibiotics e.g. aminoglycosides, quinolones, co-trimoxazole (SXT) and tetracycline [12, 13]. This study was done to characterize ESBLs isolates from Bugando Medical Center and Institute of Medical Microbiology Giessen and compare the ESBLs allele, plasmids incompatibility (Inc) groups and PFGE clones of the isolates. The predominance of bla CTX-M-15 in these two institutions associated with conjugative IncF plasmids of variable sizes 25kb-291kb is reported in this thesis. It also reports the extensive heterogeneity of Escherichia coli and Klebsiella pneumoniae carrying bla CTX-M-15 from Tanzania and we report here for the first time the presence of Escherichia coli ST131 in Tanzania and identify a novel Enterobacter spp carrying bla CTX-M-15 that is associated with outbreaks in pediatric wards STATEMENT OF THE PROBLEM Antimicrobial resistance is fast becoming a global concern with rapid increases in multidrug resistant organisms. The prevalence of ESBL producing clinical isolates is more than 20% in Asia and South Africa [7, 14]. In Muhimbili Tanzania more than 80% of isolates are resistant to ampicillin and 25% of Escherichia coli isolates were ESBL producers [15] and recently in Muhimbili more than 45% of Escherichia coli and Klebsiella pneumoniae have been found to produce ESBL [16]. In Giessen Germany, the Escherichia coli ESBL producing isolates are on the increase, most of them are resistant to multiple antibiotics. In Giessen, there was more than 2 fold increase of Klebsiella pneumoniae ESBL producing isolates in 20

21 2007 when compared to 2006 from 4.5% to 11.6% [Unpublished]. CTX-M ESBL types have been reported in Germany and Tanzania, CTX-M type has been found to be associated with multiple resistant genes [7, 15]. Antimicrobial agents are the most important tools available for managing infectious diseases. Some of the ESBL producing isolates are untreatable so prevention will be crucial in controlling infection with these resistant organisms. Therefore it is essential to address this issue as a cornerstone to prevent the emergence of multiresistant organisms. This study aims at characterizing ESBL-producing isolates in two distinct geographical locations, located 8000km apart, viz., in Giessen Germany and Mwanza, Tanzania. It addresses their emergence and compares the molecular epidemiology between these institutions. 1.3 RATIONALE OF THE STUDY In developed countries the use of antibiotics is strictly controlled, this is not the case in a developing country like Tanzania. There is limited information on molecular epidemiology of ESBL isolates in Tanzania. Inappropriate use of antibiotics is rampant in several places in Tanzania, a situation that provides a conducive ground for the outbreak of resistant organisms. The treatment of bacterial infection at BMC is largely empirical with no laboratory results in most instances to guide therapy. There is no data on common gram negatives isolates and their susceptibility pattern from different units and there is also no data on ESBL among common isolates like Escherichia coli, Klebsiella pneumoniae, Enterobacter spp etc. Treatment option for ESBL isolates is expensive and is often at times not available in resource-limited 21

22 settings like Tanzania. Controlling the spread and occurrence of these isolates is therefore very important. This study was undertaken to estimate the magnitude of ESBL in Bugando Medical Centre and compare its molecular epidemiology to that of Giessen University Hospital. Information obtained from this study will contribute towards developing evidence-informed policy on rational use of antimicrobial agents, control and prevention of emergence of multidrug resistant microbial strains in Tanzania. 22

23 1.4 AIMS OF THE THESIS 1. To determine the distribution of ESBL isolates in different patient care units at Bugando Medical Centre (BMC) and Institute of Medical Microbiology Giessen 2. To determine the prevalence of ESBL alleles among ESBL isolates from both institutions. 3. To ascertain molecular epidemiology of ESBL isolates using plasmid analysis, phylogenetic groups, PFGE and MLST. 4. To compare the molecular epidemiology of ESBL isolates from Bugando Medical centre and those from Giessen University Hospital. 23

24 2.0 LITERATURE REVIEW CHAPTER TWO 2.1 Definition of ESBLs and classification There is no consensus regarding the precise definition of ESBLs; a commonly used working definition is that ESBLs are β-lactamases capable of conferring bacterial resistance to penicillin, first, second and third generation cephalosporins and aztreonam (but not the cephamycins or carbepenems) by hydrolyzing these antibiotics and which are inhibited by β-lactamase inhibitors such as clavulanic acid [18, 19]. These enzymes can be classified according to two general schemes; the Ambler molecular classification scheme and the Bush-Jacoby-Medeiros functional classification system [18]. The Ambler schemes divides β-lactamases into four major classes (A to D). The basis of this classification scheme rests upon protein homology and not phenotypic characteristics. Class A, C and D are serine β- lactamase and class B is metallo- β-lactamases [18, 19]. The Bush-Jacoby Medeiros scheme groups these enzymes according to functional similarity (substrate and inhibitor profile). This classification scheme is of more relevance to physicians or microbiologists in diagnostic laboratory because it considers β-lactamase inhibitor and β-lactam substrates that are clinically relevant (Table 1). 24

25 Table 1: Modified Bush Jacoby Medeiros Classification of β-lactamases [18] Functional group Substrate profile Molecular Class Inhibitor Example 1 Cephalosporinase C OXA AmpC,MIR-1 2a Penicillinase A Clav S.aureus 2b Broad spectrum A Clav Tem-1/2,SHV-1 2be Extended A Clav Tem-3-29,Tem- 46,Tem 104, SHV 2-28, CTX-M types 2br Inhibitor resistant A - Tem-30-41(IR 1-12) 2c Carbenicillinase A AER-1 ( C), CARB-3 2d Oxacillinase D Clav PSE-1 2e Cephalosporinase A Clav OXA-1, OXA-2,10 2f Carbepenemase Clav IPM-1,NmcA, Smc1-3 3 Metalloenzymes A - S. maltophilia 4 Penicillinase B B. cepacia (c) 2.2 ESBLs types TEM: The TEM type ESBLs are derivatives of TEM-1 and TEM-2. TEM -1 was first reported in 1965 from the patient named Temoniera hence the designation TEM [4]. It is the most commonly encountered β-lactamase among gram negative bacteria [19]. TEM-1 which is not an ESBL can hydrolyze ampicillin at greater extent than oxacillin, carbenicillin or cephalothin and cannot hydrolyze extended spectrum cephalosporins such as ceftriaxone, cefotaxime, ceftazidime etc [4]. It is inhibited by clavulanic acid. TEM-2 has the same hydrolytic profile as TEM-1, but 25

26 it has more active native promoter and different isoelectric point of 5.6 compared to 5.4 of TEM-1 [20]. TEM-13 has a similar hydrolytic profile as TEM-1 and TEM-2. TEM-1, 2 and 13 are not Extended Spectrum Beta-Lactamases. Currently over 100 TEM-type β-lactamases have been described of which most of them are ESBLs ( Their isoelectric points range from 5.2 to 6.5 [20, 21]. In Tanzania TEM- ESBL type has been reported [15]. SHV: SHV refers to Sulfhydryl variable. The SHV types, used to be more frequently found in clinical isolates than any other type of ESBL. The first SHV that hydrolyze extended spectrum β-lactam antibiotics was isolated from Klebsiella ozaenae in 1983 in Germany [5]. This enzyme was found to differ with parent enzyme SHV-1 by replacement of glycine with serine at 238 th position and it was designated SHV-2. SHV types of ESBLs have been detected in a wide range of enterobacteriaceae and outbreaks of SHV producing Pseudomonas spp and Acinetobacter spp have been reported [22]. Unlike TEM-type β-lactamases, there are few derivatives of SHV-1; more than 50 SHV varieties have been described worldwide [23]. SHV ESBL alleles have been reported in Tanzania and Germany. CTX-M: CTX-M is a recently described family of ESBLs; these enzymes hydrolyze cefotaxime more than ceftazidime and they also hydrolyze cefepime with high efficiency [24, 25]. Tazobactam exhibits a better inhibitory effect towards CTX-M than sulbactam and clavulanate [26]. Genes for these enzymes are located on the plasmids generally ranging from 7-260kb of size [7]. Plasmids have acquired these genes from chromosomes of Kluyvera spp [27]. CTX-M type has been 26

27 reported in most parts of the world, and it is believed that it might be the most frequent type of ESBLs in the world [7]. More than 113 CTX-M varieties are currently known [ The bla CTX-M-15 allele is considered to be predominant in many countries and it has also been reported in Tanzania and Germany [7, 15]. We here report this allele from isolates in Giessen University Hospital and those from Bugando Medical Centre. OXA- Beta lactamases: The OXA- β-lactamases are so named because of their oxacillin hydrolyzing abilities. These β-lactamases are characterized by their ability to hydrolyze cloxacillin and oxacillin 50% more than benzyl penicillin [28, 29]. They predominantly occur in Pseudomonas spp, but have been detected in many other gram negative bacteria [28]. Most of OXA-type β-lactamases do not hydrolyze extended spectrum cephalosporins to a significant degree, they are not ESBLs. OXA-10 weakly hydrolyze cefotaxime, ceftriaxone and aztreonam. Other OXA ESBLs derived from OXA-10 includes OXA-14, 16, 15, 18, 19, 28, 31, 32, and 45 [28, 29]. Other ESBLs types include PER1-2, VEB-1-2, GES, SFO and IBC. PER type ESBL share only 25 to 27% homology with known TEM and SHV type ESBLs. This enzyme was first detected in pseudomonas and later in salmonella and acinetobacter [30]. VEB-1 has greatest homology (38%) with PER-1 and PER-2 [31]. It has higher level resistance to ceftazidime, cefotaxime and aztreonam, which is reversed by clavulanic acid. This enzyme is plasmid mediated; it was first isolated from a Vietnamese child hospitalized in France [31, 32]. Other VEB 27

28 enzymes have been described in Kuwait and China [33, 34]. GES, SFO and IBC are examples of non-tem, non SHV ESBLs and have been found in a wide range of geographical locations [35, 36]. 2.3 Epidemiology of ESBL ESBL epidemiology should be considered at different levels, namely the level of single patient, of a single medical institution and a wider geographical scale. Each of these levels, it depends on evolutionary phenomenon that occurs in ESBL producing strains [36]. Interspecies dissemination of an ESBL gene carrying plasmids in multi-bacterial infection/colonization cases has been reported [7, 11, 14]. ESBLs have been found in wide range of gram negative rods, with the majority of strains harbouring these enzymes belonging to the family of enterobacteriaceae. Escherichia coli and Klebsiella pneumoniae are important ESBL producing organisms in the enterobacteriaceae family [37, 38]. Non-enterobacteriaceae ESBL producers are rare, with Pseudomonas aeruginosa being the most important. ESBL producers are usually selected in hospitals, although outbreaks have been reported in nursing home facilities [37]. The distribution of ESBL isolates in the hospitals is common in the wards where patients have a higher risk for infections such as ICU, surgical wards, neonatal wards, chronic care facilities etc [39]. In these units outbreaks are common, and most outbreaks are attributed to plasmid transfer or clonal spread [40]. In some studies ESBL coding genes have been identified in multiple plasmids present in bacterial strains and ESBL genes are usually located in 28

29 transposon or integrons which strongly facilitate horizontal transfer of these genes [7, 41]. ESBL producing isolates are currently a major problem in hospitalized patients worldwide [41, 42, 43, 44]. The prevalence of ESBLs among clinical isolates varies between countries and from institution to institution. In the USA the prevalence among Enterobacteriaceae ranges from 0-25% depending on the institution with national average being 3% ( For Germany, Austria and Switzerland a multi-center study of the Paul Ehrlich Society in 2001 detected ESBL rate of 0.8 for Escherichia coli and 8.2% for K. pneumoniae. In Germany, the study involving the GENARS hospital network in 2004 found 1.7% and 7.1% for Escherichia coli and Klebsiella pneumoniae, respectively [38]. For southern European countries ESBL rates of more than 50% have been reported. In Japan the survey which involved 196 institutions found <0.1% for Escherichia coli and < 0.3% for Klebsiella pneumoniae [44]. In some countries in Asia the prevalence ranges 4.8%-12% in Escherichia coli and Klebsiella pneumoniae [14]. In Africa the prevalence of ESBL isolates among enterobacteriaceae varies in different regions, in South Africa during the period the prevalence of confirmed ESBL among clinical isolates was 28.1% [6, 14, 44]. In Nigeria different ESBL alleles have been reported, these include TEM, SHV and CTX-M [42]. In Tanzania the prevalence of ESBL is more than 25% among Escherichia coli, and TEM, SHV and CTX-M alleles have been reported [15, 16 43]. However there is limited data on plasmids and phylogenetic groups and ST of Escherichia coli and K. 29

30 pneumoniae [7, 12, 44]. In this thesis extensive description is done on ESBL regarding plasmids, ST and phylogenetic analysis. Specific ESBL allele can be predominant in a certain country or region. For example TEM-10 has been responsible for several outbreaks in USA [36]; TEM-3 is common in France but has not been detected in USA. The bla CTX-M-15 has spread all over the country in Lebanon in both hospital and in the community acquired ESBL enterobacteriaceae [7, 44, 45]. Recently bla CTX-M-15 has been reported to be predominant in many countries such as UK, Poland, Italy, Spain, Lebanon and others [7, 18, 24, 25, 45]. 2.4 Detection of ESBL Several methods have been used to screen and confirm the presence of Extended Spectrum β Lactamase [46]. These methods can differ between countries and Clinical Microbiology Laboratories. The Clinical Laboratory and Standard Institute (CLSI) proposed disk diffusion methods for screening ESBL producing Escherichia coli, Klebsiella pneumoniae and Proteus mirabilis [47]. Cefpodoxime, ceftazidime, aztreonam, cefotaxime or ceftriaxone can be used, the use of more than one of these discs increase sensitivity of detection [46]. With any zone of diameter that may indicate suspicion of ESBL production, phenotypic confirmation should be done [47, 48]. Cefpodoxime 10µg has been found to be more sensitive than other cephalosporins for screening ESBL production, CLSI recommends, the isolate with zone diameter 17mm should be confirmed for ESBL production [47]. In broth dilution tests a MIC of 2µg/ml for cefpodoxime, ceftazidime, cefotaxime and 30

31 aztreonam is an indication for phenotypic confirmation of ESBL production and warrants phenotypic confirmation [47]. Disk Approximation method (Double disc synergy): This is simple and reliable method for detection of ESBL production. The disc that contains oxyimino β lactam (30µg) is placed 30mm apart (center - centre) from amoxicillin- clavulanate disk (20/10µg) clear extension of the edge of the inhibition zone towards amoxicillinclavulanate disk is interpreted as positive ESBL production (Figure 1). The sensitivity of the test can be increased by reducing the distance to 20mm [46, 47]. Three dimensional tests can also be used to confirm ESBL production [49]. In this method the standard inoculum of test organisms is inoculated on Muller Hinton agar plate, a slit is cut on agar plate in which a broth suspension of test organism is placed; antibiotic disc is placed 3-4mm from the slit [49]. Distortion of circular inhibition zone is interpreted as positive ESBL production. This method is very sensitive in detecting ESBL production, but is more labor intensive than other methods. AMC CRO CAZ Figure 1: Disk Approximation method. AMC, Amoxicillin clavulanic acid; CAZ ceftazidime; CRO, ceftriaxone 31

32 Combine disk test (Inhibitor potentiated disk test): Cephalosporins disks (cefotaxime 30µg, ceftazidime 30 µg, Cefpodoxime 30µg) with and without 10µg clavulanic acid are placed on Muller Hinton agar inoculated with test organisms [50]. An increase in the inhibition zone diameter of 5mm in cephalosporins disk combined with clavulanic acid, compared to cephalosporins alone, indicates ESBL production. MIC reduction test can also be used; an 8 fold reduction in the MIC of cephalosporin in presence of clavulanic acid, using E Test or broth micro/macro dilution indicates ESBL production [46-48, 51]. There is commercially available E tests for ESBL detection; one side contains a gradient of cephalosporin (MIC µg/ml) and other side the same gradient with a constant concentration of 4µg/ml clavulanic acid [46]. BD Phoenix Automated Microbiology system: The phoenix ESBL test uses the growth response to cefpodoxime, ceftazidime and cefotaxime to detect ESBL production [48, 51]. VITEK ESBL Cards: Wells containing cards are inoculated, the reduction in growth of cephalosporins well contains clavulanic acid; when compared to with level of growth in well with cephalosporin alone indicates presence of ESBL production [51]. Molecular detection methods: These include DNA probes, PCR, oligotyping, PCR-RFLPs and nucleotide sequencing. Molecular methods can detect different variants of ESBL but they can be labor intensive and expensive to be adopted as routine methods [7, 11, 20, 51]. 32

33 2.6 Plasmid incompatibility groups Most of ESBL genes are plasmid mediated and few studies which have done a characterization of their replicons using PCR based replicon typing have found that the majority of these plasmids to be IncFII plasmids, either alone or in association with Inc FIA and FIB [8, 9]. One study reported the presence of Inc FI alone in one isolate in Turkey [10]. Other Inc groups like IncI1, IncN, and IncP have been reported [9]. In this thesis we confirm association of IncF plasmids and bla CTX-M-15, also we report association of Inc FI alone and bla CTX-M-15 in 63 Escherichia coli isolates from Giessen, Germany 2.7 Escherichia coli and Klebsiella pneumonia Phylogenetic groups and ESBL Population genetics analyses and determination of the phylogenetic relationships between strains have proven to be extremely useful approaches to obtain insight into the epidemiological pattern of bacterial species and the evolution of pathogenicity [52, 53]. Phylogenetic analyses have grouped Escherichia coli strains into four main phylogenetic groups (A, B1, B2 and D) [52]. Virulent extraintestinal strains belong mainly to group B2 and to a lesser extent to group D whereas most commensals strains belong to group A. Studies have found most of the ESBL producing E. coli belong to group B2 [53]. Commensals Escherichia coli (group A) have also been found to produce ESBL [54]. Klebsiella pneumoniae isolates fall into three phylogenetic groups named KpI, KpII and KpIII. KpI comprises the majority of Klebsiella pneumoniae isolates; in Brisse et al [55] more 33

34 than 80.3% of isolates were KpI. In the few studies that determine phylogenetic groups among Klebsiella pneumoniae ESBL isolates found that most of ESBL isolates belonged to KpI; also they demonstrated an association between bla CTX-M-10 and KpIII [55]. Multi-locus sequence typing (MSLT) also has been used to trace the epidemiology of the ESBL producing isolates, and in contrast to pulsed field gel electrophoresis (PFGE) this provides interlaboratory and comparison in different countries [56, 57, 58]. Extensive studies have been done in developed countries among Escherichia coli ESBL producing isolates [12, 13, 58]. Using this method the rapid and international spread of bla CTX-M-15 has been mainly associated with the global dissemination of Escherichia coli clonal strain ST-131 O25:H4 and ST-405 [12, 13, 58]. 2.8 Treatment options Most of the ESBL isolates harbour the plasmids which confer co-resistance to aminoglycosides and co-trimoxazole (SXT) [59]. Also there is strong association between ESBL production and resistance to quinolones [7, 59, 60]. Klebsiella pneumoniae ESBL isolates have been found to be deficient in porins and showed active efflux of quinolones also some of the plasmids carrying bla CTX-M genes harbor genes for quinolones resistance and most of the bla CTX-M ESBL types hydrolyze 4 th generation cephalosporins [61]. 34

35 Quinolones can be used as treatment of choice in urinary tract infection, if there is no in vitro resistance [60]. Carbepenems should be regarded as treatment of choice for ESBL producing organisms as ESBL- producing strains are uniformly sensitive to carbepenems and also there is a base of clinical experience [59, 60]. Few studies have reported the use of tigecycline [62]. In the present thesis the majority of ESBL producing isolates were multiply resistant to gentamicin, SXT, tetracycline and ciprofloxacin; they were all sensitive to carbepenems and all isolates from Giessen Germany were sensitive to tigecycline. 35

36 CHAPTER THREE 3.0 Material and Methods 3.1 Study area The isolates analyzed in this study were from Bugando Medical Centre (BMC) which has bed capacity of 800 and the Institute of Medical Microbiology Giessen (IMMG). BMC is a referral hospital and serves as University teaching hospital for Weill Bugando Medical College. The Institute of Medical Microbiology Giessen handles all specimens for microbiological examination from Giessen University Hospital which has bed capacity of more than Isolates A total of 116 ESBL isolates from Giessen University hospital were analyzed. The majority of these included Escherichia coli 66 (57%), Klebsiella pneumoniae 24 (20.6%), Enterobacter cloacae 8 (6%) and others 18 (15%) (Enterobacter gergoviae, Citrobacter freundii, Proteus mirabilis, Sternotrophomonas maltophilia). From BMC more than 1000 routine clinical specimens were processed and 133 ESBL producing isolates were analyzed of which 92(69%) were Klebsiella pneumoniae, 32(18%) Escherichia coli and 17 (13%) Enterobacter spp. Pure cultures of clinical isolates were identified using a set of in-house biochemical tests (Table 2). Isolates exhibiting ambiguous taxonomic classification were retested with API 20E (BioMerieux, France), VITEK (BioMerieux, France) and Phoenix- NMIC/ID-64 (Becton Dickson) following the manufacturer s instructions. In few cases 16S-rDNA studies were done using primers described previously [63]. In 36

37 isolates from Giessen polymicrobial infections occurred in three cases of UTI; the first case with significant count of both Escherichia coli and Enterobacter cloacae, the second with Escherichia coli and Enterobacter gergoviae and the third with Klebsiella pneumoniae in the urine sample and Escherichia coli in the blood culture. Table 2: Example of Biochemical tests which were used to identify enterobacteriaceae [46] Species Lac KIA ORN LYS IND Ure CIT MOT Glucose Rhamnose K.pneumoniae + I K. oxytoca + I Escherichia coli + d I or II d Ent. aerogenes +d I or II Ent cloacae + d I or II w Citr diversus +d I or II Serr marcescens - II d w + 10% - Serr liqufaciens - II + D % - Hafnia alvei - II Prov rettgeri - II w Prov stuartii - II Morg. morganii - II w - d - Prot mirabilis - III s d Prot vulgaris - III s - + d - Salmonella - III d Citro freundii + III I= Yellow/Yellow, II= Red/ Yellow, III= Black coloration due to H 2 S, D = Differential, W= few give positive results, Lact=Lactose, KIA=Kligler Iron Agar, 37

38 ORN=Ornithine decarboxylase, LYS=Lysine decarboxylase, IND=Indole, CIT=Citrate 3.3 Susceptibility testing Routine susceptibility was determined using the disk diffusion method on Mueller- Hinton agar (Thermofisher, UK) as recommended by the Clinical and Laboratory Standard Institute (CLSI) [47]. Susceptibility was tested against ampicillin (10 µg), amoxycillin/clavunate (20/10µg), ampicillin/sulbactam (10/10µg), tetracycline (30 µg), gentamicin (10 µg), tobramycin (10 µg), SXT (1.25/23.75 µg), ciprofloxacin (5 µg), moxifloxacin (5 µg), 20 cefpodoxime (10 µg), ceftazidime (30 µg), cefepime (30 µg), imipenem (10 µg) and meropenem (10 µg) (BD BBL, USA). All isolates resistant to multiple cephalosporins were confirmed for ESBL production using double disk synergy (Disk approximation method Figure 1). Bacterial colonies were resuspended in saline to a turbidity of 0.5 McFarland standards and inoculated on a Muller Hinton agar plate. Disks containing ceftazidime (30 µg) and cefotaxime (30 µg) were placed 20 mm center to center to the amoxycillin/clavunate (20/10µg) disk. The plates were incubated at 37 C for 18-20h. An enhanced zone of inhibition towards the amoxycillin/clavunate (20/10 µg) disk indicated positive ESBL production [46, 47, 64]. The MIC for cefepime and tigecycline were determined using E tests ranging µg /ml (AB Biodisk, Solna, Sweden) according to the manufacturer s instructions and the Clinical Laboratory and Standard Institute (CLSI). Bacteria were cultured on LB agar plate (BD BBL, USA) for 18h at 37 C and colonies resuspended in sterile saline to 0.5 McFarland standards. Each suspension was inoculated on a 90-mm diameter 38

39 Mueller Hinton agar plate and E test strips were applied as recommended by the manufacturer. Results were recorded after 16-20h of incubation. Quality of media, antibiotic disks and E test strips were controlled with Escherichia coli ATCC Isolates with a MIC of 8μg/ml for cefepime and a MIC of 2μg/ml for tigecycline were considered resistant according to the CLSI [46, 47]. 3.4 Amplification of ESBLs genes and ISEcp1 element A single colony of each organism was inoculated into 5ml of LB broth (BD BBL, USA) and incubated for 18hrs at 37 0 C while shaking. Cells from 2ml of overnight culture were harvested by centrifugation at 13000rpm for 5 minutes. The supernatant was discarded and cells were suspended in 500µl of sterile distilled water. The suspension was incubated for 10 minutes at 95 o C to lyse the cells, and then centrifuged at full speed for 10 minutes to remove cellular debris. Five microlitres of supernatant was used as template DNA in the PCR reaction [11, 65]. PCR amplification of TEM, SHV and CTX-M genes were performed as described previously using primers in Table 3. For amplification, 5 µl of template DNA was added to a 45µl mixture containing 200µM of dntp mixtures (Roche, Switzerland) 0.4µM of each primer, 2.5U taq polymerase (Invitrogen, USA) and appropriate buffer (0.2 µl MgCl 2, 2.5 µl KCL, 0.5µl 10% Tween 20, 1µl of Gelatin and 3.8µl of pure water). The reaction was performed in Gene Amp PCR system 9700 thermo cycler (Applied Biosystems, USA) under the following conditions: Initial denaturation at 94 o C for 5 minutes followed by 35 cycles of 30 seconds denaturation at 94 o C, 30 seconds annealing at 58 o C, 60 seconds extension at 72 o C, 39

40 and a final extension at 72 o C for 7 minutes. For SHV, the annealing temperature used was 55 o C [65]. Using the published sequence of a 92kb plasmid carrying bla CTX-M-15 (GenBank accession AY044436), primer sets (4, 5 table 3) was designed to amplify the ISEcp1 element in bla CTX-M-15 carrying Escherichia coli and K. pneumoniae isolates [11]. The reaction mixture was the same as for the ESBL genes, except that an annealing temperature of 62 C was used. PCR products were detected with ethidium bromide fluorescence using the Bio-Rad image system (Bio- Rad, UK) after 1 hour electrophoresis in 1% TBE agarose gel. Positive controls for TEM, SHV and CTX-M were used in every run. 3.5 Sequencing PCR products were purified using Invitek purification kit (Invitek, Berlin Germany) following the manufacturer s instructions. Reverse and forward sequence reactions were done using the corresponding primers used for amplification, and sequencing was performed using the automated sequencer ABI Prism 3100 (Applied Biosystems, USA). In case of isolates from Tanzania all PCR products were sequenced (LGC genomics GmbH, Berlin Germany) using the same primers plus additional set of primers (CTF) to cover mutation that differentiate bla CTX-M-15 from bla CTX-M-28. The resulting sequences were compared with known sequences using DNASTAR software (DNASTAR Inc, Madison, USA) and the Basic Local Alignment Search Tool (BLAST, NCBI). 40

41 3.6 Location and transferability of ESBL genes Plasmids were extracted using alkaline lysis method as describe previously [10] and transformed into Escherichia coli DH10α by electroporation at 1.8kv, using Gene- Pulser (Bio-Rad, UK). Transformants were selected on LB agar containing 30µg/ml cefotaxime (Sigma, Germany) [11, 65]. Table 3: Primers used for amplification and sequence of ESBL genes and IS element Target Primer name Sequence(5-3 ) Product size References 1. bla TEM TEM-F TCCGCTCATGAGACAATAACC 931bp 65 TEM-R TTGGTCTGACAGTTACCAATGC 2. bla CTX-M CTX-F TCTTCCAGAATAAGGAATCCC 909bp 65 CTX-R CCGTTTCCGCTATTACAAAC 3. bla SHV SHV-F TGGTTATGCGTTATATTCGCC 868bp 65 SHV-F GGTTAGCGTTGCCAGTGCT 4. tnpa tnpa- F GCAGGTGATCACAACC 1800bp Article II tnpa- R GCGCATACAGCGGCACACTTCCTAAC 5. CTX/tnpA F GTATCAAAGCTTCATGCTCACGGCGGG 3185bp Article II R GGAAAAAAGCTTAGGTGATCACAACCG 6. CTF CT-F GACAGACTATTCATGTTGTTG 419bp Article 1V CT-R CGATTGCGGAAAAGCACGTC 7. ChuA ChuA.1 GACGAACCAACGGTCAGGAT 279bp 66 ChuA. 2 TGCCGCCAGTACCAAAGACA 8. yjaa YjaA.1 TGAAGTGTCAGGAGACGCTG 211bp 66 YjaA.2 ATGGAGAATGCGTTCCTCAAC 9. TSPE4.C TspE4C2.1 GAGTAATGTCGGGGCATTCA 152bp 66 TspE4C2.2 CGCGCCAACAAAGTATTACG 41

42 10. gyra gyra-a CGCGTACTATACGCCATGAACGTA 441bp 55 gyra-c ACCGTTGATCACTTCGGTCAGG 11. parc2 parc2-1 GGCGCAACCCTTCTCCTAT 55 parc2-3 GAGCAGGATGTTTGGCAGG Conjugation was carried out using overnight cultures with Escherichia coli CC118 as a recipient strain and randomly selected clinical isolates of Escherichia coli and Klebsiella pneumoniae, representing different PFGE-based clusters, respectively, by mixing them at the ratio 2:1 on LB agar and incubation overnight at 37 C. Transconjugants were selected by suspending the growth in 1ml of PBS and 100µl of dilutions were plated on LB agar containing rifampicin 300 µ/ml and 100 µg/ml ampicillin. The denominator was calculated from 1ml of original donor cells by diluting to The transconjugants were tested for ESBL production followed by PCR amplification of ESBL gene. All transconjugants plasmids were sized using PFGE SI nuclease digestion as described previously [67] followed by southern blotting and hybridization using digoxygenin (DIG)-labeled bla CTX-M-15 amplicon probes, prepared according to the manufacturer s instruction (DIG High Prime DNA labeling and Detection Starter Kit II, Roche, Germany). PCR based replicon typing was done to selected isolates and their transconjugants using primers pairs which recognize FIA, FIB, FII, FrepB, I1, P, A/C, X, HI1,HI2, L/M, FIC, Y, W,T, K and N replicons [9]. Sequencing was done to confirm the detected replicons using the same primers. All recombinant techniques were performed under biosafety cabinet. 42

43 3.7 Recombinant techniques The bla CTX-M-15 gene together with its insertion elements was cloned into a 2.7kb plasmid (psu2719cm) [68] (Figure 2). Using primer 5 in table 3 the CTX-M/tnpA gene was amplified and the 3.185kb product was purified from the gel using QIAEX II Gel extraction kit (QIAGEN, Germany). Plasmids were extracted from an over night culture of DH10α using QIAprepR Spin Miniprep Kit (QIAGEN, Germany). Plasmids and vector were restricted with Hind III (MBI fermentas). Mixtures were purified using Invitek purification kit (Invitek, Germany) followed by dephosphorylation of the vector and ligation performed at 16 C overnight [68]. The cloned plasmid was used to transform TOP-10 R Escherichia coli chemically and transformants were selected by plating on LB plate with 30μg/ml ampicillin and 25μg/ml chloramphenicol. Twenty randomly selected colonies (large and small) were screened for the presence cloned gene into a plasmid using M13 F, M13 rev and CTX-M specific primers. Figure 2: Illustration for CTX-M-15 and ISEcp1 and 2.7kb plasmid 43

44 3.8 Pulse-Field Gel Electrophoresis (PFGE) PFGE was performed according to the Pulse Net protocol of Centre for Disease Control and Prevention (Atlanta, USA) ( Incubation and washing steps were prolonged as per recommendations. The agarose embedded DNA was restricted with Xbal (New England Biolabs) at 37 o C for 16hrs. Electrophoresis was performed on 1% Agarose gel (Bio-Rad, UK) 0.5X TBE buffer (Sigma). For Escherichia coli the PFGE conditions were 6V, 2.2s-54s pulse, for 20hrs, for Klebsiella pneumoniae were 6V, 5s-50s for 26hrs. Electrophoresis was conducted using CHEF Drive II (Bio-Rad, UK). Strain differentiation by PFGE analysis was achieved by comparison of band patterns using Gelcompar II (Applied Maths, Belgium). Patterns were normalized on basis of the molecular weight marker. The similarity coefficient (SAB) of sample pairs was calculated based on band positions by using the DICE metric [69]. The genetic relationships among isolates were computed by cluster analysis performed on the matrix of genetic similarities. Cluster analysis was performed by means of the unweighted paired group method using arithmetic average (UPGMA) [70]. Dendograms were generated to visualize relationships among the isolates. The cut-off in the dendograms was calculated at a SAB of 0.99 as a threshold for defining clone of genetically similar isolates and SAB of 0.8 to define cluster of isolates. The discriminatory power of the applied PFGE typing method was assessed by calculating the discriminatory index D based on application of Simpson s index of diversity as described previously [70, 71]. Molecular sizes of the bands were calculated with Gelcompar II (Applied Maths) by using a calibration 44

45 curve based on a synthetic regression curve derived from the reference bands (Lambda Ladder, Biolabs, USA). 3.9 Phylogenetic analysis All Escherichia coli and Klebsiella pneumoniae ESBL isolates were grouped into phylogenetic groups. For Escherichia coli Triplex PCR method described in Clermont et al [66] was used. Three markers were used: chua, yjaa and TSPE4.C2, primers sequence are seen in Table 3, using these markers Escherichia coli were grouped into A, B1, B2 and D phylogenetic groups (Figure 3 and Figure 4). Figure 3: Dichotomous decision tree to determine the phylogenetic group of an Escherichia coli strain by using the results of PCR amplification of the chua and yjaa genes and DNA fragment TSPE4.C2. 45

46 Figure 4: Agarose gel showing chua, yjaa and TSPE.C2 DNA fragments For Klebsiella pneumoniae phylogenetic grouping was done using PCR RFLP analysis for gyra gene and ParC amplification (Primers in table 3). Three groups were expected KpI, KpII and Kp III. The gyra product was restricted by HaeIII and Taq1 expected fragments are seen in table 4 [55]. Table 4: Interpretation of phylogenetic groups of Klebsiella pneumoniae KpI (Products) KpII KpIII HaeIIIB 175-bp,174-bp and 92-bp HaeIIIC HaeIIID 175-bp,129-bp,92-bp and 45-bp 175-bp,129-bp,92-bp and 45-bp 267-bp,129-bp,92-bp and 45-bp Taq1B 197-bp,142-bp, 93- bp and 9-bp 197-bp,142- bp,93-bp and 9- bp Taq1E 197-bp, 151-bp and 93-bp ParC

47 3.10 Multilocus sequence typing (MLST) MLST was carried out as previously described in Escherichia coli MLST website; gene amplification and sequencing were performed by using the primers listed on the Escherichia coli MLST website ( and both strands were sequenced. Allelic profile and ST determination was derived from the Escherichia coli MLST website database Biofilm assay Biofilm assay was performed to all Enterobacter spp from Tanzania. 100µl of 1:100 diluted overnight cultures of test strains were dispensed in 96-well microtiter plates (Becton Dickinson, Germany) containing 100 µl LB medium per well. Test plates were covered with its lid and incubated at 37 C for 48 h without shaking. Biofilm formation was assayed by staining of polystyrene-attached cells with crystal violet (CV). Briefly after removal of medium and two washes with 150 µl of phosphate buffered saline (PBS) solution, surface-attached cells were covered with 160 µl of 0.1% CV for 15 min. Following four subsequent washes with 200 µl of PBS solution, surface-bound CV was extracted by addition of 180 µl of ethanol (96%) and absorbance measurements obtained at 590 nm (A590) using spectrophotometer [72]. 47

48 3.12 Data analysis All data were entered in log books and then in the computer using excel sheets. The data were manually cleaned and final analysis was done as study objectives using SPSS software and Gelcompar II (Applied Maths, Belgium) Quality control In all tests the use of positive and negative controls was adhered to, and reading of tests was done by more than two people to avoid bias. Quality control strains were used as described in methodology section. The API 20E and MIC determination methods were used in cases where the results were not conclusive. The standard operating procedures were established at Bugando Medical Centre and reproducibility was ensured. All isolates have been preserved for future use and for further identification if needed Ethical consideration The study obtained clearance from BUCHS and BMC Research Ethics Committee. The data obtained were used in routine management of the patients. In the cases where ESBL producers were isolated proper control measures were instructed to prevent dissemination to other patients. All patients with ESBL producer were treated and managed appropriately, according to susceptibility results. 48

49 3.15 Limitations Inappropriate use of antibiotics prior to specimen collection affected culture rate results in specimens from BMC. Despite this limitation the study achieved its objectives and recommendations were laid down. 49

50 CHAPTER FOUR 4.0 Results 4.1 Escherichia coli from Giessen ESBL producing Isolates and Susceptibility Results A total 63 non-replicative isolates of Escherichia coli from Giessen were found to be ESBL producing phenotypically. These isolates were mainly recovered from urine 35 (55.5 %), blood culture 6 (9.5%), sputum 5(7.9%) and swabs 17 (27 %). Most of the isolates studied were from medical ward 29 (46%) and 7(11.1%) were from ICU. Among 63 phenotypically confirmed ESBLs 61(96.8 %) were positive for PCR amplification using specific primers for TEM and CTX-M. No isolates were positive for SHV and 2(3.2 %) were negative in 3 attempts for the PCR-based amplification reactions for TEM, SHV and CTX-M group 1. CTX-M had the highest occurrence frequency and was found in 49(77.7 %) isolates. The bla CTX-M-15 was the commonest allele detected, it was found in 36 (57.1%) of all Escherichia coli tested. Other ESBL alleles detected were CTX-M-3 (4.7%), CTX-M-1 (11.1%), CTX-M-28 (3.1%), TEM-144 (7.9%), TEM-126 (3.1%), TEM-105 (3.1%), TEM-150 (1.6%) and TEM-143 (3.1%) (Appendix 1). CTX-M-15 was detected in all cases of polymicrobial infection. Twenty randomly selected bla CTX-M- 15-carrying Escherichia coli isolates were positive for the 1.8kb ISEcp1 element. Co-trimoxazole (SXT) was transferable in 60% of isolates tested and gentamicin in 33% of cases, no transferable ciprofloxacin resistance was observed (Table 5). 50

51 The rate of resistance to gentamicin, ciprofloxacin, co-trimoxazole (SXT) and tetracycline were 96.8%, 79.3%, 90.4% and 88.8%, respectively (Appendix 1). All ESBL isolates were sensitive to carbapenems and tigecycline. The MIC distribution of tigecycline ranges from 0.19 µg/ml to 1.5 µg/ml with a mean of μg/ml and standard deviation of All isolates carrying the CTX-M-15 allele were resistant to cefepime (MIC 8μg/ml). The majority of isolates carrying CTX-M-15 were significantly resistant to gentamicin, SXT, tetracycline and ciprofloxacin when compared to other alleles (chi square 7.43, p=0.006). There was a significant association between being resistant to cefepime and having CTX-M-15 allele, when compared to other CTX M alleles. (p= , Fisher exact test) appendix Characterization of isolates using PFGE and Phylogenetic grouping All of the 63 Escherichia coli were subjected to PFGE analysis. Analysis of PFGEpatterns revealed that most of the isolates were heterogeneous. The genetic relatedness of the isolates is illustrated in figure 5. The 63 Escherichia coli isolates were assigned to 56 genotypes when, applying a similarity level of SAB of 0.99 as a calculated threshold for clustering (black dashed line (X) in figure 5. The B2 phylogenetic group was common group found in 28 (44.4%), other groups detected included A 20 (31.7%), D 10 (15.8%) and B1 5 (7.9%). The bla CTX-M-15 was found in all phylogenetic groups (B2, 50%; B1, 8.1%; A, 32.4% and, 27%). 51

52 Table 5: Characteristics of Escherichia coli selected as donors from different PFGE clusters NO Phylogen y group PFGE ESBL allele RESISTANCE Conjugation Inc group 12 B1 X13 CTX-M-15 GM,*SXT,*TET,CIP 10-9 FIA,FIB 19 A X13 CTX-M-15 GM,*SXT,TET,CIP 10-9 FIA,FIB 44 A X5 CTX-M-15,TEM-1 GM,CIP 10-9 FIA,FIB 48 D X13 CTX-M-15 *GM,CIP,*SXT,*TET 10-7 FIA,FIB 58 B2 X5 CTX-M-15 GM,CIP,SXT 10-4 FIA,FIB 66 A X9 CTX-M-15,TEM-1 *GM,CIP,*TET,*SXT 10-7 FIA,FIB 67 A X9 CTX-M-15,TEM-1 GM,CIP,*TET,*SXT 10-7 FIA,FIB 70 B2 X5 CTX-M-15,TEM-1 GM,*SXT,TET,CIP 10-9 FIA,FIB 81 D X6 CTX-M-28 CIP, SXT,*TET 10-9 FIB 90 A X12 CTX-M-3 *GM,CIP,SXT,*TET 10-9 FIA,FIB 92 B2 X5 CTX-M-15 GM, TET, SXT 10-9 FIA,FIB 95 A X9 CTX-M-1 SXT 10-8 FIA,FIB 103 B2 X12 CTX-M-15,TEM-1 *GM, CIP,*TET, SXT 10-7 FIA, FIB 79 B1 X5 CTX-M-15,TEM-1 *GM,CIP,*TET,*SXT 10-7 FIA 54 A X9 CTX-M-15, TEM B2 X1 CTX-M-15, TEM- 1 GM,CIP, *TET, *SXT 10-6 FIA GM,CIP,*TET, *SXT 10-7 FIA 110 D X4 CTX-M-15 *GM,CIP,*SXT,*TET 10-9 FIA,FIB 112 B2 X4 CTX-M-15 GM,CIP,*SXT,TET 10-9 FIA,FIB *Transferable resistance, GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Co-trimoxazole. The rate of transferable antibiotic resistance for GM, SXT, TET, GM-SXT-TET, SXT-TET and GM-TET was 33%, 61%, 61%, 27%, 44% and 11% respectively 52

53 4.1.3 Plasmid analysis and replicon typing Variable sizes of plasmids were detected. The majority of transconjugants had plasmids ranging from 145.5kb-194kb. A 145.5kb plasmid was found in 65% of isolates tested and uniformly positive for hybridization with the bla CTX-M- 15, FIA and FIB DIG-labelled DNA probes. On other occasions hybridization was positive for plasmids ranging between 97kb-145.5kb or 194kb of size (Figure 6). In one isolate the CTX-M-gene was located in a 242.5kb IncF1 plasmid. All clinical isolates and transconjugants had Inc FI group using PCR based replicon typing (PBRT). The DNA sequences of these replicons were homologous to published sequence representing the detected replicon. No plasmids belonging to the Inc groups FII, FII, IncN and IncI1 were detected ISEcp1 and Cloning results All of the 10 randomly selected bla CTX-M-15 -carrying Escherichia coli isolates were positive for the 1.8kb ISEcp1 element. Nine of the 10 randomly selected bla CTX-M-15 - carrying K. pneumoniae had short PCR products of ISEcp1 with 7 isolates exhibiting fragment sizes of 450bp and 2 isolates of 530bp, respectively. One isolate was negative for the PCR reaction. Sequencing of the short products revealed >99% identity with the ISEcp1 element. The CTX-M-15/tnpA was successfully cloned in 2.7kb plasmid (psu2719ccm) (Figure 2) and used to transform Escherichia coli TOP-10 R Topo-10 cells. Two phenotypically identical transformants were observed on LB plate with 30μg/ml cefotaxime and 25μg/ml chloramphenicol. PCR for CTX-M-15 was positive in all the transformants. 53

54 Figure 5: PFGE dendrogram of ESBL-producing Escherichia coli as evaluated by Dice and UPGMA analysis. The diagram also shows the isolates, ESBL genotypes PFGE groups and Phylogenetic group, of the isolates, A dashed line Z, SAB=0.97, X dashed line SAB=

55 Figure 6: Agarose gel showing S1 nuclease PFGE-based sizing of plasmids for 5 isolates. Lane 2, 4, 6 were not treated by SI nuclease, note the common 145.5kb plasmid LB agar plate containing 30μg/ml cefotaxime and 25μg/ml chloramphenicol revealed phenotypically small and large colonies in a 1:1 ratio (Figure 7). All of the 10 randomly selected small colonies contained the entire CTX-M-15/tnpA unit within the cloning site. Figure 7: LB plate showing Large (L) and small (S) colonies 55

56 For 6 of the 10 randomly selected large colonies, the CTX-M-15/tnpA unit was not present within the cloning site. Moreover, for all large colonies tested, the CTX-M- 15/tnpA-PCR reaction consistently revealed a ladder of smaller with distinct sizes (Figure 8). Figure 8: Agarose gel electrophoresis of products obtained by PCR from 3 large colonies and 3 small colonies. Lanes 1, 2 and 3 depict results from small colonies and, 4, 5 and 6 from large colonies, respectively. M denotes the 1kb molecular mass marker (Bio-Rad). All large colonies were without insert, these were positive for specific CTX-M PCR (results not shown) Klebsiella pneumoniae isolates from Giessen, Germany Isolates, ESBL alleles and susceptibility results Twelve (50%) of the 24 ESBL producing K. pneumoniae were recovered from urine specimens. All isolates were grouped into phylogenetic group KpI. PFGE had 3 clusters using SAB 0.8 (B1-B3) (Figure 9). Cluster B3 formed the majority of our isolates 19 (79%), within this cluster there was 10 (A3) isolates which had identical PFGE pattern (SAB 0.997). These identical isolates were from wards A (20%), B (50%), C (10%), G (10%) and I (10%) (Figure 9). The bla CTX-M genes were found in 20(83%) of Klebsiella pneumoniae isolates. Bla CTX-M-15 was the commonest allele 56

57 found 16(66%). Other alleles found were bla CTX-M-3 (16.6%), TEM-104 (8.3%) and TEM-54 (4.1%). TEM-1 was found in association with CTX-M-alleles in 19 (95%) of cases. Isolate no 71, was within the A3 clone, and despite phenotypically ESBL appearance it was negative for ESBL gene, only TEM-1 gene was found. No isolate carrying SHV ESBL gene was detected. In investigating the presence of ISEcp1, it was noted that all isolates gave 500bp amplicon instead of the expected 1.8kb amplicon. Random sequencing of four of these products indicated that they were similar to ISEcpl in Klebsiella pneumoniae with more than 98% identity. The primer set gave the desired product of 1,885bp using control Escherichia coli with bla CTX-M-15 gene (data not shown). All isolates with CTX-M-15 gene were resistant to cefepime with MIC >24µg/ml and also all isolates were resistant to gentamicin, tetracycline ciprofloxacin and sulphamethaxazole/trimethoprim (Table 5). All isolates were found to be sensitive to carbepenems and tigecycline Location of bla CTX-M-15 In three attempts made, the bla CTX-M-15 resistance gene was not transferable by conjugation or transformation. Plasmid analysis using the method described above revealed that the isolates harboured multiple plasmids of various sizes ranging from less than 48.5kb to 436.5kb (Figure 10). The A3 clone had common plasmids of 48.5kb, 339.5kb and 388kb. Hybridization using the bla CTX-M-15 DIG labelled probe located the gene to the chromosome of 6 isolates, representing different clusters tested. PCR based replicon typing showed that most of our isolates had IncFI plasmids 20(80%) and 3(12.5%) had Inc FI and IncFII plasmids. The DNA 57

58 sequence of the FIA and FIB in four randomly selected products was homologous to previous published sequences. Table 5: Characteristics of Klebsiella pneumoniae isolates ISOLATE WARD Phylogeneti PFGE ESBL type Antibiotics resistance Incompatibility c group GROUP other than -Lactams Group 20 A KpI B1 CTX-M-3, Tem-1 GM,TET,SXT,CIP FIA,FIB 36 A KpI B1 CTX-M-15 GM,TET,SXT,CIP FII,FIA,FIB 61 G KpI B1 Tem-104 GM,TET,SXT,CIP FII,FIA,FIB 25 I KpI B2 Tem-54 GM,TET,SXT,CIP FII,FIA,FIB 57 C KpI B2 CTX-M-3,Tem-1 GM,TET FIA 76 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 82 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 84 B KpI B3 CTX-M-15 GM,TET,SXT,CIP FIA,FIB 115 A KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA 116 A KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 30 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 33 A KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 34 I KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 39 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 31 C KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 46 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 65 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 71 B KpI B3 Tem-1 GM,TET,SXT,CIP FIA,FIB 78 B KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 96 G KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 80 A KpI B3 CTX-M-15,Tem-1 GM,TET,SXT,CIP FIA,FIB 89 C KpI B3 CTX-M-3,Tem-1 GM,TET,SXT,CIP FIA,FIB 5 C KpI B3 Tem-104 GM,TET,SXT,CIP ND 52 A KpI B3 CTX-M-3,Tem-1 GM,SXT,CIP FIA,FIB *This isolate was ESBL phenotypically but no ESBL gene was found. GM: Gentamicin, TET: Tetracycline, CIP: Ciprofloxacin, SXT: Sulphamethaxazole/trimethoprim., ND: not done. 58

59 Figure 9: Dendogram (UPGMA, DICE) showing the similarity for 24 Klebsiella pneumoniae ESBL Producers. The line B indicates the 80% similarity. Note the clones A1-A3, Phylogenetic group, wards A-I, PFGE clusters and isolate numbers. Figure 10: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates. 59

60 4.3 Escherichia coli isolates from Bugando Medical Centre Distribution, susceptibility pattern and ESBL allele Twenty seven (84%) and 5(16%) of the isolates were recovered from inpatient and outpatients specimens, respectively, the majority of which originated from surgical wards 16/27 (59%). The isolates were recovered from various clinical specimens: wound swabs (n=11), urine (n=8), pus (n=7) and blood (n=6). All isolates were found to be resistant to cefotaxime (MIC>30µg/ml) and showed the classic ESBL phenomenon on disk synergy test. The rate of resistance to non-beta-lactam antibiotics tested was 100% to tetracycline, 93% to sulphamethaxazole/trimethoprim and 84% to gentamicin and ciprofloxacin respectively. All isolates were resistant to cefepime and sensitive to imipenem and meropenem. Following PCR for ESBL alleles and subsequent sequencing of amplicons, all isolates were found to carry bla CTX-M-15, while 8 isolates (25%) also carried bla TEM-1 (Figure11). In all isolates tested, bla CTX-M-15 was linked to an ISEcp1 element Genetic relatedness Phylogenetic group typing assigned the majority of isolates, 24(75%), to phylogenetic group B2. Group D, A and B1 were found for 2 (6%), 3 (9.3%) and 3 (9.3%) strains, respectively. Multiple clones were seen on PFGE and using a similarity level (SAB) of 0.8, twenty two clusters (X1-X22) were seen among 32 isolates (Figure 11). There was no evidence for the presence of any large cluster. 60

61 Cluster X11 displayed a clonal relationship (SAB>0.99) amongst isolates of three patients from an orthopedic ward. MLST revealed multiple ST clonal complexes. ST131 was found in 12 (40%) strains, other ST complexes associated with bla CTX-M-15 included ST38 (2), ST46 (1), ST224 (1), ST405 (4), ST638 (3), ST648 (1) and ST827 (2). Two new ST clonal complexes were found: ST1845 and ST1848 which were typed to the phylogenetic group A; these isolates were recovered from wound swab and pus, respectively. All Escherichia coli in clonal complex ST131 were in the phylogenetic groups B2. Of the four ST405 complex isolates, 2 were classified as phylogenetic group D. A clear association was seen between ST clonal complexes and PFGE patterns as isolates with a PFGE pattern similarity (SAB) of more than 85% were also grouped into the same ST complex (Figure 11) Location and transferability of ESBL genes PCR based replicon typing revealed that replicons FIA, FIB, FII and FrepB were present in 30 clinical isolates and transconjugants in various combinations. The commonest combination was FIA- FIB, which was demonstrated in 14 (47%) of cases. IncFII was found in 8 (26%) cases. Fifteen randomly selected isolates were found to carry IncF conjugative plasmids with a conjugation frequency ranging from per donor cells. Gentamicin-, sulphamethaxazole/trimethoprim- and tetracycline-resistance was transferable in 7/15(46%) of cases, while gentamicin resistance alone was transferable in 12/15(80%) of cases (Table 6). 61

62 Different plasmids were found to carry bla CTX-M-15 when using SI nuclease digestion and DIG hybridization techniques to probe for their presence (Figure 12). Based on the lambda ladder marker used, the estimated plasmids size ranged from 50kb- 291kb. The commonest plasmid was 291kb of size and was found in 6 (40%) transconjugants 62

63 Figure 11: PFGE dendrogram of CTX-M-15 producing Escherichia coli. Heterogeneity of the 32 Escherichia coli ESBL producers are seen on the dendrogram. The diagram also shows the isolate number, wards, specimen, ESBL allele, incompatibility groups, ST clonal complex as well as the PFGE cluster. Solid line X indicates SAB of 0.8 revealing 22 clusters (X1-X22). MOPD, medical outpatient department; NU, neonatal unit; CTC, care and treatment clinic; GOPD, gynecological outpatient department; NICU, neonatal ICU; (E4,E8,C9,E9,C6, J5), Surgical wards; VIP, First class ward. Table 6: Characteristics of Escherichia coli selected as donors from different PFGE clusters S NO ISOLATE NO Inc Group ST Conjugation frequency Estimated Plasmid Size Transferable resistance 1 02 FIA,FIB ST kb GM 2 18 FIB ST * kb GM,SXT,TET 3 22 FIB ST * kb GM,SXT,TET 4 32 FIA,FIB ST * kb GM,SXT,TET 5 76 FIA,FIB ST kb GM,SXT FIB ST kb SXT,TET FrepB ST kb GM FIA,FIB ST kb GM,SXT FIB ST kb Beta lactams FIB ST kb GM,SXT,TET FIA,FIB NT kb GM,SXT,TET FIA,FIB ST kb GM,SXT,TET FIA,FIB ST131 4* kb Beta lactams FIB ST kb GM,SXT FII ST kb GM,SXT,TET 63

64 ST: Sequence type, GM: Gentamicin, SXT: Co-trimoxazole, TET: Tetracycline A B Figure 12: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates. M (Lambda Marker) indicates the molecular weight marker. Plasmid size preparations from isolate number 02, 18, 32, 76, 215, 181, 182 and 092 reveal plasmids with size ranging from 50 kb to 291 kb which are indicated with arrows; B is corresponding gel after southern blot and DIG hybridization hybridized plasmids are shown with arrows 4.4: Klebsiella pneumoniae isolates from Bugando Medical Centre Bacterial isolates and susceptibility pattern A total of 92 Klebsiella pneumoniae isolates were found to be ESBL producers, they formed 45% of all Klebsiella pneumoniae isolated over a period of 8 months. Most of Klebsiella pneumoniae producing isolates were from inpatients 87 (94%). The majority of isolates were recovered from blood culture from neonatal unit 39(64 %) and 22(36%) from neonatal ICU (NICU) (Figure 13). Nineteen isolates (21 %) were from wound swabs and pus from surgical wards and 12(13%) were 64

65 isolated from urine specimens from various wards (Figure 13). A higher rate of resistance to commonly used non-beta lactams was observed in the hospital. All isolates were found to be resistant to gentamicin and sulphamethaxazole/trimethoprim; the rate of resistance to tetracycline and ciprofloxacin were 98% and 54%, respectively. A total of 25(38%) isolates from neonatal unit and NICU were resistant to ciprofloxacin compared to 17(68%) of isolates from other wards (p<0.05). All isolates were sensitive to imipenem and meropenem using disc diffusion test ESBL alleles Following PCR and sequencing bla CTX-M-15 was the commonest ESBL allele detected. It was found in 70(76%) of cases. In the majority of isolates 49(70%), the bla CTX-M-15 allele occurred in combination with bla TEM-1. Also bla CTX-M-15 occurred in combination with bla SHV-11 in 11(16 %). Other ESBL alleles detected were bla TEM (18%) and bla TEM-176 2(2%). The bla CTX-M-15 was the commonest allele 58/67(87 %) among isolates from neonatal unit and neonatal ICU (Figure 13) Genetic relatedness On PFGE the isolates were assigned to thirteen clusters using a similarity index (SAB) of 0.8 (Figure 13). These clusters contained subclusters, as shown in figure 12. The cluster X5 was found to be clonal. The cluster X7 contained 2 large subclusters each with identical strains; also identical strains were seen in subclusters from cluster X8. All these subclusters with identical strains occurred in neonatal unit and neonatal ICU, thus representing outbreaks in these units. The first outbreak 65

66 occurred in June 2009 isolates in cluster X8, followed by subclusters in X7 in January and March The largest cluster was cluster X7 which contained 28 isolates of which 26(93 %) are from neonatal unit and NICU. The isolates in this cluster have one band difference indicating that they are closely related. Cluster X2 which is the second largest, contained diverse isolates from various wards and could further be divided into 4 subclusters. All Klebsiella pneumoniae isolates were grouped in the phylogenetic group KpI using gyra PCR-RFLP Location of ESBL genes Sixteen of 18 Klebsiella pneumoniae isolates which were randomly selected as donors were able to transfer resistance at a frequency of transconjugants per donor cells (Table 7). Different sizes of plasmids were found in transconjugants ranging from 25kb-485kb and all were found to hybridize with DIG labelled bla CTX- M-15 probes (Figure 14). A representative isolate from 11 identical strains in cluster X7 contained 2 plasmids (485kb and 25kb). Interestingly this isolate did not transfer resistance on conjugation and all plasmids gave positive signals on hybridization (Figure 14). The 25kb plasmid was transformed into Escherichia coli DH10β conferring resistance only towards beta lactams. IncF replicons were found in 8 isolates (42%) and IncP was found in 2(10%) while the other isolates could not be typed. Gentamicin resistance was transferable in all conjugative cases, GM-SXT in 7(38%), and GM-SXT-TET was transferable in 3 (16%) cases. 66

67 NO Ward Specimen ESBL ALLELE Phyl Cluster X 67

68 Figure 13: PFGE dendrogram of ESBL producing Klebsiella pneumoniae The PFGE patterns of the 92 Klebsiella pneumoniae ESBL producers are seen on the dendrogram. The diagram also shows the isolate number, wards, specimen, ESBL allele, phylogenetic group as well as the PFGE cluster. Dashed X line indicates SAB of 0.8 revealing 13 clusters (X1-X13). NU, neonatal unit; NICU, neonatal ICU 4.5 Enterobacter spp from Bugando Medical Centre During December 2009 and February 2010, a gram negative bacterium was isolated from blood-samples of 17 neonates (Table 8). Twelve (70%) of cases occurred in January (Table 8). Using in-house phenotypic biochemical profiling and latex agglutination test using polyvalent Salmonella kit (Thermofisher, UK) these strains were identified as Salmonella paratyphi. All isolates were resistant to ampicillin (MIC>16μg/ml), amoxicillin/clavulanic acid (MIC>16μg/ml), gentamicin (MIC>8μg/ml), sulphamethaxazole/trimethoprim(mic>2/38μg/ml), tetracycline (MIC>8μg/ml), fosfomycin (MIC>128μg/ml), chloramphenicol (MIC>32μg/ml), cefotaxime (MIC>32μg/ml), ceftriaxone (MIC>16μg/ml), ceftazidime (MIC>16μg/ml), cefepime (MIC>16μg/ml) while being sensitive to ciprofloxacin and meropenem (Figure 15A). 68

69 Table 7: Representative strains of Klebsiella pneumoniae S NO ISOLATE ESBL ALLELE Inc Group PFGE Cluster Phyl Conjugation frequency PLASMID Size Transferable resistance CTX-M-15, TEM-1 IncP X2 KpI kb GM,SXT CTX-M-15, TEM-1 FII X2 KpI kb GM TEM-104 FII X2 KpI kb GM,SXT TEM-104 ND X8 KpI kb GM CTX-M-15, TEM-1 FII X8 KpI kb GM CTX-M-15 FII X10 KpI kb GM CTX-M-15, TEM-1 ND X2 KpI kb GM CTX-M-15, TEM-1 FIA X7 KpI kb GM TEM-104 FII X8 KpI kb GM TEM-104 FIA X12 KpI Kb GM CTX-M-15, TEM-1 ND X7 KpI Neg 485Kb, 25kb CTX-M-15, TEM-1 ND X9 KpI kb GM,SXT CTX-M-15 ND X2 KpI kb GM,SXT,TET CTX-M-15 ND X4 KpI kb GM,SXT, TET CTX-M-15, TEM-1 ND X9 KpI kb GM,SXT CTX-M-15,TEM-1 ND X5 KpI Neg ND CTX-M-15 IncP X7 KpI kb GM CTX-M-15 FII X2 KpI kb GM 69

70 Figure 14: Agarose gel showing S1 nuclease PFGE-based sizing of large plasmids for 8 isolates. M (Lambda Marker) indicates the molecular weight marker. Plasmid size preparations from isolate number 08, 20, 25, 135, 141, 214 and 175 reveal plasmids with size ranging from 25 kb (marked A) to 485kb which are indicated with arrows; B is corresponding gel after southern blot and DIG hybridization hybridized plasmids are shown with arrows. All isolates were found to produce extended spectrum β-lactamase and bla CTX-M-15 (HQ175999) was detected in all isolates. In conjugation experiments, gentamicin-, tetracycline- and fosfomycin-resistances were transferrable. S1-nuclease PFGE and subsequent DIG hybridization with a CTX-M-15 specific gene probe indicated that bla CTX-M-15 was located on a 291kb plasmid in all wild-type isolates. However, in transconjugants, the resistance gene was chromosomally located, indicating translocation of the resistance gene to the recipient chromosome probably following abortive conjugal transfer (Figure 15B). 70

71 Table 8: Demographics and clinical characteristics of neonates infected with Enterobacter spp nov SNO SEX AGE (days) GA Date of Admission Diagnosis Date sepsis diagnosis of Positive culture Isolate Outcome 245 F 5 Premature 23/12/2009 Prematurity 27/12/ /12/2009 Enterobacter spp Death 246 F 3 Full term 30/12/2009 Birth asphyxia 01/1/2010 3/1/2009 Enterobacter spp Discharge 247 M 7 Premature 1/1/2010 Prematurity 03/1/2010 5/1/2010 Enterobacter spp Discharge 248 F 2 Premature 3/1/2010 Prematurity 05/1/2010 7/1/2010 Enterobacter spp Death 249 F 14 Full term 1/02/2010 Birth asphyxia 01/1/2010 3/1/2010 Enterobacter spp Discharge 250 F 2 Premature 13/1/2010 Prematurity 15/1/ /1/2010 Enterobacter spp Death 251 M 6 Full term 14/1/2010 Birth asphyxia 14/1/ /1/2010 Enterobacter spp Discharge 252 F 2 Premature 14/1/2010 Prematurity 16/1/ /1/2010 Enterobacter spp Death 254 F 3 Premature 15/1/2010 Prematurity 18/1/ /1/2010 Enterobacter spp Death 255 M 2 Premature 14/1/2010 Prematurity 16/1/ /1/2010 Enterobacter spp Discharge 256 M 2 Full term 15/1/2010 Birth asphyxia 17/1/ /1/2010 Enterobacter spp Discharge 258 M 3 Premature 23/1/2010 Prematurity 25/1/ /1/2010 Enterobacter spp Discharge 260 F 4 Premature 24/1/2010 Prematurity 28/1/ /1/2010 Enterobacter spp Discharge 261 M 3 Full term 04/2/2010 Birth asphyxia 07/2/ /2/2010 Enterobacter spp Death 264 M 4 Premature 04/2/2010 Prematurity 08/2/ /2/2010 Enterobacter spp Discharge 265 F 3 Premature 05/2/2010 Prematurity 08/2/ /2/2010 Enterobacter spp Discharge 267 F 2 Premature 06/2/2010 Prematurity 08/2/ /2/2010 Enterobacter spp Discharge 71

72 Figure 15: PFGE dendrogram rooted from XbaI digested Enterobacter cloacae strain 263 of 18. Enterobacter strains revealing clonal isolates, isolate MO244 was isolated from milk bucket. G, gentamicin; TET, tetracycline; SXT, sulphamethaxazole/trimethoprim; FF, fosfomycin; CIP, ciprofloxacin; MEM, meropenem; R: resistant, S: Sensitive. 72

73 On identification using commercial biochemical kits, API 20E (BioMerieux, Germany), VITEK 2 GN ID Card (BioMerieux, Germany) and Phoenix-NMIC/ID- 64 (Becton Dickson, Germany) isolates were identified as Enterobacter cloacae with identity of 56%, 95% and 98%, respectively. Fatty acid analysis classified the strains in the Enterobacteriaceae family with a similarity index of 0.471, 0.438, 0.419, and to Proteus vulgaris, Enterobacter gergoviae, Kluyvera ascorbata, Serratia phymuthca and Escherichia coli. All isolates were found to form Biofilm on microtiter plate after 48hr incubation. A 16S rdna phylogeny analysis using a 1444bp fragment of the16s rdna (GenBank HQ122932) from strain no 247BMC and 248BMC revealed the sequence was 97% -98.8% similar to other Enterobacter sp (Figure 16); the closest similarity (Table 9) was seen with Enterobacter asburiae (98.86%), Enterobacter cancerogenus (98.82%), Enterobacter kobei (98.57%), Enterobacter ludwigii (98.55%) and Enterobacter cloacae (98.52%). A 982bp rpob DNA fragment (HQ148298) was obtained (Table 9). The closest relation was Enterobacter hormaechei with a divergence of 1.2% (Table 9). Finally a 360bp fragment of the hsp60 gene was obtained (HQ148299) and compared with other hsp60 genes in gene bank; it was close to Enterobacter hormaechei. 73

74 Table 9: Biochemical properties and percentage homology of genetic markers between strain 247BMC and other closely related Enterobacter spp. E. aerogenes E.asburiae E.cancerogenu s E. cloacae E.cowanii E. gergoviae E. hormaechei E. kobei C. sakazakii E. ludwigii 247BMC 4-NP-α-Glc NA VP ADH - V(21) V(78) ODC V(91) SAC V(25) RAF + V(70) ARA CIT MR V(57) ADO V(25) SOR LDC LACT + V(75) V(55) RHA MEL ESC NA NA - V(30) NA NA - NA URE - V(60) - V(65) + V(87) Yellow colour V(66) S rdna* 98.2% 98.8% 98.8% 98.5% 97.3% 94.8% 97.9% 98.5% 97% rpob* 95.7% 97.4% 96.1% 98.1% 91.5% 91.5% 98.8% 97.8% 91% Hsp60* NA 94.9% 92.6% 95.2% 86.6% 80.0% 97.3% NA 89% 98. 5% 98. 0% 93. 7% 100% 100% 100% 74

75 NP-α-Glc, metabolism of 4-NP-α-Glucoside; VP, Voges-Proskauer; ADH, arginine dihydrolase; ODC, ornithine decarboxylase; SAC, acid from sucrose; RAF, acid from raffinose; ARA, acid from arabinose; SOR, acid from sorbitol; LDC, lysine decarboxylase; MR, methyl red test; CIT, use of citrate as sole source of carbon; ADO, acid from adonitol; MEL, acid from melibiose, URE, production of urease, LACT, acid from lactose; RHA, acid from rhamnose; ESC, hydrolysis of esculin; +, 90% or more strains are positive, -, 90% or more strains are negative, V, 11-89% strains are positive, NA, not available, - + ; 10-20% are positive. *Percentage of homology to strain 247 BMC Figure 16; Neighbor joining tree of Enterobacter spp based on 16SrRNA DNA sequences in relation to the strain 247 BMC. Numbers in brackets are accession no. A 1444 bp 16S rdna was amplified and sequenced with the primers 49F (TWAYACATGCAAGTCGRRCG) and 1504R (CTTGTTACGACTTCACCCCAG), 355R (GCTGCCTCCCGTAGCAGTCTGG) and 1092F (AAGTCCCGCAACGAGCGCAAC). 75

76 4.6 Comparison of Molecular Epidemiology of ESBL producing isolates between BMC and IMMG Escherichia coli (56%) formed the majority of ESBL producing isolates from Giessen (Tables 10, 11), while from Bugando most of ESBL producing isolates were Klebsiella pneumoniae which formed more than 50% of all enteric gram negative bacteria found to produce ESBL. Thirty two Escherichia coli from BMC formed 22 clusters while only 6 clusters were seen among 63 Escherichia coli from Giessen University hospital (p=0.0011). The bla CTX-M-15 was found to be predominant allele in these two institutions, and in Escherichia coli this allele was carried in multiple conjugative IncF plasmids (Table 10, Table 11). A 145.5kb plasmid was common in Escherichia coli isolates from Giessen while in E. coli isolates from Mwanza, Tanzania no common plasmid was seen (Table 6). In Klebsiella pneumoniae the bla CTX-M-15 was found in the chromosomal DNA of isolates from Germany while the allele in Klebsiella pneumonia isolates from Bugando Medical Centre was found in multiple conjugative plasmids with size ranging from 25kb-483kb. As with Escherichia coli higher diversity of Klebsiella pneumoniae isolates from BMC was observed, the isolates from Giessen University Hospital formed 3 PFGE clusters while those from BMC had 12 PFGE clusters ( p>0.05). 76

77 Table 10: Comparison of Escherichia coli ESBL producing isolates from Giessen and that from Bugando medical Centre Organisms University Hospital Bugando Medical Centre Giessen Escherichia coli 63 isolates 32 isolates Prevalence 3.3% 25% ESBL alleles CTX-M-1 7 (11.1%) ND CTX-M-3 3 (4.7%) ND CTX-M (57%) 32 (100%) CTX-M-28 2 (3.1%) ND TEM 12 (18.8%) ND Plasmid groups FIA 10 (15.8%) ND FIB 8 (12.7%) 7 (21.8%) FIA,FIB 45 (74.1%) 14 (43.4%) FII ND 9 (28.1%) Common Plasmid size 145.5kb 291kb Largest plasmid carrying 242.5kb 291kb bla CTX-M-15 Conjugation Frequency Transferrable resistance GM 33% 80% SXT 61% 73% CIP ND ND TET 61% 53% ST ST 131 NT 40% (Predominant) Phylogenetic group A 20(31.7%) 3(9.3%) B1 5(7.9%) 3(9.3%) B2 28(44.4%) 24(75%) D 10(15.8%) 2(6%) PFGE clusters 6 clusters 22 clusters Specimens Urine 35 (55.5%) 8 (25%) Wound swab 17 (27.0%) 11 (34.4% Sputum 5 (7.9%) - Blood 6 (9.5%) 6 (18.8%) Pus - 7 (21.95) 77

78 Table 11: Comparison of Klebsiella pneumoniae ESBL producing isolates from Giessen and that from Bugando medical Centre Organisms University Hospital Bugando Medical Centre Giessen Klebsiella pneumoniae 24 isolates 92 isolates Prevalence 11.6% 50% ESBL alleles CTX-M-1 - ND CTX-M-3 4 (16.7%) ND CTX-M (66.7%) 70 (76%) CTX-M-28 - ND TEM (8.3%) 17 (19%) TEM (2%) TEM-54 1 (4.2%) SHV-11 ND 3(3.2%) Plasmid groups FIA 2 (8.3% 2 (11.1%) FIB - FIA,FIB 21 (87.5%) - FII 2 (8.3%) 6 (33.3%) IncP - 2 (11.1%) Common Plasmid carrying NIL 145kb bla CTX-M-15 Largest plasmid carrying NIL 485kb bla CTX-M-15 Conjugation Frequency Not conjugative Transferrable resistance GM ND 100% SXT ND 33% TET ND 11% GM-SXT ND 22% GM-SXT-TET ND 11% Phylogenetic group KpI 24(100%) 92 (100%) KpII ND ND KpIII ND ND PFGE clusters Clusters 3 12 clusters Specimens Urine 12 (50.0%) 12 (13%) Wound swab 7 (29.2) 19 (21%) Sputum 4 (16.6% - Blood 1 (4.2%) 61(66.3%) 78

79 CHAPTER FIVE 5.0 Discussion 5.1 Isolates, ESBL alleles and Susceptibility results This study provides genetic epidemiological data on ESBL-carrying enterobacteriaceae in the clinical setting of a University Hospital in Germany and BMC Mwanza, Tanzania. In both Institutions ESBL producers were commonly found in Escherichia coli, Klebsiella pneumoniae and Enterobacter spp with most of the strains recovered from urine, blood and wound swab samples. As described previously a predominance of certain specie producing ESBL in specific institution was observed in this study, whereby in Giessen University Hospital Escherichia coli was predominant while Klebsiella pneumoniae was predominant at BMC. Among Klebsiella pneumoniae isolates from these two institutions, the prevalence of ESBL was higher than in other enteric gram negative bacteria. The predilection for ESBL production by Klebsiella pneumoniae has never been clearly explained. Almost all non- ESBL producing Klebsiella pneumoniae isolates have chromosomally mediated SHV-1 β-lactamase [73]. This could also explain why 100% of our Klebsiella pneumoniae were resistant to ampicillin. Also Klebsiella pneumoniae was the commonest isolate from ICU and a significant number of them were ESBL producers. This finding agrees with those described in more than 75% of previous studies, where the majority of Klebsiella pneumoniae isolates were found to produce ESBL [73-76]. 79

80 At BMC approximately three quarters of the isolates were from inpatients and of these significant proportions were found to produce ESBL (p= ). Some other studies have demonstrated a statistically significant increase in antibiotic resistance in those organisms isolated after 72 hours of admission [77, 78]. This suggests that nosocomial acquired organisms are more likely to become ESBL producer and this may result in treatment failure with empirical use of cephalosporins. Almost all phenotypic confirmed ESBLs harboured ESBL genes. In a few cases (<2%) the PCR for the ESBL genes tested were negative. The study has demonstrated that CTX-M ESBLs are the most common ESBL types in Giessen and Mwanza. CTX-M- types were found in 76% of all ESBLs isolates in Giessen; in all Escherichia coli in Mwanza and in 76% of Klebsiella pneumoniae in Mwanza. The bla CTX-M-15 allele was the commonest allele among all ESBLs alleles and was more common in Klebsiella pneumoniae than in Escherichia coli in Giessen and it was vice versa in Mwanza. The predominance of bla CTX-M-15 indicates that this allele might be as common in Germany and Tanzania as in other European countries (such as UK, Poland, Greek, France etc) [7, 44]. The bla CTX-M genes are associated with an ISEcp1 element which facilitates their transfer and may explain why they are becoming the most common ESBL types in the world. In this study the ISEcpl element was found in all Escherichia coli strains tested habouring bla CTX-M-15 alleles. The bla TEM-1 was commonly associated with the bla CTX M-15 allele in the present study. Karisik et al. reported that 6 out of 11 Escherichia coli harboured both bla CTX M-15 and TEM-1[11]. 80

81 Extensive studies investigating the association of the MLST clonal complex ST131 and blactx-m-15 have been reported for Canada, India, Kuwait, France, Switzerland, Portugal, Spain, Korea and Japan; and worldwide dissemination of blactx-m-15 seems to be linked to this clone [12, 13]. In the present study ST131 was detected in 38% of Escherichia coli and this is the first report of ST131 in Tanzania. Also other multiple ST clones were detected to harbour bla CTX-M-15 allele, an observation that indicates a high diversity of Escherichia coli carrying ESBL genes in Tanzania. Both Escherichia coli and Klebsiella pneumoniae, isolates carrying bla CTX-M-15 were significantly more resistant to ciprofloxacin, gentamicin and co-trimoxazole as compared to other ESBL alleles. Other studies have reported cross-resistance to tetracycline, aminoglycosides, quinolones and co-trimoxazole in ESBL-producing organisms [6, 7, 12, 13, 15]. Other studies have shown that the plasmids harbouring the bla CTX-M-15 gene also carry other genes of resistance such as tet(a) and aac(6 )- ib-cr [6, 11, 44]. In this study gentamicin, tetracycline and SXT resistance were transferable by conjugation in 50% of cases. In non conjugative isolates like Klebsiella pneumoniae isolates from Giessen University Hospital, the mechanisms of co-resistance could not be explained, which suggests the possibility of other coexisting mechanisms of resistance in these isolates or location in non conjugative plasmids [6, 7, 44]. This study found that all isolates habouring bla CTX-M-15 were resistant to cefepime with most of them having a MIC greater than 32µg/ml (p=0.001) when compared to other CTX-M alleles. Mutation in (Asp-240-Gly) in bla CTX-M-15 which is conferring an increased ability to hydrolyze ceftazidime could also explain the resistance to 81

82 cefepime in strains harboring this allele [5, 19, 61]. Furthermore, this study demonstrated that most of the isolates with TEM- ESBL alleles were significantly sensitive to cefepime (p=0.02). All ESBL isolates used in our study were sensitive to carbapenems as it has been found in most studies; these groups of drugs have been recommended as the treatment of choice for ESBL isolates [59, 60]. Of the tested, ESBL isolates habouring CTX-M types 97% were found to be sensitive to tigecycline with a MIC < 2µg/ml. Thus, this could be a good alternative to carbepenems in case of systemic infection due to ESBL producing organisms [62] and also in avoiding overuse of carbepenems with attendant resistance problems. The only limitation could be cost because tigecycline is more expensive than carbapenems so its use in developing countries is questionable. The clinical impact of ESBL infection was assessed among neonates (Article III). As in other studies high mortality rate was observed among neonates infected with ESBL producing organisms in the present study [79, 80]. The majority of neonates with multi-resistant organisms died within 72hrs of initiation of antimicrobials. Good survival was demonstrated in neonates with sensitive organisms, 80.8% of them improved after 72hrs of treatment [81]. 5.2 Genetic relatedness of the isolates The PFGE results demonstrated that a multitude of genotypes were present in the population of clinical isolates. Analysis of PFGE banding patterns of Escherichia coli isolates from University Hospital Giessen revealed multiple genotypes among 63 isolates, suggesting that the spread of ESBLs is most probably linked to mobile 82

83 genetic elements rather then clonal outbreak. Using a similarity coefficient (SAB) of 0.80, 6 different clusters (1-6) were observed. Cluster 2 was the largest and was mainly formed by the B2 phylogenetic group with 67% of the isolates harbouring the CTX-M-15 allele. More diversity was seen in isolates from Bugando Medical Centre. Thirty two Escherichia coli from Bugando Medical Centre were heterogeneous in their PFGE profile and comprised 22 clusters (using SAB 0.8) this is high diversity but has been reported repeatedly in previous studies [82]. Using a SAB of >0.99 three small outbreaks were observed with PFGE patterns X2, X3 and X11 (Figure 5) occurring in pediatric wards and a surgical ward. Also MLST revealed that multiple ST clonal complexes carrying bla CTX-M-15, are present in single hospital in Tanzania, which contrasts with findings from many previous reports [83-85]. Many of the Escherichia coli strains carrying bla CTX-M-15 from different countries in Europe and North-America are homogenously grouped into the clonal complex ST131 [83-85], which was also the commonest grouping in this study (40%). However, we observed ten different sequence types carrying bla CTX-M- 15 among the Escherichia coli isolates from a single hospital, indicating high diversity of strains. Most of the ST (ST131, ST405, ST638, ST648, ST827 and ST224) in this study have been reported to carry bla CTX-M-15. The sequence types; ST1845, ST1848, ST46 and ST455 are reported here for the first time to be associated with bla CTX-M-15. In the present study ST648 was isolated in urine samples from outpatients. This ST has been found to be common in birds and close proximity with birds can be a risk factor for infection [86]. Only two isolates were grouped in the phylogenetic group D and these were found to be in the ST405 83

84 which also confirms what has been observed in the other studies [12]. In summary, an atypical high diversity of sequence types is observed in a single hospital in Africa, indicating that more studies are needed to determine the epidemiology of these isolates on this continent. As described in several other studies which involve clinical isolates, the majority of the isolates were assigned to the phylogenetic group B2, members of which, together with group D isolates, are the cause of most invasive infections. Bla CTX-M-15 has been found to be associated more often with B2 group than with other groups [12]. K. pneumoniae from University Hospital Giessen were differentiated into 3 clusters while that from Bugando Hospital were so diverse that they could be differentiated into 12 clusters using a SAB of 0.8 (p>0.05). A more clonal picture was seen in isolates from Giessen using SAB= High diversity of ESBL producing Klebsiella pneumoniae from BMC was observed in PFGE. Three breakouts caused by genetically identical strains on PFGE could be observed. In all these subclusters involved in outbreaks, the majority of isolates were from neonatal unit and neonatal ICU. These clonal outbreaks occurred at different times and could be due to patientto-patient transmission, the acquisition from a common source (contaminated equipment) or from health workers. Different clones were involved in all three outbreaks, which further support the notion of diversity of these strains in this hospital. The high diversity of these isolates capable of causing outbreaks is a big challenge for the hospital infection control team. 84

85 The difference in clonality of these isolates in two hospitals could be explained by level of hygiene and surveillance system. There is high level of hygiene in Giessen Hospital and there is surveillance mechanism of multi resistance organisms with infection control practices in place. In the presence of good hygiene measures, clonal outbreaks will occur at a point but at BMC there are multiple clones in the hospital capable of causing outbreaks, these clones could only be eliminated by good hygiene practice and proper antibiotic policy. The outbreak of Enterobacter spp in neonatal unit (Article V) at BMC which was controlled by hygiene measures further support the role of hygiene and good surveillance systems as important measures in controlling the problem of ESBL producing isolates in developing countries. Escherichia coli, Klebsiella pneumoniae and Enterobacter spp do form biofilm, in the present study all strains identified as novel Enterobacter spp were found to form biofilm in microtiter plates, this pose challenges in disinfectants and clean methods used at BMC, more work is needed in this area at BMC to explore the effectiveness of different disinfectants used. 5.3 Location of ESBL alleles Indeed all representative strains of Escherichia coli were able to transfer genes by conjugation with conjugation frequency ranges of per donor cell; which was in several cases at least 1000-fold higher than the frequency than that of strain D reported in the UK, which had frequency 10-6 per donor cells [11]. This could explain why in this study Escherichia coli strains with bla CTX-M-15 are found as multiple clones. Also the spread of genetic elements could partly explain the three 85

86 cases of mixed infections where the same genetic element was found in all cases. The genetic element harboring the bla CTX-M-15 and the flanking ISEcp1 plasmid was cloned onto a plasmid, we obtained strong evidence for its transposition from the plasmid in many cases. Strains harboring the recombinant plasmid only formed small colonies suggesting negative selection for growth. Transposition of the cloned element from the plasmid to the chromosome resulted in rapidly growing bacteria as evidenced by the larger colonies obtained. We found that the transposition ability of the clone was high and was detected in nearly 50% of colonies tested, thus facilitating spread and emergence of this resistance allele in different isolates. All Escherichia coli isolates were typed for plasmid incompatibility groups and could be classified as FII, FIA- and FIB-replicon types. Unlike in most previously published studies [8-10], where an association of FII together with FIA and/or FIB was observed, no FII-replicon type could be detected in the Escherichia coli isolates from University Hospital Giessen while both IncFI and IncFII were observed in Escherichia coli isolates from Bugando Medical Centre. Plasmid analysis revealed that the majority of our transconjugants harboured large plasmids ranging from 50kb to 291kb. In 65% of the tested ESBL isolates from Giessen, a common IncFI plasmid of about 145.5kb could be demonstrated, while a 291kb IncFI was the commonest in Escherichia coli from BMC. A 291kb IncFI plasmid harbouring bla CTX-M-15 is the largest IncFI plasmid described in Escherichia coli. Most previous studies have found plasmids ranging from 7 to 200kb in association with bla CTX-M-15 [8-11]. The detection of other Enterobacteriaceae with the same ESBL type, as demonstrated in polymicrobial infections, suggests a species-overlapping transfer of 86

87 bla CTX-M-15. CTX-M ESBL genes are often associated with an ISEcp1 element which facilitates its transfer. In this study the ISEcp1 element was found in all isolates tested. The bla CTX-M-15 gene in Klebsiella pneumoniae isolates from Giessen were found to be located in the chromosome, a finding that has been described previously in Escherichia coli and recently in Klebsiella pneumoniae isolates from Spain [10, 87 ]. For the Klebsiella pneumoniae from BMC as in other studies, the bla CTX-M-15 allele was carried in multiple conjugative plasmids of different size, with one clone having multiple copies of the bla CTX-M-15 genes, one copy in the chromosome and two other copies in a 485kb and a 25kb plasmid. To date 485kb is the largest plasmid described in Klebsiella pneumoniae to be associated with the bla CTX-M-15 gene. 5.3 Conclusion and recommendation There is a predominant presence of bla CTX-M-15 allele among ESBL producing enteric gram negative bacteria in University Hospital Giessen and Bugando Medical Centre. Here we document the spread and persistence of ESBL habouring bla CTX-M- 15 by two mechanisms: lateral spread among Enterobacteriaceae by conjugation and transposition to create a reservoir, and clonal outbreaks deriving from a subset of these isolates. High diversity is observed among ESBL producing isolates from Tanzania, indicating the need for improving hospital hygiene. Also ESBL isolates are prevalent in our setting and they are multiply resistant to gentamicin, ciprofloxacin, tetracycline and sulphamethaxazole/trimethoprim. For the first time 87

88 we report the existence of 025:H4 ST 131 strain in Tanzania associated with bla CTX- M-15 also to the best of our knowledge, a novel Enterobacter spp carrying bla CTX-M-15 is reported for the first time in Africa and Enterobacter gergoviae carrying bla CTX-M- 15 worldwide. Routine detection of ESBL isolates and proper control measures are recommended so that appropriate management can be instituted. Multiple-resistant microorganisms (MROs) constitute a significant cause of socio-economic loss and remain among the most neglected diseases on the African continent. Thus studies that examine the source and spread of antibiotic resistance, and novel measures to implement their reduction in clinical settings are highly warranted. 88

89 1.0 REFERENCES 1. Abraham EP and Chain. E1940. An enzyme from bacteria able to destroy penicillin. Nature 146: Ghuysen JM Serine β-lactamases and penicillin binding proteins Annu Rev Microbiol 45: Datta N and Kontomichalou P Penicillinase synthesis controlled by infectious R factor in Enterobacteriaceae. Nature 208: Sougakoff W, Goussard S, Gerbaud G, et al Plasmid-mediated resistance to third-generation cephalosporins caused by point mutations in TEM-type penicillinase genes. Rev Infect Dis 10: Kilebe C, Niles BA, Meyer JF, Toledorf Neutzling RM and Weidman B Evolution of plasmid coded resistance to broad spectrum cephalosporins. Antimicrob Agent Chemother 28: Ishii Y, Ohno A, Taguchi H, Imago S, Ishiguru M and Matsuzwa H Cloning and sequence of the gene encoding a cefotaxime-hydrolyzing class A, β-lactamase isolated from Escherichia coli. Antimicrob Agent Chemother 39: Bonnet R Growing group of extended spectrum: the CTX-M enzymes. Antimicrob Agent Chemother 48: Carattoli A, Garcia-Fernandez A, Varesi P, Fortin D, Gerardi S, Penni A, Mancini C and Gorordano A Molecular Epidemiology of Escherichia 89

90 coli producing Extended Spectrum β- Lactamases isolated in Rome, Italy. J Clin Microbiol. 46: Carattoli A, Miriagou V, Bertin A, Loli A, Colinon C, Villa L, Whichard JM. and Rossolin GM Replicon typing of plasmids encoding resistance to new β-lactams. Emerg Infect Dis 12: Gonullu N, Aktas Z, Kayacan CB, Sacioglu M, Carattoli A, Yong DE and Walsh TR Dissemination of CTX-M-15 β- Lactamases Genes Carried on Inc FI and F11 plasmids among clinical isolates of Escherichia coli in a University Hospital in Instabul, Turkey. J Clin Microbiol 46: Karisiki E, Ellington MJ, Pike R, Warren RE, Livermore DM and Woodford N Molecular characterization of plasmids encoding CTX-M-15 β- lactamases from E. coli strains in the United Kingdom. J Antimicrob Chemother 58: Nicolas-Chanoine M, Blanco J, Leflon-Guibout V, Demarty R, Alonso M.P, Canica MM., Park Y, Lavigne JP, Pitout J, Johnson JR Intercontinental emergence of Escherichia coli clones 025:H4-ST131 producing CTX-M-15. J Antimicrob Chemother 61: Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, Baquero F, Canton R, Nordmann P Dissemination of Clonally Related Escherichia coli Strains Expressing Extended-Spectrum β Lactamase CTX-15. Emerg Infect Dis 14: Bell JM, Turnidge JD, Gales AC, Pfaller MA, Jones RN Prevalence of extended spectrum beta-lactamase (ESBL)-producing clinical isolates in the 90

91 Asia-Pacific region and South Africa: regional results from SENTRY Antimicrobial Surveillance Program ( ). Diagn Microbiol Infect Dis 42(3): Blomberg B, Jureen R, Manji KP, Tamim BS, Mwakagile DSM, Urassa WK, Fataki M, Msangi V, Tellevik MG, Maselle SY, and Langeland N High Rate of Fatal Cases of Pediatric Septicemia Caused by Gram-Negative Bacteria with Extended-Spectrum Beta-Lactamases in Dar es Salaam, Tanzania. J Clin Microbiol 43(2): Moyo SJ, Aboud S, Kasubi M, Lyamuya EF and Maselle SY Antimicrobial resistance among producers and non-producers of extended spectrum beta-lactamases in urinary isolates at a tertiary Hospital in Tanzania. BMC Res Notes, 3: Moland ES, Black JA, Hossain A, Hanson ND, Thomson KS and Poltumarthy S Discovery of CTX-M like extended spectrum-beta lactamase in Escherichia coli isolates from five US states. Antimicrob Agent Chemother 47: Bush K, Jacoby GA and Medeiros AA A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother 39: Jacoby GA and Medeiros AA More extended- spectrum β-lactamase. Antimicrob. Agent Chemother 35:

92 20. Jouvenot M, Deschaseaux ML, Royez M, Mougin C, Cooksey RC, Michel- Briand Y, and Adessi GL Molecular hybridization versus isoelectric focusing to determine TEM type P-lactamases in gram-negative bacteria. Antimicrob Agents Chemother 31: Sougakoff W, Goussard S, and Courvalin P The TEM-3 ß-lactamase, which hydrolyzes broad-spectrum cephalosporins, is derived from the TEM-2 penicillinase by two amino acid substitutions. FEMS Microbiol Lett 56: Nuesch-Inderbinen MT, Kayser FH, and Hachler H Survey and molecular genetics of SHV ß-lactamases in Enterobacteriaceae in Switzerland: two novel enzymes, SHV-11 and SHV-12. Antimicrob Agents Chemother 41: Ulises Garza-Ramos, Esperanza Martínez-Romero, Jesús Silva-Sánchez SHV-type Extended-spectrum ß-lactamase (ESBL) are encoded in related plasmids from enterobacteria clinical isolates from Mexico. Salud Publica Mex 49: Baraniak A, Fiett J, Hryniewicz W, Nordmann P, Gniadkowski M Ceftazidime-hydrolysing CTX-M-15 extended-spectrum beta-lactamase (ESBL) in Poland. J Antimicrob Chemother 50(3): Alobwede I, Mzali FH, Livermore DM, Hentige J, Todd N and Hawkey PM CTX-M extended Spectrum beta lactamase arrives in UK. J. Antimicrob Chemother 51:

93 26. Reynaud A, Péduzzi J, Barthélémy M, and Labia R Cefotaximehydrolyzing activity of the ß-lactamase of Klebsiella oxytoca D488 could be related to a threonine residue at position 140. FEMS Microbiol Lett 81: Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R, and Philippon A Beta-lactamases of Kluyvera ascorbata, probable progenitors of some plasmidencoded CTX-M types. Antimicrob Agents Chemother 46: Daniel F, Hall LMC, Gur D. and Livermore DM OXA-14 another extended- spectrum variant of OXA-10(PSE-2) β-lactamase from Pseudomonas aeruginosa. Antimicrob Agent Chemother 41: Nordmann P, Poirel L, Kubina M, Casetta A and Nass T Biochemicalgenetic characterization of 0XA-22 β-lactamase form Ralstonia (Pseudomonas) pickettii. Antimicrob Agent Chemother 44: Bauernfeind A, Stemplinger I, Jungwirth R, Mangold P, Mann SA, Akalin E, Ary O, Bal C and Casellas JM Characterization of beta- lactamase gene bla PER-2 which encodes an extended-spectrum class A beta-lactamase. Antimicrob Agent Chemother 40: Vahaboglu, H., Ozturk, R., Aygun, G., Coskunkan, F., Yaman, A., Kaygusuz, A. et al. (1997). Widespread detection of PER-1-type extended-spectrum β- lactamases among nosocomial Acinetobacter and Pseudomonas aeruginosa isolates in Turkey: a nationwide multicenter study. Antimicrob Agents and Chemother 41, Poirel L, Naas T, Guibert M, Chaibi EB, Labia R and Nordmann P Molecular and biochemical characterization of VEB-1 a novel class A extended 93

94 spectrum beta-lactamase encoded by an Escherichia coli intergrons gene. Antimicrob Agent Chemother 43: Poirel L, Rotimi VO, Mokaddas EM, Karim A, Nordmann P VEB-1-like extended-spectrum beta-lactamases in Pseudomonas aeruginosa, Kuwait. Emerg Infect Dis. May-Jun; 7(3): Jiang X, Ni Y, Jiang Y, Yuan F, Han L, Li M, Liu H, Yang L, Lu Y Outbreak of infection caused by Enterobacter cloacae producing the novel VEB-3 beta-lactamase in China. J Clin Microbiol 43(2): Galani I, Souli M, Chryssouli Z, Katsala D, and Giamarellou H First identification of an Escherichia coli clinical isolate producing both metallobeta-lactamase VIM-2 and extended-spectrum beta-lactamase IBC-1. Clin. Microbiol. Infect 10: Medeiros AA Nosocomial outbreaks of multiresistant bacteria: extendedspectrum ß-lactamases have arrived in North America. Ann Intern Med 119: Bradford PA, Urban C, Jaiswal A, Mariano N, Rasmussen BA, Projan SJ, Rahall JJ and Bush K SHV-7 a novel cefotaxime-hydrolyzing betalactamase identified in Escherichia coli isolates from hospitalized nursing home patient. Antimicrob Agent Chemother 39: Huppertz K., Noll I, Pfister W, Pietzcker T, Ziesing S and Wiedemann B. ESBL strains of E.coli and K. pneumoniae in GENARS HOSPITALS. 94

95 39. Pena C, Pujol M, Ricart A, Ardanuy C, Ayat J, Linares J, Garrigosa F, Ariza J and Gudiol F Risk factors for fecal carriage of Klebsiella pneumoniae producing extended spectrum β-lactamase in the Intensive Care Unit. J Hosp Infect 35: Bingen EH, Desjardins P, Arlet G, Bourgeois F, Mariani-Kurkdjian P, Zechovsky NY Lambert, Denamur E, Philippon A, and Elion J Molecular epidemiology of plasmid spread among extended broad-spectrum beta-lactamase-producing Klebsiella pneumoniae isolates in a pediatric hospital. J Clin Microbiol. 31: Bradford PA Extended-spectrum beta-lactamases in the 21st century: characterization, epidemiology, and detection of this important resistance threat. Clin Microbiol Rev 14: Akindele JA, I. Rotilu O Outbreak of neonatal Klebsiella septicemia: a review of antimicrobial sensitivities. Afr J Med Med Sci 26: Ndugulile F, Jureen R, Harthung S, Urassa W and Langeland N Extended Spectrum β-lactamases among gram negative bacteria of nosocomial origin from an Intensive Care Unit of a Tertiary facility in Tanzania. BMC infect Dis 5: Paterson DL, Bonomo RA Extended Spectrum- β-lactamase a clinical update. Clinic Microbiol Review 18: Livermore DM, Hawkey PM CTX-M: changing the face of ESBLs in the UK. J Antimicrob Chemother 56:

96 46. Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH Manual of clinical microbiology, 7 edn. Washington D. C.: ASM press. 47. CLSI. Standards for antimicrobial disk susceptibility tests. Approved standard. In Ninth edition Document M2-A9 Clinical and Laboratory Standards Institute, Wayne, PA; Drawz SM and Bonomo RA Three Decades of {beta}-lactamase Inhibitors. Clin. Microbiol. Rev 23: Menon T, Bindu D, Kumar CP, Nalini S, Thirunarayan MA Comparison of double disc and three dimensional methods to screen for ESBL producers in a tertiary care hospital. Indian J Med Microbiol. 24(2): Carter, M. W., K. J. Oakton, M. Warner, and D. M. Livermore Detection of extended-spectrum beta-lactamases in klebsiellae with the Oxoid combination disk method. J Clin Microbiol 38: Leverstein-van Hall MA, Fluit AC, Paauw A, Box AT, Brisse S, Verhoef J Evaluation of the E-test ESBL and the BD Phoenix, VITEK 1, and VITEK 2 automated instruments for detection of extended-spectrum betalactamases in multiresistant Escherichia coli and Klebsiella spp. J Clin Microbiol. 40(10): Oliver C, Stephane B and Edouard B Rapid and simple Determination of Escherichia coli Phylogenetic Group. Appl and Environ Microbiol 66 (10):

97 53. Catherine B, Zamfir O, Geoffroy S, Laurans G, Arlet G, Vu Thien H, Gouriou S and Denamur BE Genetic Background of Escherichia coli and Extended-Spectrum Beta-Lactamase Type. Emerg Infect Dis 11(1): Lucia P, Bartoloni A, Fiorelli C, Mantella A, Di Maggio T, Gamboa H, Gotuzzo E. Kronvall G, Paradisi F and Rossolin GM Rapid dissemination and Diversity of CTX-M Extended Spectrum β-lactamases Genes in Commensals Escherichia coli isolates from Healthy Children from low-resource setting in Latin America. Antimicrob Agent and Chemother 51 8: Brisse S, van Himbergen T, Kusters K Development of a rapid identification method for Klebsiella pneumoniae phylogenetic groups and analysis of 420 clinical isolates. Clin Microbiol Infect 10: Schmidt J, Jacobs E and Schmidt H Molecular Characterization of extended-spectrum lactamases in Enterobacteriaceae from patients of two hospitals in Saxony, Germany. J Med Microbiol 56: Aranzazu V, Coque TM, Garcia-San Miguel L, Vaquero F and Canton R Complex molecular epidemiology of extended-spectrum β- lactamases in Klebsiella pneumoniae: a long term perspective from a single institution in Madrid. J Antimicrob Chemother 61, Blanco M, Alonso MP, Nicolas-Chanoine MH, Dahbi G, Mora A, Blanco JE, López C, Cortés P, Llagostera M, Leflon-Guibout V, Puentes B, Mamani R, Herrera A, Coira MA, García-Garrote F, Pita JM, Blanco J Molecular epidemiology of Escherichia coli producing extended-spectrum {beta}- 97

98 lactamases in Lugo (Spain): dissemination of clone O25b:H4-ST131 producing CTX-M-15. J Antimicrob Chemother 63(6): David L: Paterson Treatment of ESBL producers. Enferm Infecc Microbiol Clin 2: Paterson DL Recommendation for treatment of severe infections caused by Enterobacteriaceae producing extended-spectrum b-lactamases (ESBLs). Clin Microbiol Infect 6: Zanetti G, Bally F, Greub G, Garbino J, Kinge T, Lew D, Romand JA, Bille J, Aymon D, Stratchounski L, Krawczyk L, Rubinstein E, Schaller MD, Chiolero, R, Glauser MP, Cometta A, Cefepime Study Group Cefepime versus imipenem-cilastatin for treatment of nosocomial pneumonia in intensive care unit patients: a multicenter, evaluator-blind, prospective, randomized study. Antimicrob Agents Chemother 47(11): Hope R, Warner M, Potz NA, Fagan EJ, James D, Livermore DM Activity of tigecycline against ESBL-producing and AmpC-hyperproducing Enterobacteriaceae from south-east England. J Antimicrob Chemother 58(6): Drancourt M, Bollet C, Carlioz A, Martelin R, Gayral JP and Raoult D S ribosomal DNA sequence analysis of a large collection of environmental and clinical unidentifiable bacterial isolates. J Clin. Microbiol 38: Yves De G, Avesami V, Berhin C, Delwee M and Glupenzynskii Y Evaluation of THERMOFISHER combinations disc for detection of extended A-Lactamases. J Antimicrob Chemother 52:

99 65. Kiratisin P, Apisarnthanarak A, Laesripa C, Saifon P Molecular Characterization and Epidemiology of Extended-Spectrum-_-Lactamase- Producing Escherichia coli and Klebsiella pneumoniae Isolates Causing Health Care-Associated Infection in Thailand, Where the CTX-M Family Is Endemic. Antimicrob Agents Chemother 52: Clermont O, Bonacorsi S, Bingen E Rapid and simple Determination of Escherichia coli Phylogenetic Group. Appl Environ Microbiol 66: Bret MB, Gordon PH, and Anthony JZ A general method for detecting and sizing large plasmids. Analytical, Biochemistry 226: Martinez E, Bartolome B, de la Cruz F pacy184- derived 1 cloning vectors containing the multiple cloning site and laczy reporter gene of puc8 2 and puc18/19 plasmids. Gene 68: Dice LR Measures of the amount of ecologic associations between species. J Ecol 26: Hunter PR, Fraser CA.M Application of a numerical index of discriminatory power to a comparison of four physiochemical typing methods for Candida albicans. J Clin Microbiol 27: Hunter PR, Gaston MA Numerical Index of the discriminatory ability of typing systems: an application of Simpson Index of diversity. J Clin Microbiol; 26: O Toole GA, Pratt LA, Watnick PI, Newman DK, Weaver VB, and Kolter R Genetic approaches to study of biofilms. Methods Enzymol 310:

100 73. Babin GS, Livermore DM Are SHV beta-lactamases universal in Klebsiella pneumoniae? Antimicrob Agents Chemother 44: Asensio A, Oliver A, Gonzalez-Diego P, Baquero F, Perez-Diaz JC, Ros P, Cobo J, Palacios M, Lasheras D, Canton R Outbreak of a multiresistant Klebsiella pneumoniae strain in an intensive care unit: antibiotic use as risk factor for colonization and infection. Clin Infect Dis 30: Du B, Long Y, Liu H, Chen D, Liu D, Xu Y, Xie X Extended spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae blood stream infection: risk factors and clinical outcome. Intensive Care Med 28: Pessoa-Silva CL, Meurer Moreira B, Camara V, Flannery B, Almeida MC, Mello Sampaio JL, Martins TL, Vaz Miranda LE, Riley LW, Gerberding L Extended-spectrum beta-lactamase-producing Klebsiella pneumoniae in a neonatal intensive care unit: risk factors for infection and colonization. J Hosp Infect 53: Jones SL, Nguyen VK, Nguyen TMP, Athan E Prevalence of multiresistant Gram-negative organisms in a surgical hospital in Ho Chi Minh Cit, Vietnam. Tropical Med International Health 11: Livermore DM Beta-lactamases in laboratory and clinical resistance. Clin Microbiol Rev, 8: Jain A, Roy I, Gupta MK, Kumar M and Agarwal SK Prevalence of extended-spectrum lactamase producing Gram-negative bacteria in septicaemic neonates in a tertiary care hospital. J Med Microbiol 52:

101 80. Tessin I, Trollfors B, Thlringer K Incidence and etiology of neonatal septicemia and meningitis Western Sweden. Acta Pediatr Scand 79: Monga K, Fernandez A, Deodhar L Changing bacteriological patterns in neonatal septicemia. Indian J Pediatr 53: Smet A, Martel A, Persoons D, Dewulf J, Heyndrikx N, Claeys G, Lontie M, Van Meensel B, Herman L, Haesebrouk F, Butaye P Characterization of extended spectrum beta-lactamases produced by Escherichia coli isolated from hospitalized and non-hospitalized patients: emergence of CTX-M-15 producing strains causing Urinary tract infections. Microb Drug Resist 16(2): Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M Escherichia coli sequence type 131 as the major Cause of serious Multidrug- Resistant E.coli infections in the United States. Clin Infect Dis 51: Urban C, Mariano N, Bradford PA, Tuckman M, Segal-Maurer S, Wehbeh W, Grenner L, Colon-Urban R, Johnston B, Jhonson JR, Rahal JJ Identification of CTX-M beta-lactamases in Escherichia coli from hospitalized patients and residents of long term care facilities. Diagn Microbiol infect Dis 66(4): Peirano G, Costello M, Pitout JDD Molecular characteristics of extended spectrum-β-lactamase- producing Escherichia coli from the Chicago area; high prevalence of ST131 producing CTX-M-15 in community hospitals. Int J Antimicrob Agents 36: Guenther S, Grobbel M, Beutlich J, Bethe A, Friedrich ND, Goedecke A, Lübke-Becker A, Guerra B, Wieler LH, Ewers C CTX-M-15-type 101

102 extended-spectrum beta-lactamases-producing Escherichia coli from wild birds in Germany. Environ Microbiol Rep 10: Coelho A, Gonzalez-Lopez JJ, Miro E, Alonso-Tarres C, Mirelis B, Larrosa MN, Bartolome RM, Andreu A, Navarro F, Johson Jr, Prats G Characterisation of CTX-M-15 encoding gene in Klebsiella pneumoniae strains from the Barcelona metropolitant area. Plasmid diversity and chromosomal Intergration. Int J Antimicrob Agents 36,

103 Appendix 1: ESBL producing E. coli, ESBL allele, Plasmid incompatibility groups and antibiotic-susceptibility results Isolat e Ward Specimen ESBL type MIC µg/ml Resistance to antibiotics other than Beta-lactams Incompatibility group FEP TGC 3 Urology Blood Tem-144 >256 - GM, CIP, SXT, TET FIA, FIB B2 X5 6 Urology Urine CTX-M GM, CIP, SXT, FIA, FIB A X12 8 Surgical Urine CTX-M-15,Tem1b GM, CIP, SXT, TET FIA, FIB A X5 9 Surgical W. swab Tem GM, SXT, TET FIA, FIB A X13 10 Surgical W. swab CTX-M-15 > GM, SXT, TET, CIP FIA, FIB A X10 12 ICU Tra. swab CTX-M GM, SXT, TET, CIP FIA, FIB B1 X13 13 ICU Tra. swab CTX-M GM, SXT, TET, CIP FIA, FIB B1 X13 16 Int. Medicine Urine CTX-M-15,Tem GM, SXT, TET, CIP FIA, FIB B2 X5 19 Int. Medicine W. swab CTX-M GM, SXT, TET, CIP FIA, FIB A X13 21 OB/GY CX. swab Tem CIP, TET FIA B2 X7 22 Int. Medicine Phar. swab CTX-M CIP, SXT, TET FIA, FIB D X3 23 Paediatric Blood Tem GM, CIP, TET, SXT FIB B2 X6 26 Surgical Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA B2 ND 28 OB/GY Vag. swab Tem GM, CIP, TET, SXT FIA D X9 38 Int. Medicine Urine CTX-M-1, Tem-1 ND 0.25 SXT, TET FIA B2 ND 44 Urology Urine CTX-M-15,Tem GM, CIP FIA, FIB A X5 45 Urology Urine Tem CIP, SXT FIA, FIB B2 X5 47 Int. Medicine Urine CTX-M NONE FIA, FIB B2 X5 48 ICU Sputum CTX-M GM, CIP, SXT, TET FIA, FIB D X13 Phylo. group PFGE type 103

104 Isolate Ward Specimen ESBL type MIC µg/ml Appendix 1 continued Resistance to antibiotics other than Beta-lactams Incomp-atibility group Phylo.group FEP TGC 49 Int. Medicine Phar. swab CTX-M-1, Tem TET, SXT FIB A X9 50 Paediatric Eye swab CTX-M-1, Tem TET, SXT FIA, FIB B1 X13 53 OB/GY CX. swab CTX-M-28,Tem GM, CIP, TET, SXT FIA, FIB A X13 54 Orthopaedic Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA, FIB A X9 55 Int. Medicine Blood CTX-M GM, CIP, SXT, TET FIA, FIB B2 X Urology Int. Medicine Urine Sputum CTX-M-15 Tem-143 > GM, CIP, TET GM, CIP, SXT FIA, FIB FIA, FIB 63 ICU Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA, FIB D X9 64 Int. Medicine Urine CTX-M GM, CIP, TET, SXT FIA, FIB A X4 66 Int. Medicine Urine CTX-M-15,Tem GM, CIP,TET,SXT FIA, FIB A X9 67 ICU Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA, FIB A X9 68 Urology Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA, FIB B2 X5 70 Urology Urine CTX-M-15,Tem-1 >256 2 GM, CIP, TET, SXT FIA, FIB B2 X5 72 Paediatric Urine CTX-M-1,Tem SXT, TET FIA A X5 73 Int. Medicine Urine CTX-M-1,Tem GM, CIP, TET, SXT FIB A X8 74 Surgical W. swab CTX-M-15,Tem-1 > GM, CIP, TET, FIA B2 X5 77 Paediatric Urine Tem GM, CIP, TET, SXT FIB D X5 81 Int. Medicine Urine CTX-M-28,Tem CIP, TET, SXT FIB D X6 83 Int. Medicine Urine CTX-M-15,Tem GM, CIP, TET FIA, FIB B2 X12 87 Int. Medicine Eye swab CTX-M-15,Tem GM, SXT, TET, CIP FIA, FIB D X5 88 Int. Medicine Urine CTX-M-15,Tem GM, SXT, TET, CIP FIA, FIB A X9 90 Int. Medicine Urine CTX-M GM, CIP, TET, SXT FIA, FIB A X12 91 Urology Urine Tem CIP, SXT, TET FIB A X9 92 Paediatric Urine CTX-M-15 > GM, TET, SXT FIA, FIB B2 X5 94 Int. Medicine Blood CTX-M GM, CIP, SXT, TET FIA, FIB A X11 B2 B2 PFGE group X5 X12 104

105 Appendix 1 continued Isolate Ward Specimen ESBL type MIC µg/ml Resistance to antibiotics other than Beta-lactams Incomp-atibility group FEP TGC 95 Surgical W. swab CTX-M SXT FIA, FIB A X9 97 Int. Medicine Sputum Tem GM, CIP, SXT, TET FIA, FIB B1 X2 99 Int. Medicine Urine CTX-M-15,Tem CIP, TET, SXT FIA B2 X5 101 ICU Urine CTX-M-15,Tem GM, TET, SXT FIA, FIB B2 X6 102 Surgical Sputum CTX-M-15,Tem GM, TET, SXT, CIP FIA, FIB B2 X1 103 Int. Medicine Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA, FIB B2 X Int. Medicine Urine CTX-M GM, CIP, TET, SXT FIA, FIB B2 X Int. Medicine Urine NEG 32 - GM, CIP, TET, SXT FIA, FIB D X5 106 Int. Medicine Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA B2 X5 107 Int. Medicine Swab Negative - GM, CIP, TET, SXT FIB B2 X Int. Medicine CX. swab Tem GM, CIP, SXT FIA, FIB B2 X6 109 Int. Medicine Blood CTX-M CIP, TET, SXT FIA B2 X5 110 Urology Urine CTX-M GM, CIP, TET, SXT FIA, FIB D X4 112 Int. Medicine Urine CTX-M-15 > GM, CIP, TET, SXT FIA, FIB B2 X4 113 Urology Urine Tem GM, CIP, TET, SXT FIB B2 X9 114 Urology Urine CTX-M-15,Tem GM, CIP, TET, SXT FIA, FIB D X4 79 ICU Blood CTX-M-15,Tem GM, CIP, TET, SXT FIA B1 X5 27 Int. Medicine Urine CTX-M GM, CIP, TET, SXT FIA, FIB A ND 32 Int. Medicine Sputum CTX-M-15 > GM, CIP, TET, SXT FIA, FIB B2 X5 Phylo. group PFGE group 105

106 106

Management of Extended Spectrum Beta- Lactamase (ESBL) Producing Enterobacteriaceae in health care settings

Management of Extended Spectrum Beta- Lactamase (ESBL) Producing Enterobacteriaceae in health care settings Management of Extended Spectrum Beta- Lactamase (ESBL) Producing Enterobacteriaceae in health care settings Dr. Mary Vearncombe PIDAC-IPC February 2012 Objectives: To provide an overview of the RP/AP Annex

More information

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity

Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Originally published as:

Originally published as: Originally published as: Dedeic-Ljubovic, A., Hukic, M., Pfeifer, Y., Witte, W., Padilla, E., López-Ramis, I., Albertí, S. Emergence of CTX-M-15 extended-spectrum β-lactamase-producing Klebsiella pneumoniae

More information

Open Access Article pissn 0976 3325 eissn 2229 6816

Open Access Article  pissn 0976 3325 eissn 2229 6816 Original Article A STUDY OF EXTENDED SPECTRUM β-lactamase (ESBL) AND AmpC β-lactamase PRODUCING KLEBSIELLA PNEUMONIAE IN NEONATAL INTENSIVE CARE UNIT AT TERTIARY CARE HOSPITAL, AHMEDABAD Modi Dhara J 1,

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN

More information

Mamdouh Yones Ali Ahmed

Mamdouh Yones Ali Ahmed Characterization and Molecular Epidemiology of Extended-Spectrum-ß-Lactamase-Producing Escherichia coli derived from University Hospitals of Egypt and Germany Inaugural Dissertation Submitted to the Faculty

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Disc Diffusion Susceptibility Methods

Disc Diffusion Susceptibility Methods Disc Diffusion Susceptibility Methods Introduction When a filter paper disc impregnated with a chemical is placed on agar the chemical will diffuse from the disc into the agar. This diffusion will place

More information

FACULTY OF MEDICAL SCIENCE

FACULTY OF MEDICAL SCIENCE Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research

More information

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding

More information

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro

More information

Urinary tract infections caused by extended spectrum β-lactamase (ESBL) producing Escherichia coli and Klebsiella pneumoniae

Urinary tract infections caused by extended spectrum β-lactamase (ESBL) producing Escherichia coli and Klebsiella pneumoniae African Journal of Biotechnology Vol. 10(73), pp. 16661-16666, 21 November, 2011 Available online at http://www.academicjournals.org/ajb DOI: 10.5897/AJB11.2449 ISSN 1684 5315 2011 Academic Journals Full

More information

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Bacterial Transformation and Plasmid Purification. Chapter 5: Background Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

Global Spread of Carbapenemase- Producing Klebsiella pneumoniae

Global Spread of Carbapenemase- Producing Klebsiella pneumoniae Global Spread of Carbapenemase- Producing Klebsiella pneumoniae These pathogens arose in the mid-1990s and continue to spread, leaving few options for treating infected patients John Quale John Quale is

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification

More information

Venkatadri Babu. et al. / International Journal of Biological & Pharmaceutical Research. 2014; 5(1): 66-70.

Venkatadri Babu. et al. / International Journal of Biological & Pharmaceutical Research. 2014; 5(1): 66-70. 66 e- ISSN 0976-3651 Print ISSN 2229-7480 International Journal of Biological & Pharmaceutical Research Journal homepage: www.ijbpr.com IJBPR MULTIDRUG RESISTANT ESCHERICHIA COLI AND KLEBSIELLA PNEUMONIAE

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Antimicrobial Resistance and Human Health

Antimicrobial Resistance and Human Health Antimicrobial Resistance and Human Health Dearbháile Morris, Discipline of Bacteriology, School of Medicine, National University of Ireland, Galway The microbial world The is a gene Talk cloud in a The

More information

Transformation Protocol

Transformation Protocol To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic

More information

Introduction to cloning

Introduction to cloning 1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria

More information

TransformAid Bacterial Transformation Kit

TransformAid Bacterial Transformation Kit Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein

Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie

Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie 0 HELMHOLTZ I ZENTRUM FÜR INFEKTIONSFORSCHUNG Technische Universität Braunschweig Institut

More information

BD Phoenix Automated Microbiology System

BD Phoenix Automated Microbiology System BD Phoenix Automated Microbiology System Resistance Detection Workflow Efficiency Analysis and Communication BD Diagnostics 7 Loveton Circle Sparks, MD 115-0999 800.638.8663 www.bd.com/ds CHROMagar is

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

DNA: A Person s Ultimate Fingerprint

DNA: A Person s Ultimate Fingerprint A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

HOW TO WRITE AN UNKNOWN LAB REPORT IN MICROBIOLOGY

HOW TO WRITE AN UNKNOWN LAB REPORT IN MICROBIOLOGY HOW TO WRITE AN UNKNOWN LAB REPORT IN MICROBIOLOGY GENERAL Unknown reports in microbiology are written in scientific format. Scientific writing is written differently from other types of writing. The results

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Beta-Lactamase Encoding Gene Among Extended Spectrum B-Lactamase Positive Wound Isolates of Pseudomonas

Beta-Lactamase Encoding Gene Among Extended Spectrum B-Lactamase Positive Wound Isolates of Pseudomonas Arch Pediatr Infect Dis. 2015 October; 3(4): e26362. Published online 2015 October 12. doi: 10.5812/pedinfect.26362 Research Article Molecular Detection of bla VEB-1 Beta-Lactamase Encoding Gene Among

More information

CLONING IN ESCHERICHIA COLI

CLONING IN ESCHERICHIA COLI CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

Tigecycline and intravenous fosfomycin zone breakpoints equivalent to the EUCAST MIC criteria for Enterobacteriaceae

Tigecycline and intravenous fosfomycin zone breakpoints equivalent to the EUCAST MIC criteria for Enterobacteriaceae Brief Original Article Tigecycline and intravenous fosfomycin zone breakpoints equivalent to the EUCAST MIC criteria for Enterobacteriaceae Fernando Pasteran, Celeste Lucero, Melina Rapoport, Leonor Guerriero,

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)

Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are

More information

Urinary Tract Infections

Urinary Tract Infections Urinary Tract Infections Overview A urine culture must ALWAYS be interpreted in the context of the urinalysis and patient symptoms. If a patient has no signs of infection on urinalysis, no symptoms of

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Received 22 March 2006/Returned for modification 2 May 2006/Accepted 14 September 2006

Received 22 March 2006/Returned for modification 2 May 2006/Accepted 14 September 2006 JOURNAL OF CLINICAL MICROBIOLOGY, Nov. 2006, p. 4085 4094 Vol. 44, No. 11 0095-1137/06/$08.00 0 doi:10.1128/jcm.00614-06 Copyright 2006, American Society for Microbiology. All Rights Reserved. Two-Center

More information

Microbiology BIOL 275 DILUTIONS

Microbiology BIOL 275 DILUTIONS DILUTIONS Occasionally a solution is too concentrated to be used as is. For example, when one is performing manual blood counts, the blood contains too many cells to be counted as such. Or when performing

More information

Biological Sciences Initiative

Biological Sciences Initiative Biological Sciences Initiative HHMI Student Activities Measuring Antibiotic Resistance Introduction: You might be aware that antibiotics were once thought of as a magic bullet; a nearly perfect drug for

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

Antibiotic resistance does it matter in paediatric clinical practice? Jette Bangsborg Department of Clinical Microbiology Herlev Hospital

Antibiotic resistance does it matter in paediatric clinical practice? Jette Bangsborg Department of Clinical Microbiology Herlev Hospital Antibiotic resistance does it matter in paediatric clinical practice? Jette Bangsborg Department of Clinical Microbiology Herlev Hospital Background The Department of Clinical Microbiology at Herlev Hospital

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

360 Master Mix. , and a supplementary 360 GC Enhancer.

360 Master Mix. , and a supplementary 360 GC Enhancer. Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012

Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012 Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4

More information

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA

Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols

More information

HUSRES Annual Report 2008 Martti Vaara. www.huslab.fi www.intra.hus.fi

HUSRES Annual Report 2008 Martti Vaara. www.huslab.fi www.intra.hus.fi HUSRES Annual Report 2008 Martti Vaara www.huslab.fi www.intra.hus.fi The basis of this HUSRES 2008 report is the HUSLAB/Whonet database 2008, which contains susceptibility data on about 180.000 bacteria

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

The National Antimicrobial Resistance Monitoring System (NARMS)

The National Antimicrobial Resistance Monitoring System (NARMS) The National Antimicrobial Resistance Monitoring System (NARMS) Strategic Plan 2012-2016 Table of Contents Background... 2 Mission... 3 Overview of Accomplishments, 1996-2011... 4 Strategic Goals and Objectives...

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Terra PCR Direct Polymerase Mix User Manual

Terra PCR Direct Polymerase Mix User Manual Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain

More information

Prevalence of Metallo-β-lactamases Encoding Genes Among Pseudomonas

Prevalence of Metallo-β-lactamases Encoding Genes Among Pseudomonas Avicenna J Clin Microb Infec. 2014 May; 1(1): e19216. Published online 2014 April 28. DOI: 10.17795/ajcmi-19216 Research Article Prevalence of Metallo-β-lactamases Encoding Genes Among Pseudomonas aeruginosa

More information

The 14th EURL-AR Proficiency Test - enterococci, staphylococci and E. coli 2013. Lina Cavaco Susanne Karlsmose Rene S. Hendriksen Frank M.

The 14th EURL-AR Proficiency Test - enterococci, staphylococci and E. coli 2013. Lina Cavaco Susanne Karlsmose Rene S. Hendriksen Frank M. The 14th EURL-AR Proficiency Test - enterococci, staphylococci and E. coli 2013 Lina Cavaco Susanne Karlsmose Rene S. Hendriksen Frank M. Aarestrup The 14TH EURL-AR Proficiency Test Enterococci, Staphylococci

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

One Shot TOP10 Competent Cells

One Shot TOP10 Competent Cells USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.

More information

Liofilchem - Antibiotic Disk Interpretative Criteria and Quality Control - F14013 - Rev.7 / 20.02.2013

Liofilchem - Antibiotic Disk Interpretative Criteria and Quality Control - F14013 - Rev.7 / 20.02.2013 Liofilchem Antibiotic Disk Interpretative Criteria and Quality Control F0 Rev.7 /.02. Amikacin AK Amoxicillin + Clavulanic acid AUG (+) ATCC 352 Coagulasenegative staphylococci Amoxicillin + Clavulanic

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

The 11 th EURL-AR Proficiency Testing Salmonella and Campylobacter 2011. Susanne Karlsmose Lina M. Cavaco Rene S. Hendriksen Frank M.

The 11 th EURL-AR Proficiency Testing Salmonella and Campylobacter 2011. Susanne Karlsmose Lina M. Cavaco Rene S. Hendriksen Frank M. The 11 th EURL-AR Proficiency Testing Salmonella and Campylobacter 2011 Susanne Karlsmose Lina M. Cavaco Rene S. Hendriksen Frank M. Aarestrup European Union Reference Laboratory - Antimicrobial Resistance

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Welcome to Implementing Inquirybased Microbial Project. Veronica Ardi, PhD

Welcome to Implementing Inquirybased Microbial Project. Veronica Ardi, PhD Welcome to Implementing Inquirybased Microbial Project Veronica Ardi, PhD Microbiology Laboratory Courses CourseSmart: ebook resources http://instructors.coursesmart.com/ Microbiology Laboratory Courses

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

HighPure Maxi Plasmid Kit

HighPure Maxi Plasmid Kit HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer

More information

SEA-HLM-415 Distribution: General. Establishment of national laboratory-based surveillance of antimicrobial resistance

SEA-HLM-415 Distribution: General. Establishment of national laboratory-based surveillance of antimicrobial resistance SEA-HLM-415 Distribution: General Establishment of national laboratory-based surveillance of antimicrobial resistance World Health Organization 2011 All rights reserved. Requests for publications, or for

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)

GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) 1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial

More information

Version 12 May 2013. BSAC Methods for Antimicrobial Susceptibility Testing. All enquiries to: Mandy Wootton. Email: [email protected].

Version 12 May 2013. BSAC Methods for Antimicrobial Susceptibility Testing. All enquiries to: Mandy Wootton. Email: Mandy.Wootton@wales.nhs. BSAC Methods for Antimicrobial Susceptibility Testing Version 12 May 2013 All enquiries to: Mandy Wootton Email: [email protected] Telephone: +44 (0) 2920 746581 Contents Page Working Party members

More information

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.

A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently. Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday

More information

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

British Society for Antimicrobial Chemotherapy

British Society for Antimicrobial Chemotherapy British Society for Antimicrobial Chemotherapy BSAC to actively support the EUCAST Disc Diffusion Method for Antimicrobial Susceptibility Testing in preference to the current BSAC Disc Diffusion Method

More information