Flt3-ITD, NPM1 and CEBPα mutation detection in AML
|
|
|
- Brittney Walton
- 9 years ago
- Views:
Transcription
1 Flt3-ITD, NPM1 and CEBPα mutation detection in AML a collaborative diagnostic assay setup Friedel Nollet, Ph.D., AZ Sint-Jan Brugge-Oostende AV
2 Acute Myeloïd Leukemia
3 AML subgroups (WHO2008 classification) AML with recurrent genetic abnormalities AML with t(8;21) AML1/ETO AML with inv(16) CBFB/MYH11 APL with t(15;17) PML/RARa AML with t(9;11) MLLT3/MLL (==MLL/AF9) AML with t(6;9) DEK/NUP214 (==DEK/CAN) AML with inv(3) ot t(3;3) RPN-EVI1 AML with t(1;22) RBM1/MKL1 Provisional AML with mutated NPM1 Provisional AML with mutated CEBPa AML with myelodysplasie-related changes AML, NOS Myeloid sarcoma Myeloid proliferations related to Down Syndrome Blastic plasmacytoid dendritic cell neoplasm AML molecular prognostic markers All AML CN-AML (45%) Outcome Flt3-ITD 15%-25% 25%-35% Adverse NPM1 25%-35% 45%-60% Favorable CEBPa 5%-15% 10%-20% Favorable
4 Flt3 mutations in AML TKD D835
5 Nucleophosmin-1 mutations in AML * Falini, B. et al. NEJM 2005; 352:
6 CEBPα mutations in AML Green et al., 2010, JCO 28(16)
7 Double CEBPα mutations Wouters et al., Blood (2009) 113:
8 Participating Centres ULB Erasme, Hakim El Housni Jesse Ziekenhuis, Hasselt, Femke Hillen, Brigitte Maes Institut de Pathology et de Genetique, Gosselies, Pascal Vannuffel UZBrussel, Marleen Bakkus CHU University de Liège, Frédéric Lambert Ziekenhuis Netwerk Antwerpen, Pieter Deschouwer, Annemie Celens AZ Sint-Jan, Brugge, Friedel Nollet, Johan Billiet UZGent, Barbara Denys UZLeuven, Hilde Vranckx, Wim De Kelver Heilig Hart Ziekenhuis Roeselare, Elke Boone St-Augustinus, Antwerpen, Philippe van Lint.
9 Primer selection
10 1: Biotechniques Jun;20(6):1004-6, Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Brownstein MJ, Carpten JD, Smith JR. Taq DNA polymerase can catalyze non-templated addition of a nucleotide (principally adenosine) to the 3' end of PCR-amplified products. Recently, we showed that this activity, which is primer-specific, presents a potential source of error in genotyping studies based on the use of short tandem repeat (STR) markers. Furthermore, in reviewing our data, we found that non-templated nucleotide addition adjacent to a 3' terminal C is favored and that addition adjacent to a 3' terminal A is not. It was clear, however, that features of the template in addition to the 3' terminal base also affect the fraction of product adenylated. To define consensus sequences that promote or inhibit product adenylation, we transplanted sequences between the 5' ends of the reverse primers of markers that are adenylated and those of markers that are not adenylated. It proved difficult to identify a single sequence capable of protecting the products of all markers from non-templated addition of nucleotide. On the other hand, placing the sequence GTTTCTT on the 5' end of reverse primers resulted in nearly 100% adenylation of the 3' end of the forward strand. This modification or related ones (called "PIG-tailing") should facilitate accurate genotyping and efficient T/A cloning.
11 PCR optimisation F. Nollet, AZ Sint Jan, Brugge
12 Singleplex or multiplex genescan TAD1 TAD2 bzip NPM1 FLT3-ITD TAD1 + TAD2 TAD2 wt TAD1 wt + 5bp bzip + NPM1 + FLT3 bzip wt NPM1 wt + 4bp FLT3 wt M. Bakkus, UZBrussel
13 1bp resolutie gctttc gctttcc: M. Bakkus, UZBrussel
14 Example of Multiplex GeneScan NPM1 +4bp NPM1 wild type Flt3 wild type Flt3-ITD bzip TAD2 TAD2 wild type TAD2 +5bp F. Nollet, AZ Sint Jan, Brugge
15 NPM : actctctggtggtagaatgaaaaatagatgttgaactatgcaaagagaca tttaatttattgatgtctatgaagtgttgtggttccttaaccacatttct ttttttttttttccaggctattcaagatctctggcagtggaggaagtctc tttaagaaaatagtttaaacaatttgttaaaaaattttccgtcttatttc atttctgtaacagttgatatctggctgtcctttttataatgcagagtgag aactttccctaccgtgtttgataaatgttgtccaggttctattgccaaga atgtgttgtccaaaatgcc
16
17 Interrun
18 Flt3-ITD RNA versus DNA Conclusion : sensitivity Flt3-ITD on DNA is ~5% on RNA ~1%
19 linearity and sensitivity Conclusion : semi-quantitative analysis sensitivity is ~ 5% (sensitivity of Flt3-ITD detection on RNA is ~1%)
20 Sample Exchange
21 Conclusions collaborative reflection upon strategy and primer selection for Flt3-ITD, NPM1 and CEBPα is rewarded by straightforward optimisation and setup de facto standardization of assay
22 THE END
23 Example Without LNA With LNA Hakim El Housni, ULB Erasme
Acute leukemias and myeloproliferative neoplasms
Acute leukemias and myeloproliferative neoplasms GERGELY SZOMBATH SEMMELWEIS UNIVERSITY OF MEDICINE IIIRD. DEPARTMENT OF INTERNAL MEDICINE Basics of acute leukemia Neoplastic disease Cell of origin is
Clinical Use of Karyotype and Molecular Markers In Curing Acute Myeloid Leukemia
Clinical Use of Karyotype and Molecular Markers In Curing Acute Myeloid Leukemia Clara D. Bloomfield, M.D. Distinguished University Professor The Ohio State University Comprehensive Cancer Center, and
ncounter Leukemia Fusion Gene Expression Assay Molecules That Count Product Highlights ncounter Leukemia Fusion Gene Expression Assay Overview
ncounter Leukemia Fusion Gene Expression Assay Product Highlights Simultaneous detection and quantification of 25 fusion gene isoforms and 23 additional mrnas related to leukemia Compatible with a variety
PROGRAMMA / PROGRAM. Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol
Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol PROGRAMMA / PROGRAM Molecular Biology and Cytometry Course 16 th -17 th May 2013, SCK CEN, Mol MB&C course MOL 2013 programma / program
AML- new studies. Moderator Prof. Edo Vellenga. 1st author / speaker Mojca Jongen-Lavrencic
AML- new studies Moderator Prof. Edo Vellenga 1st author / speaker Mojca Jongen-Lavrencic Belangenverklaring In overeenstemming met de regels van de Inspectie van de Gezondheidszorg (IGZ) Naam: Organisatie:
APPROACH TO THE DIAGNOSIS AND TREATMENT OF ACUTE MYELOID LEUKEMIA (AML) Hematology Rounds Thurs July 23, 2009 Carolyn Owen
APPROACH TO THE DIAGNOSIS AND TREATMENT OF ACUTE MYELOID LEUKEMIA (AML) Hematology Rounds Thurs July 23, 2009 Carolyn Owen Outline Diagnosis Prognosis Treatment AML Elderly AML APL Future directions AML
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
DNA Methylation in MDS/MPD/AML: Implications for application
DNA Methylation in MDS/MPD/AML: Implications for application James G. Herman, M.D. Professor of Oncology Evelyn Grollman Glick Scholar The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Disclosures
Subtypes of AML follow branches of myeloid development, making the FAB classificaoon relaovely simple to understand.
1 2 3 4 The FAB assigns a cut off of 30% blasts to define AML and relies predominantly on morphology and cytochemical stains (MPO, Sudan Black, and NSE which will be discussed later). Subtypes of AML follow
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?
BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
Basics of AML. Acute myeloid leukemia and related myeloid neoplasms: WHO 2008 brings us closer to understanding clinical behavior
Acute myeloid leukemia and related myeloid neoplasms: WHO 2008 brings us closer to understanding clinical behavior No conflicts of interest to disclose Steven Devine, MD The Ohio State University Common
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
GENETIC PROGNOSTIC FACTORS IN ACUTE MYELOID LEUKEMIA
GENETIC PROGNOSTIC FACTORS IN ACUTE MYELOID LEUKEMIA PhD dissertation Magdalena Renata Koszarska Eötvös Loránd University, Faculty of Science Doctoral School of Biology Classical and Molecular Genetics
Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia
Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia Subarna Sinha PhD Department of Computer Science Principal Investigator: David Dill Daniel
PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA PROGNOSIS IN ACUTE MYELOID LEUKEMIA
PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA UNFAVORABLE Advanced age High leukocyte count at diagnosis Presence of myeloid antigens Late achievement of CR Chromosomal abnormalities: t(9:22)(q34:q11) t(4;11)(q21;q23)
Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra
GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
QPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
Difficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
Leukemias and Lymphomas: A primer
Leukemias and Lymphomas: A primer Normal blood contains circulating white blood cells, red blood cells and platelets 700 red cells (oxygen) 1 white cell Neutrophils (60%) bacterial infection Lymphocytes
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
BHS COMMITTEES MEETING 30 January 2014
BHS COMMITTEES MEETING 30 January 2014 Regulatory affairs JACIE Ivan Van Riet [email protected] Scopes Supporting implementation of JACIE standards in national SCT centres with the aim to obtain
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
NGS e malattie mieloproliferative
NGS e malattie mieloproliferative Matteo G Della Porta Department of Hematology Oncology, Fondazione IRCCS Policlinico S. Matteo, University of Pavia Medical School, Pavia, Italy [email protected]
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
Molecular diagnostics is now used for a wide range of applications, including:
Molecular Diagnostics: A Dynamic and Rapidly Broadening Market Molecular diagnostics is now used for a wide range of applications, including: Human clinical molecular diagnostic testing Veterinary molecular
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications
PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
Commonly Used STR Markers
Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
Immune priviledged sites and HSV resistance: experience of the Regavir platform. Ophtalmologica Brussels November 27th, 2014
Immune priviledged sites and HSV resistance: experience of the Regavir platform. Ophtalmologica Brussels November 27th, 2014 A Reference and Service Center created in 2009 by the funding received from
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Nuevas tecnologías basadas en biomarcadores para oncología
Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS
Published Ahead of Print on May 31, 2011 as 10.1200/JCO.2010.32.8500. J Clin Oncol 29. 2011 by American Society of Clinical Oncology INTRODUCTION
Published Ahead of Print on May 31, 11 as 1.1/JCO.1.32.85 The latest version is at http://jco.ascopubs.org/cgi/doi/1.1/jco.1.32.85 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T Long-Term Prognosis
Factors Influencing Multiplex Real-Time PCR
APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].
LEUCEMIA MIELOIDE ACUTA. A.M. Carella U.O.C. Ematologia IRCCS AOU San Martino IST, Genova
LEUCEMIA MIELOIDE ACUTA A.M. Carella U.O.C. Ematologia IRCCS AOU San Martino IST, Genova Impact of mutational analysis in AML C. Thiede Optimal acute myeloid leukemia therapy in 2012 H. Dombret Acquired
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
bitter is de pil Linos Vandekerckhove, MD, PhD
4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV
Molecular Diagnosis of Hepatitis B and Hepatitis D infections
Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Acute Myeloid Leukemia Therapeutics Market to 2020
Brochure More information from http://www.researchandmarkets.com/reports/3030124/ Acute Myeloid Leukemia Therapeutics Market to 2020 Description: Summary: Treatment and prognosis in AML is strongly influenced
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
IPSOGEN SA Listed on Alternext by NYSE Euronext
Cliquez pour modifier le style du titre Cliquez pour modifier les styles du texte du masque IPSOGEN SA Listed on Alternext by NYSE Euronext SGAM meeting June 2008 Page 1 Cliquez pour modifier le style
DNA Technology Mapping a plasmid digesting How do restriction enzymes work?
DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria
Řekněte si o vzorky zdarma!
strana 1 z 6 Ceník platí v souladu s Obchodními podmínkami LAB MARK od 15.10.2015 Core Reagents for Molecular Biology www.bioline.com Řekněte si o vzorky zdarma! PCR ENZYME & MIXES DNA Polymerases - For
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Reliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials
LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application
Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville
Genetic Engineering and Biotechnology
1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation
Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation Dr Ros Ganderton, Ms Kate Parratt, Dr Debbie Richardson, Dr Kim Orchard and Dr Liz Hodges Departments of Molecular Pathology
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.
510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Recombinant DNA Technology
Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium
Introduction. About 10,500 new cases of acute myelogenous leukemia are diagnosed each
Introduction 1.1 Introduction: About 10,500 new cases of acute myelogenous leukemia are diagnosed each year in the United States (Hope et al., 2003). Acute myelogenous leukemia has several names, including
Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)
Page 1 of 9 Isolation and characterization of microsatellite markers from the greater ani Crotophaga major (Aves: Cuculidae) C. RIEHL * and S. M. BOGDANOWICZ * Department of Ecology and Evolutionary Biology,
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
Oncologist. The. Pediatric Oncology. Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia
The Oncologist Pediatric Oncology Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia SOHEIL MESHINCHI, a ROBERT J. ARCECI b a Fred Hutchinson Cancer Research Center, University
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
