Flt3-ITD, NPM1 and CEBPα mutation detection in AML

Size: px
Start display at page:

Download "Flt3-ITD, NPM1 and CEBPα mutation detection in AML"

Transcription

1 Flt3-ITD, NPM1 and CEBPα mutation detection in AML a collaborative diagnostic assay setup Friedel Nollet, Ph.D., AZ Sint-Jan Brugge-Oostende AV

2 Acute Myeloïd Leukemia

3 AML subgroups (WHO2008 classification) AML with recurrent genetic abnormalities AML with t(8;21) AML1/ETO AML with inv(16) CBFB/MYH11 APL with t(15;17) PML/RARa AML with t(9;11) MLLT3/MLL (==MLL/AF9) AML with t(6;9) DEK/NUP214 (==DEK/CAN) AML with inv(3) ot t(3;3) RPN-EVI1 AML with t(1;22) RBM1/MKL1 Provisional AML with mutated NPM1 Provisional AML with mutated CEBPa AML with myelodysplasie-related changes AML, NOS Myeloid sarcoma Myeloid proliferations related to Down Syndrome Blastic plasmacytoid dendritic cell neoplasm AML molecular prognostic markers All AML CN-AML (45%) Outcome Flt3-ITD 15%-25% 25%-35% Adverse NPM1 25%-35% 45%-60% Favorable CEBPa 5%-15% 10%-20% Favorable

4 Flt3 mutations in AML TKD D835

5 Nucleophosmin-1 mutations in AML * Falini, B. et al. NEJM 2005; 352:

6 CEBPα mutations in AML Green et al., 2010, JCO 28(16)

7 Double CEBPα mutations Wouters et al., Blood (2009) 113:

8 Participating Centres ULB Erasme, Hakim El Housni Jesse Ziekenhuis, Hasselt, Femke Hillen, Brigitte Maes Institut de Pathology et de Genetique, Gosselies, Pascal Vannuffel UZBrussel, Marleen Bakkus CHU University de Liège, Frédéric Lambert Ziekenhuis Netwerk Antwerpen, Pieter Deschouwer, Annemie Celens AZ Sint-Jan, Brugge, Friedel Nollet, Johan Billiet UZGent, Barbara Denys UZLeuven, Hilde Vranckx, Wim De Kelver Heilig Hart Ziekenhuis Roeselare, Elke Boone St-Augustinus, Antwerpen, Philippe van Lint.

9 Primer selection

10 1: Biotechniques Jun;20(6):1004-6, Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Brownstein MJ, Carpten JD, Smith JR. Taq DNA polymerase can catalyze non-templated addition of a nucleotide (principally adenosine) to the 3' end of PCR-amplified products. Recently, we showed that this activity, which is primer-specific, presents a potential source of error in genotyping studies based on the use of short tandem repeat (STR) markers. Furthermore, in reviewing our data, we found that non-templated nucleotide addition adjacent to a 3' terminal C is favored and that addition adjacent to a 3' terminal A is not. It was clear, however, that features of the template in addition to the 3' terminal base also affect the fraction of product adenylated. To define consensus sequences that promote or inhibit product adenylation, we transplanted sequences between the 5' ends of the reverse primers of markers that are adenylated and those of markers that are not adenylated. It proved difficult to identify a single sequence capable of protecting the products of all markers from non-templated addition of nucleotide. On the other hand, placing the sequence GTTTCTT on the 5' end of reverse primers resulted in nearly 100% adenylation of the 3' end of the forward strand. This modification or related ones (called "PIG-tailing") should facilitate accurate genotyping and efficient T/A cloning.

11 PCR optimisation F. Nollet, AZ Sint Jan, Brugge

12 Singleplex or multiplex genescan TAD1 TAD2 bzip NPM1 FLT3-ITD TAD1 + TAD2 TAD2 wt TAD1 wt + 5bp bzip + NPM1 + FLT3 bzip wt NPM1 wt + 4bp FLT3 wt M. Bakkus, UZBrussel

13 1bp resolutie gctttc gctttcc: M. Bakkus, UZBrussel

14 Example of Multiplex GeneScan NPM1 +4bp NPM1 wild type Flt3 wild type Flt3-ITD bzip TAD2 TAD2 wild type TAD2 +5bp F. Nollet, AZ Sint Jan, Brugge

15 NPM : actctctggtggtagaatgaaaaatagatgttgaactatgcaaagagaca tttaatttattgatgtctatgaagtgttgtggttccttaaccacatttct ttttttttttttccaggctattcaagatctctggcagtggaggaagtctc tttaagaaaatagtttaaacaatttgttaaaaaattttccgtcttatttc atttctgtaacagttgatatctggctgtcctttttataatgcagagtgag aactttccctaccgtgtttgataaatgttgtccaggttctattgccaaga atgtgttgtccaaaatgcc

16

17 Interrun

18 Flt3-ITD RNA versus DNA Conclusion : sensitivity Flt3-ITD on DNA is ~5% on RNA ~1%

19 linearity and sensitivity Conclusion : semi-quantitative analysis sensitivity is ~ 5% (sensitivity of Flt3-ITD detection on RNA is ~1%)

20 Sample Exchange

21 Conclusions collaborative reflection upon strategy and primer selection for Flt3-ITD, NPM1 and CEBPα is rewarded by straightforward optimisation and setup de facto standardization of assay

22 THE END

23 Example Without LNA With LNA Hakim El Housni, ULB Erasme

Acute leukemias and myeloproliferative neoplasms

Acute leukemias and myeloproliferative neoplasms Acute leukemias and myeloproliferative neoplasms GERGELY SZOMBATH SEMMELWEIS UNIVERSITY OF MEDICINE IIIRD. DEPARTMENT OF INTERNAL MEDICINE Basics of acute leukemia Neoplastic disease Cell of origin is

More information

Clinical Use of Karyotype and Molecular Markers In Curing Acute Myeloid Leukemia

Clinical Use of Karyotype and Molecular Markers In Curing Acute Myeloid Leukemia Clinical Use of Karyotype and Molecular Markers In Curing Acute Myeloid Leukemia Clara D. Bloomfield, M.D. Distinguished University Professor The Ohio State University Comprehensive Cancer Center, and

More information

ncounter Leukemia Fusion Gene Expression Assay Molecules That Count Product Highlights ncounter Leukemia Fusion Gene Expression Assay Overview

ncounter Leukemia Fusion Gene Expression Assay Molecules That Count Product Highlights ncounter Leukemia Fusion Gene Expression Assay Overview ncounter Leukemia Fusion Gene Expression Assay Product Highlights Simultaneous detection and quantification of 25 fusion gene isoforms and 23 additional mrnas related to leukemia Compatible with a variety

More information

PROGRAMMA / PROGRAM. Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol

PROGRAMMA / PROGRAM. Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol Moleculaire Biologie en Cytometrie Cursus 16-17 Mei 2013, SCK CEN, Mol PROGRAMMA / PROGRAM Molecular Biology and Cytometry Course 16 th -17 th May 2013, SCK CEN, Mol MB&C course MOL 2013 programma / program

More information

AML- new studies. Moderator Prof. Edo Vellenga. 1st author / speaker Mojca Jongen-Lavrencic

AML- new studies. Moderator Prof. Edo Vellenga. 1st author / speaker Mojca Jongen-Lavrencic AML- new studies Moderator Prof. Edo Vellenga 1st author / speaker Mojca Jongen-Lavrencic Belangenverklaring In overeenstemming met de regels van de Inspectie van de Gezondheidszorg (IGZ) Naam: Organisatie:

More information

APPROACH TO THE DIAGNOSIS AND TREATMENT OF ACUTE MYELOID LEUKEMIA (AML) Hematology Rounds Thurs July 23, 2009 Carolyn Owen

APPROACH TO THE DIAGNOSIS AND TREATMENT OF ACUTE MYELOID LEUKEMIA (AML) Hematology Rounds Thurs July 23, 2009 Carolyn Owen APPROACH TO THE DIAGNOSIS AND TREATMENT OF ACUTE MYELOID LEUKEMIA (AML) Hematology Rounds Thurs July 23, 2009 Carolyn Owen Outline Diagnosis Prognosis Treatment AML Elderly AML APL Future directions AML

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

DNA Methylation in MDS/MPD/AML: Implications for application

DNA Methylation in MDS/MPD/AML: Implications for application DNA Methylation in MDS/MPD/AML: Implications for application James G. Herman, M.D. Professor of Oncology Evelyn Grollman Glick Scholar The Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Disclosures

More information

Subtypes of AML follow branches of myeloid development, making the FAB classificaoon relaovely simple to understand.

Subtypes of AML follow branches of myeloid development, making the FAB classificaoon relaovely simple to understand. 1 2 3 4 The FAB assigns a cut off of 30% blasts to define AML and relies predominantly on morphology and cytochemical stains (MPO, Sudan Black, and NSE which will be discussed later). Subtypes of AML follow

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Basics of AML. Acute myeloid leukemia and related myeloid neoplasms: WHO 2008 brings us closer to understanding clinical behavior

Basics of AML. Acute myeloid leukemia and related myeloid neoplasms: WHO 2008 brings us closer to understanding clinical behavior Acute myeloid leukemia and related myeloid neoplasms: WHO 2008 brings us closer to understanding clinical behavior No conflicts of interest to disclose Steven Devine, MD The Ohio State University Common

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

GENETIC PROGNOSTIC FACTORS IN ACUTE MYELOID LEUKEMIA

GENETIC PROGNOSTIC FACTORS IN ACUTE MYELOID LEUKEMIA GENETIC PROGNOSTIC FACTORS IN ACUTE MYELOID LEUKEMIA PhD dissertation Magdalena Renata Koszarska Eötvös Loránd University, Faculty of Science Doctoral School of Biology Classical and Molecular Genetics

More information

Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia

Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia Subarna Sinha PhD Department of Computer Science Principal Investigator: David Dill Daniel

More information

PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA PROGNOSIS IN ACUTE MYELOID LEUKEMIA

PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA PROGNOSIS IN ACUTE MYELOID LEUKEMIA PROGNOSIS IN ACUTE LYMPHOBLASTIC LEUKEMIA UNFAVORABLE Advanced age High leukocyte count at diagnosis Presence of myeloid antigens Late achievement of CR Chromosomal abnormalities: t(9:22)(q34:q11) t(4;11)(q21;q23)

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

Leukemias and Lymphomas: A primer

Leukemias and Lymphomas: A primer Leukemias and Lymphomas: A primer Normal blood contains circulating white blood cells, red blood cells and platelets 700 red cells (oxygen) 1 white cell Neutrophils (60%) bacterial infection Lymphocytes

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

BHS COMMITTEES MEETING 30 January 2014

BHS COMMITTEES MEETING 30 January 2014 BHS COMMITTEES MEETING 30 January 2014 Regulatory affairs JACIE Ivan Van Riet [email protected] Scopes Supporting implementation of JACIE standards in national SCT centres with the aim to obtain

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

NGS e malattie mieloproliferative

NGS e malattie mieloproliferative NGS e malattie mieloproliferative Matteo G Della Porta Department of Hematology Oncology, Fondazione IRCCS Policlinico S. Matteo, University of Pavia Medical School, Pavia, Italy [email protected]

More information

Chapter 6 DNA Replication

Chapter 6 DNA Replication Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Technical Manual No. 0173 Update Date 10112010

Technical Manual No. 0173 Update Date 10112010 TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed

More information

Molecular diagnostics is now used for a wide range of applications, including:

Molecular diagnostics is now used for a wide range of applications, including: Molecular Diagnostics: A Dynamic and Rapidly Broadening Market Molecular diagnostics is now used for a wide range of applications, including: Human clinical molecular diagnostic testing Veterinary molecular

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications

PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not

More information

Troubleshooting for PCR and multiplex PCR

Troubleshooting for PCR and multiplex PCR Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

IMBB 2013. Genomic DNA purifica8on

IMBB 2013. Genomic DNA purifica8on IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),

More information

Immune priviledged sites and HSV resistance: experience of the Regavir platform. Ophtalmologica Brussels November 27th, 2014

Immune priviledged sites and HSV resistance: experience of the Regavir platform. Ophtalmologica Brussels November 27th, 2014 Immune priviledged sites and HSV resistance: experience of the Regavir platform. Ophtalmologica Brussels November 27th, 2014 A Reference and Service Center created in 2009 by the funding received from

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Nuevas tecnologías basadas en biomarcadores para oncología

Nuevas tecnologías basadas en biomarcadores para oncología Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS

More information

Published Ahead of Print on May 31, 2011 as 10.1200/JCO.2010.32.8500. J Clin Oncol 29. 2011 by American Society of Clinical Oncology INTRODUCTION

Published Ahead of Print on May 31, 2011 as 10.1200/JCO.2010.32.8500. J Clin Oncol 29. 2011 by American Society of Clinical Oncology INTRODUCTION Published Ahead of Print on May 31, 11 as 1.1/JCO.1.32.85 The latest version is at http://jco.ascopubs.org/cgi/doi/1.1/jco.1.32.85 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T Long-Term Prognosis

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

LEUCEMIA MIELOIDE ACUTA. A.M. Carella U.O.C. Ematologia IRCCS AOU San Martino IST, Genova

LEUCEMIA MIELOIDE ACUTA. A.M. Carella U.O.C. Ematologia IRCCS AOU San Martino IST, Genova LEUCEMIA MIELOIDE ACUTA A.M. Carella U.O.C. Ematologia IRCCS AOU San Martino IST, Genova Impact of mutational analysis in AML C. Thiede Optimal acute myeloid leukemia therapy in 2012 H. Dombret Acquired

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

bitter is de pil Linos Vandekerckhove, MD, PhD

bitter is de pil Linos Vandekerckhove, MD, PhD 4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV

More information

Molecular Diagnosis of Hepatitis B and Hepatitis D infections

Molecular Diagnosis of Hepatitis B and Hepatitis D infections Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Acute Myeloid Leukemia Therapeutics Market to 2020

Acute Myeloid Leukemia Therapeutics Market to 2020 Brochure More information from http://www.researchandmarkets.com/reports/3030124/ Acute Myeloid Leukemia Therapeutics Market to 2020 Description: Summary: Treatment and prognosis in AML is strongly influenced

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

IPSOGEN SA Listed on Alternext by NYSE Euronext

IPSOGEN SA Listed on Alternext by NYSE Euronext Cliquez pour modifier le style du titre Cliquez pour modifier les styles du texte du masque IPSOGEN SA Listed on Alternext by NYSE Euronext SGAM meeting June 2008 Page 1 Cliquez pour modifier le style

More information

DNA Technology Mapping a plasmid digesting How do restriction enzymes work?

DNA Technology Mapping a plasmid digesting How do restriction enzymes work? DNA Technology Mapping a plasmid A first step in working with DNA is mapping the DNA molecule. One way to do this is to use restriction enzymes (restriction endonucleases) that are naturally found in bacteria

More information

Řekněte si o vzorky zdarma!

Řekněte si o vzorky zdarma! strana 1 z 6 Ceník platí v souladu s Obchodními podmínkami LAB MARK od 15.10.2015 Core Reagents for Molecular Biology www.bioline.com Řekněte si o vzorky zdarma! PCR ENZYME & MIXES DNA Polymerases - For

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Reliable PCR Components for Molecular Diagnostic Assays

Reliable PCR Components for Molecular Diagnostic Assays Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials

LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational

More information

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Bio 102 Practice Problems Genetic Code and Mutation

Bio 102 Practice Problems Genetic Code and Mutation Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine

More information

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,

More information

Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation

Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation Dr Ros Ganderton, Ms Kate Parratt, Dr Debbie Richardson, Dr Kim Orchard and Dr Liz Hodges Departments of Molecular Pathology

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92.

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. 510K Summary This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR 807.92. Submitter: Contact: One Lambda, Incorporated 21001 Kittridge

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Introduction. About 10,500 new cases of acute myelogenous leukemia are diagnosed each

Introduction. About 10,500 new cases of acute myelogenous leukemia are diagnosed each Introduction 1.1 Introduction: About 10,500 new cases of acute myelogenous leukemia are diagnosed each year in the United States (Hope et al., 2003). Acute myelogenous leukemia has several names, including

More information

Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae)

Isolation and characterization of microsatellite markers from the greater ani. Crotophaga major (Aves: Cuculidae) Page 1 of 9 Isolation and characterization of microsatellite markers from the greater ani Crotophaga major (Aves: Cuculidae) C. RIEHL * and S. M. BOGDANOWICZ * Department of Ecology and Evolutionary Biology,

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

Oncologist. The. Pediatric Oncology. Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia

Oncologist. The. Pediatric Oncology. Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia The Oncologist Pediatric Oncology Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia SOHEIL MESHINCHI, a ROBERT J. ARCECI b a Fred Hutchinson Cancer Research Center, University

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

DNA Replication in Prokaryotes

DNA Replication in Prokaryotes OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information