Building the Systems Biology Knowledgebase
|
|
|
- Marybeth Davidson
- 5 years ago
- Views:
From this document you will learn the answers to the following questions:
What is the name of the product that is used in the Kbase?
What is the purpose of the Systems Biology Knowledgebase?
Transcription
1 Building the Systems Biology Knowledgebase Tom Brettin Oak Ridge National Laboratory
2 Integrate science and the science community JGI Sequencing Genome Carbon Cycling Processes Bioenergy Research Integrate Science Across Metabolic Modeling Plant Feedstocks for Bioenergy Biology Research There is a tremendous wealth of data and informa@on in the Genomic Sciences program. The Knowledgebase (Kbase) is an opportunity to integrate this data and informa@on both within individual ac@vi@es as well as to integrate together different ac@vi@es.
3 Everyone should be a contributor! KBASE: A. Professional Computa@onal Biologists B. Data generators and basic analysts C. Knowledge Seekers D. Knowledge Generators Therefore we aim to: instances of minimum inventory/maximum diversity systems, a term coined by Peter Pearce in his book, Structure in Nature Is a Strategy for Design (MIT Press, 1978). Create a powerful framework for programma@c access to data and func@ons of Kbase. (Users A,B) Ul@mately provide stubs for use in PERL, PYTHON, R, MATLAB, Galaxy, etc. Create a set of packaged Widgets that make placement and recognizable display of Kbase func@ons on web pages (or within perhaps other apps), easy and iden@fiable. (Users B) Create a simplified portal for search and aggrega@on of data for data consumers and Knowledge Seekers. (Users C,D) Create a innova+ve pla.orm for knowledge crea+on, evolu+on and sharing. 2 DOE Office of Science Office of Biological and Environmental Research
4 An Integrated View of Modeling, Simulation, Experiment, and Bioinformatics Bioinformatics Analysis Tools Integrated Biological Databases Experimental Design High-throughput Experiments Analysis & Visualization
5 An Integrated View of Modeling, Simulation, Experiment, and Bioinformatics Problem Specification Modeling and Simulation Analysis & Visualization Bioinformatics Analysis Tools Integrated Biological Databases Experimental Design High-throughput Experiments Analysis & Visualization
6 Base Knowledgebase enabling predic5ve systems biology. Powerful modeling framework. Systems Biology Knowledge Community driven, extensible and scalable open source so_ware and system. Infrastructure for and of algorithms and data sources. Framework for search, and of data. Enable model based experimental design and interpreta<on of results. Microbes Communities Plants
7 Engineering a Microbe for Biofuel Produc<on Annotated Genome Annota@on algorithms Metabolic reconstruc@on Feed Stock Stresses Hydrolysate, ph, Salt, End product, intermediates Metabolic model genera@on Model op@miza@on algorithms Biomass Regulatory network inference Isoprene Other func@onal modeling Fi`ng kine@c model parameters DNA replica<on transcrip<on protein folding transla<on Regula<on Predic@ng pathway fluxes KBase Tool Integra<on Proposing strain op@miza@ons Genome Sequence Compara@ve Genomics KEGG Brenda BioCyc Published models Gene KO Phenotypes Transcriptomics Metabolomics Proteomics Growth curves Flux tracing experiments KBase Data Integra<on
8 Modifying Lignin Biosynthesis S G H S G H PolyPhen 2 Genome annota@on algorithms Compara@ve genomics Genome wide Correla@ve analysis SNP influenced changes in protein structure and func@on Pathway predic@ons Network inference Pathway reconstruc@on Omics & SNP overlay Model op@miza@on valida@on Phylogenomics Modeling phase I Plant systems modifica@on Phenotype Mutant popula<on Resequencing data Transcriptomics Proteomics Metabolomics
9 Culturing Recalcitrant Microbes from Communi<es Covaria<on Analysis, Phylogene<cally and Func<onally Interes<ng Keystone Species Phylogene<c Inference Gene Func<onal Annota<on Trp N Differen<al Gene Expression Popula@on Sta@s@cs Compara@ve Metagenomics Isolate Genomes and Models Genome Assembly from Metagenomics Annota@on and Metabolic Reconstruc@on Regula@on and Func@onal Modeling Predict Syntrophic Interac@ons Predict Culturing Condi@ons Isolate vs. Community Phenotype Species Abundance Func@onal Gene Abundance Phylo binning and scaffolding Transcriptomics Metabolomics Proteomics Temp ph Salinity Amino Acids Cofactors Syntrophies
10 What the KBase Needs To Provide? Scalable compute and data capabilities beyond that available locally Distributed infrastructure available 24x7 worldwide Integration with local bioinfo systems for seamless computing and data management Enables leverage of remote systems administration and support via service providers Enables access to state of the art facilities at fraction of the cost (SPs just add more servers) Centralized support of tools and data Bottom line enable biologists to focus on biology
11 Leverage Existing Investments We leverage the considerable investments in existing integrated databases and analysis environments Key challenge: How we build on these systems yet provide to the community an integrated view for future development
12 Microbes Online Model SEED MG-RAST 1000s Data Sets 300+ Daily Users Meta Microbes Online 6532 Models Users 41,000 Metagenomes 500+ Daily Users Phyotozome 153 Metagenomes 100+ Daily Users RegFam 1000s Papers 100+ Daily Users 20,000+ users The SEED 1166 Subsystems 5859 Users 25 Plant Genomes 300 Daily Users RAST 39,000 Genomes Users
13 Infrastructure Goals Our vision is to put users in the drivers seat.
14 DOE Systems Biology Knowledgebase KBASE Data and modeling for predictive biology Overview of Infrastructure Tom Brettin and Rick Stevens Oak Ridge and Argonne National Laboratories
15 Working As One Team Plant CDM Design and Build Jan 2012, ORNL Hackathon Jan 2012, LBL First Internal Kbase Build Feb 2012, ANL
16 So_ware Technical Reviews (May 2 3, 2012)
17 Energy Sciences Network (ESnet) KBase leverages ESNet for 10+ Gb/s data transfer between all nodes BNL ESnet backbone ( ESnet4) is a na<onal 10 Gbps op<cal circuit infrastructure ESnet shares its op<cal network with Internet2 ESnet's IP network func<ons as a Tier 1 internet service provider
18 The DOE KBase Cloud Built on the DOE ASCR investment in the Magellan cloud infrastructure Current of 700 nodes homed at ANL for heterogeneous Open Stack Argonne Open Stack Oak Ridge Cluster Berkeley Cluster Brookhaven
19 The Kbase Cloud Architecture Data Intensive Science KBase Applica<on Development Large Scale Computa<on Method Development HPC Cluster Image MapReduce Image Ubuntu Image KBase Image OpenStack IaaS Cloud SoZware Stack (EC2/S3 APIs) Commodity Compute Cluster Hardware
20 The KBase Services Services Oriented Architecture: The KBase Unified API access to a highly diverse set of services ranging from quick retrieval of simple data to massive computa@ons on the KBase Cloud. In a SOA the system is func@onally decomposed into many services each of which is implemented as one or more servers. Our long term goal includes community developed and contributed services. Our ini@al set of services will be backed by the following example servers: Genomic Servers Protein Family Servers Phenotype Servers Polymorphism Servers Compound and Reac5on Data Servers Metabolic Modeling Servers Expression Data Servers Regulatory Models Servers
21 Concept: KBase User Experience
22 Development Schedule A series of system builds occurring every quarter will enable a graded process. Successive builds will expand community involvement.
KBase and Globus Online Nexus. Shreyas Cholia NERSC/LBL
DOE Systems Biology Knowledgebase KBase and Globus Online Nexus Shreyas Cholia NERSC/LBL What is KBase? Knowledgebase enabling predic6ve systems biology. Powerful modeling framework. Community- driven,
The Office of Biological and Environmental
Genomic Science Program genomicscience.energy.gov Overview of the DOE Systems Biology Knowledgebase and Related Research Activities The Office of Biological and Environmental Research (BER) within the
DOE Office of Biological & Environmental Research: Biofuels Strategic Plan
DOE Office of Biological & Environmental Research: Biofuels Strategic Plan I. Current Situation The vast majority of liquid transportation fuel used in the United States is derived from fossil fuels. In
Data Management in the Cloud: Limitations and Opportunities. Annies Ductan
Data Management in the Cloud: Limitations and Opportunities Annies Ductan Discussion Outline: Introduc)on Overview Vision of Cloud Compu8ng Managing Data in The Cloud Cloud Characteris8cs Data Management
Mission. To provide higher technological educa5on with quality, preparing. competent professionals, with sound founda5ons in science, technology
Mission To provide higher technological educa5on with quality, preparing competent professionals, with sound founda5ons in science, technology and innova5on, commi
Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences
Euro-BioImaging European Research Infrastructure for Imaging Technologies in Biological and Biomedical Sciences WP11 Data Storage and Analysis Task 11.1 Coordination Deliverable 11.2 Community Needs of
Cloud-Based Big Data Analytics in Bioinformatics
Cloud-Based Big Data Analytics in Bioinformatics Presented By Cephas Mawere Harare Institute of Technology, Zimbabwe 1 Introduction 2 Big Data Analytics Big Data are a collection of data sets so large
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
nuts and bolts of DNA sequencing approaches and bioinformatic tools
nuts and bolts of DNA sequencing approaches and bioinformatic tools Dionysios A. Antonopoulos Institute for Genomics and Systems Biology Biosciences Division Argonne National Laboratory August 7, 2012
Data Center Evolu.on and the Cloud. Paul A. Strassmann George Mason University November 5, 2008, 7:20 to 10:00 PM
Data Center Evolu.on and the Cloud Paul A. Strassmann George Mason University November 5, 2008, 7:20 to 10:00 PM 1 Hardware Evolu.on 2 Where is hardware going? x86 con(nues to move upstream Massive compute
Big Data Challenges in Bioinformatics
Big Data Challenges in Bioinformatics BARCELONA SUPERCOMPUTING CENTER COMPUTER SCIENCE DEPARTMENT Autonomic Systems and ebusiness Pla?orms Jordi Torres [email protected] Talk outline! We talk about Petabyte?
Plant Metabolomics. For BOT 6516
Plant Metabolomics For BOT 6516 Introduction Modern metabolomics began about ten years ago and yet many continue to question the relative performance of this area of technology in advancing plant biology.
OpenCB a next generation big data analytics and visualisation platform for the Omics revolution
OpenCB a next generation big data analytics and visualisation platform for the Omics revolution Development at the University of Cambridge - Closing the Omics / Moore s law gap with Dell & Intel Ignacio
Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology
University of Glasgow - Programme Structure Summary C1G5-5100 MSc Bioinformatics, Polyomics and Systems Biology Programme Structure - the MSc outcome will require 180 credits total (full-time only) - 60
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
NERSC Data Efforts Update Prabhat Data and Analytics Group Lead February 23, 2015
NERSC Data Efforts Update Prabhat Data and Analytics Group Lead February 23, 2015-1 - A little bit about myself Computer Scien.st Brown, IIT Delhi Real- 3me Graphics, Virtual Reality, HCI Computa3onal
Experiences with Eucalyptus: Deploying an Open Source Cloud
Experiences with Eucalyptus: Deploying an Open Source Cloud Rick Bradshaw - [email protected] Piotr T Zbiegiel - [email protected] Argonne National Laboratory Overview Introduction and Background Eucalyptus
Science Gateways What are they and why are they having such a tremendous impact on science? Nancy Wilkins- Diehr [email protected]
Science Gateways What are they and why are they having such a tremendous impact on science? Nancy Wilkins- Diehr [email protected] What is a science gateway? science gateway /sī əәns gāt wā / n. 1. an
MoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China
MoBEDAC -- Integrated data and analysis for the indoor and built environment Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China NGS is causing paradigm shift Environmental clone libraries
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France
Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/
ENOS: a Network Opera/ng System for ESnet Testbed
ENOS: a Network Opera/ng System for ESnet Testbed Eric Pouyoul ([email protected]) Technology Exchange Cleveland, Ohio, September 2015 Is ESnet really developing Yet Another Network Opera:ng System (YANOS)?
Hunk & Elas=c MapReduce: Big Data Analy=cs on AWS
Copyright 2014 Splunk Inc. Hunk & Elas=c MapReduce: Big Data Analy=cs on AWS Dritan Bi=ncka BD Solu=ons Architecture Disclaimer During the course of this presenta=on, we may make forward looking statements
Founda'onal IT Governance A Founda'onal Framework for Governing Enterprise IT Adapted from the ISACA COBIT 5 Framework
Founda'onal IT Governance A Founda'onal Framework for Governing Enterprise IT Adapted from the ISACA COBIT 5 Framework Steven Hunt Enterprise IT Governance Strategist NASA Ames Research Center Michael
Legacy Archiving How many lights do you leave on? September 14 th, 2015
Legacy Archiving How many lights do you leave on? September 14 th, 2015 1 Introductions Wendy Laposata, Himforma(cs Tom Chase, Cone Health 2 About Cone Health More than 100 loca=ons 6 hospitals, 3 ambulatory
Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk
Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes
Core Bioinformatics. Degree Type Year Semester. 4313473 Bioinformàtica/Bioinformatics OB 0 1
Core Bioinformatics 2014/2015 Code: 42397 ECTS Credits: 12 Degree Type Year Semester 4313473 Bioinformàtica/Bioinformatics OB 0 1 Contact Name: Sònia Casillas Viladerrams Email: [email protected]
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/
BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute [email protected] http://www.jcvi.org/cms/about/bios/kkrampis/
Structural Bioinformatics
Structural Bioinformatics D. Ritchie, P. Tufféry Paris Nancy BISTRO Strasbourg Lyon Th IFB, Jan. 9, 2015 BISTRO Scien&fic leader: Julie Thompson Technical leader: Valérie Cognat IFB correspondent: Valérie
Apache Hadoop: The Pla/orm for Big Data. Amr Awadallah CTO, Founder, Cloudera, Inc. [email protected], twicer: @awadallah
Apache Hadoop: The Pla/orm for Big Data Amr Awadallah CTO, Founder, Cloudera, Inc. [email protected], twicer: @awadallah 1 The Problems with Current Data Systems BI Reports + Interac7ve Apps RDBMS (aggregated
Certified Cloud Computing Professional VS-1067
Certified Cloud Computing Professional VS-1067 Certified Cloud Computing Professional Certification Code VS-1067 Vskills Cloud Computing Professional assesses the candidate for a company s cloud computing
Return on Experience on Cloud Compu2ng Issues a stairway to clouds. Experts Workshop Nov. 21st, 2013
Return on Experience on Cloud Compu2ng Issues a stairway to clouds Experts Workshop Agenda InGeoCloudS SoCware Stack InGeoCloudS Elas2city and Scalability Elas2c File Server Elas2c Database Server Elas2c
Big Data. The Big Picture. Our flexible and efficient Big Data solu9ons open the door to new opportuni9es and new business areas
Big Data The Big Picture Our flexible and efficient Big Data solu9ons open the door to new opportuni9es and new business areas What is Big Data? Big Data gets its name because that s what it is data that
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Alternative Deployment Models for Cloud Computing in HPC Applications. Society of HPC Professionals November 9, 2011 Steve Hebert, Nimbix
Alternative Deployment Models for Cloud Computing in HPC Applications Society of HPC Professionals November 9, 2011 Steve Hebert, Nimbix The case for Cloud in HPC Build it in house Assemble in the cloud?
Interna'onal Standards Ac'vi'es on Cloud Security EVA KUIPER, CISA CISSP [email protected] HP ENTERPRISE SECURITY SERVICES
Interna'onal Standards Ac'vi'es on Cloud Security EVA KUIPER, CISA CISSP [email protected] HP ENTERPRISE SECURITY SERVICES Agenda Importance of Common Cloud Standards Outline current work undertaken Define
Open Cloud System. (Integration of Eucalyptus, Hadoop and AppScale into deployment of University Private Cloud)
Open Cloud System (Integration of Eucalyptus, Hadoop and into deployment of University Private Cloud) Thinn Thu Naing University of Computer Studies, Yangon 25 th October 2011 Open Cloud System University
Next-Generation Networking for Science
Next-Generation Networking for Science ASCAC Presentation March 23, 2011 Program Managers Richard Carlson Thomas Ndousse Presentation
An Open Dynamic Big Data Driven Applica3on System Toolkit
An Open Dynamic Big Data Driven Applica3on System Toolkit Craig C. Douglas University of Wyoming and KAUST This research is supported in part by the Na3onal Science Founda3on and King Abdullah University
Portable, Scalable, and High-Performance I/O Forwarding on Massively Parallel Systems. Jason Cope [email protected]
Portable, Scalable, and High-Performance I/O Forwarding on Massively Parallel Systems Jason Cope [email protected] Computation and I/O Performance Imbalance Leadership class computa:onal scale: >100,000
OpenDaylight: Introduction, Lithium and Beyond
OpenDaylight: Introduction, Lithium and Beyond Colin Dixon Technical Steering Committee Chair, OpenDaylight Senior Principal Engineer, Brocade Some content from: David Meyer, Neela Jaques, and Kevin Woods
GeneProf and the new GeneProf Web Services
GeneProf and the new GeneProf Web Services Florian Halbritter [email protected] Stem Cell Bioinformatics Group (Simon R. Tomlinson) [email protected] December 10, 2012 Florian Halbritter
Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- [email protected].
Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- [email protected] Introduc.on Genome browsing The Ensembl gene set Guided examples
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices
overview Pipeline Pilot Enterprise Server Pipeline Pilot Enterprise Server (PPES) is a powerful client-server platform that streamlines the integration and analysis of the vast quantities of data flooding
Cloudian The Storage Evolution to the Cloud.. Cloudian Inc. Pre Sales Engineering
Cloudian The Storage Evolution to the Cloud.. Cloudian Inc. Pre Sales Engineering Agenda Industry Trends Cloud Storage Evolu4on of Storage Architectures Storage Connec4vity redefined S3 Cloud Storage Use
Ibis: Scaling Python Analy=cs on Hadoop and Impala
Ibis: Scaling Python Analy=cs on Hadoop and Impala Wes McKinney, Budapest BI Forum 2015-10- 14 @wesmckinn 1 Me R&D at Cloudera Serial creator of structured data tools / user interfaces Mathema=cian MIT
So#ware Tools and Techniques for HPC, Clouds, and Server- Class SoCs Ron Brightwell
So#ware Tools and Techniques for HPC, Clouds, and Server- Class SoCs Ron Brightwell R&D Manager, Scalable System So#ware Department Sandia National Laboratories is a multi-program laboratory managed and
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow. Barry Bolding. Cray Inc Seattle, WA
Genomic Applications on Cray supercomputers: Next Generation Sequencing Workflow Barry Bolding Cray Inc Seattle, WA 1 CUG 2013 Paper Genomic Applications on Cray supercomputers: Next Generation Sequencing
bigdata Managing Scale in Ontological Systems
Managing Scale in Ontological Systems 1 This presentation offers a brief look scale in ontological (semantic) systems, tradeoffs in expressivity and data scale, and both information and systems architectural
Big Data + Big Analytics Transforming the way you do business
Big Data + Big Analytics Transforming the way you do business Bryan Harris Chief Technology Officer VSTI A SAS Company 1 AGENDA Lets get Real Beyond the Buzzwords Who is SAS? Our PerspecDve of Big Data
SDN Controller Requirement
SDN Controller Requirement draft-gu-sdnrg-sdn-controller-requirement-00 Rong Gu (Presenter) Chen Li China Mobile Background l Public Cloud && Private Cloud in China Mobile Public Cloud (ecloud.10086.cn)
Introduc)on of Pla/orm ISF. Weina Ma [email protected]
Introduc)on of Pla/orm ISF Weina Ma [email protected] Agenda Pla/orm ISF Product Overview Pla/orm ISF Concepts & Terminologies Self- Service Applica)on Management Applica)on Example Deployment Examples
Storage Solutions for Bioinformatics
Storage Solutions for Bioinformatics Li Yan Director of FlexLab, Bioinformatics core technology laboratory [email protected] http://www.genomics.cn/flexlab/index.html Science and Technology Division,
Visualizing Networks: Cytoscape. Prat Thiru
Visualizing Networks: Cytoscape Prat Thiru Outline Introduction to Networks Network Basics Visualization Inferences Cytoscape Demo 2 Why (Biological) Networks? 3 Networks: An Integrative Approach Zvelebil,
SURFsara HPC Cloud Workshop
SURFsara HPC Cloud Workshop doc.hpccloud.surfsara.nl UvA workshop 2016-01-25 UvA HPC Course Jan 2016 Anatoli Danezi, Markus van Dijk [email protected] Agenda Introduction and Overview (current
ENZO UNIFIED SOLVES THE CHALLENGES OF REAL-TIME DATA INTEGRATION
ENZO UNIFIED SOLVES THE CHALLENGES OF REAL-TIME DATA INTEGRATION Enzo Unified Solves Real-Time Data Integration Challenges that Increase Business Agility and Reduce Operational Complexities CHALLENGES
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
Teaching Computational Thinking using Cloud Computing: By A/P Tan Tin Wee
Teaching Computational Thinking using Cloud Computing: By A/P Tan Tin Wee Technology in Pedagogy, No. 8, April 2012 Written by Kiruthika Ragupathi ([email protected]) Computational thinking is an emerging
FACULTY OF MEDICAL SCIENCE
Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research
HFAA: A Generic Socket API for Hadoop File Systems
Second Workshop on Architectures and Systems for Big Data (ASBD 2012) June 9 th, 2012 HFAA: A Generic Socket API for Hadoop File Systems Adam Yee and Jeffrey Shafer University of the Pacific 2 Hadoop MapReduce
May 13-14, 2015. Copyright 2015 Open Networking User Group. All Rights Reserved Confiden@al Not For Distribu@on
May 13-14, 2015 NSV Architecture Test Architecture System Under Test Mgmt, Orch, etc. Test Solution VM VM Hypervisor Hypervisor IP Network Methodology Each individual requirement had 1 test case associated
Distributed Systems Interconnec=ng Them Fundamentals of Distributed Systems Alvaro A A Fernandes School of Computer Science University of Manchester
Distributed Systems Interconnec=ng Them Fundamentals of Distributed Systems lvaro Fernandes School of Computer Science University of Manchester Goals 1. To highlight the role of the interconnect in characterizing
Big Data, Big Challenges
Big Data, Big Challenges Big Data, Big Challenges DeIC Conference 2013 Michael Sullivan, M.D. Big Data Variety Volume Visualiza0on Velocity Variety Roger Ebert 1942-2013 Roger was diagnosed with cancer
An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle
An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal
2) Xen Hypervisor 3) UEC
5. Implementation Implementation of the trust model requires first preparing a test bed. It is a cloud computing environment that is required as the first step towards the implementation. Various tools
Linux Clusters Ins.tute: Turning HPC cluster into a Big Data Cluster. A Partnership for an Advanced Compu@ng Environment (PACE) OIT/ART, Georgia Tech
Linux Clusters Ins.tute: Turning HPC cluster into a Big Data Cluster Fang (Cherry) Liu, PhD [email protected] A Partnership for an Advanced Compu@ng Environment (PACE) OIT/ART, Georgia Tech Targets
Application of Graph-based Data Mining to Metabolic Pathways
Application of Graph-based Data Mining to Metabolic Pathways Chang Hun You, Lawrence B. Holder, Diane J. Cook School of Electrical Engineering and Computer Science Washington State University Pullman,
Toward a Unified Ontology of Cloud Computing
Toward a Unified Ontology of Cloud Computing Lamia Youseff University of California, Santa Barbara Maria Butrico, Dilma Da Silva IBM T.J. Watson Research Center 1 In the Cloud Several Public Cloud Computing
Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
An Advanced Performance Architecture for Salesforce Native Applications
An Advanced Performance Architecture for Salesforce Native Applications TABLE OF CONTENTS Introduction............................................... 3 Salesforce in the Digital Transformation Landscape...............
Cloud Ready for Bioinformatics?
IDB acknowledges co-funding by the European Community's Seventh Framework Programme (INFSO-RI-261552) and the French National Research Agency's Arpege Programme (ANR-10-SEGI-001) Cloud Ready for Bioinformatics?
Case Studies in Solving Testing Constraints using Service Virtualization
Case Studies in Solving Testing Constraints using Service Virtualization [email protected] 2/21/14 1 Introduction Paraso& is supplier automated tes1ng solu1ons Since 1984, Los Angeles (US) and
HP Converged Cloud Cloud Platform Overview. Shane Pearson Vice President, Portfolio & Product Management
HP Converged Cloud Cloud Platform Overview Shane Pearson Vice President, Portfolio & Product Management Cloud is the biggest disruption since the Internet 1970-80s Mainframe 1990s Client/Server 2000s The
