Table 1: Bio-markers developed for the diagnosis and study of bacterial virulence genes.
|
|
|
- Angel Anderson
- 9 years ago
- Views:
Transcription
1 Table 1: Bio-markers developed for the diagnosis and study of bacterial virulence genes. Biomarcadores Target gene description Primers sequence (5-3 ) Product (pb) Amplificação aaic a,c ilha ativadora do gene aggr, E. coli 1 enteroagregativa (EAEC) S: ATTGTCCTCAGGCATTTCAC a 95ºC, 20 a 57ºC, 1 a 72ºC AS: ACGACACCCCTGATAAACAA 2 aggr b,c regulador de aderência agregativa, EAEC S: ATGAAATTAAAACAAAATATCGA a 95ºC, 30 a 58ºC, 1 a 72ºC AS: TCATTGGCTTTTAAAATAAGTCAA 3 hipo a,c hipurato hidrolase de C. jejuni S: ATGATGGCTTCTTCGGATAG 176 AS: GCTCCTATGCTTACAACTGC 30 a 95ºC, 30 a 51ºC, 45" a 72ºC 4 ask a,c aspartato quinase de C. coli S: GGTATGATTTCTACAAGCGAG 502 AS: ATAAAAGACTATCGTCGCGTG 5 glya a,c serina hidroximetiltransferase de C. lari S: TAGAGAGATAGCAAAAGAGA a 95ºC, 30 a 46ºC, 45" a 72ºC AS: TACACATAATAATCCCACCC Virulence gene 6 pet b,c toxina codificada por plasmídio, EAEC S: TGACAGTGGATCAGGCGTGT 558 AS: TTCTGTGCGCCAAGAATGAC 7 pic a,d proteína envolvida em colonização, EAEC S: TTCAGCCGAAAGACGAAATCG a 95ºC, 30 a 55ºC, 1 a 72ºC AS: TCTGCGCATTCATACCAACAT asta b,d toxina termo-estável agregativa, EAST1, 8 EAEC S: GCCATCAACACAGTATATCCGA a 95ºC, 30 a 55ºC, 1 a 72ºC 9 aap b,d proteína anti-agregativa, dispersina, EAEC AS: CGATATTATTTAACCCATTCGG 356
2 Continuation of Table 1: Bio-markers developed for the diagnosis and study of bacterial virulence genes. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplificação 10 cdta a,d toxina citoletal distensora (CDT) porção, C. S: TTGGCGATGCTAGAGTTTGG jejuni 175 AS: ACCGCTGTATTGCTCATAGGG 11 cdtb a,d CDT porção B, C. jejuni S: CTCGCGTTGATGTAGGAGCTA AS: GCAGCTAAAAGCGGTGGAGTA 12 cdtc a,d CDT porção C, C. jejuni S: AGCCTTTGCAACTCCTACTGG AS: GCTCCAAAGGTTCCATCTTC 13 flaa a,d flagelina A, C. jejuni S: AGCTGCTTCGCAACTTTCTACGGT AS: TGCACTCTCGGCTGCAAAGTCT 14 plda a,d fosfolipase A, C. jejuni S: AAGAGTGAGGCGAAATTCCA AS: GCAAGATGGCAGGATTATCA 15 ciab a,d antígeno de invasão de Campylobacter S: TCATGCGGTGGCATTAGAATGGG AS: GCGACCGATGATAACATCAAGGCT 16 racr a,d regulador de resposta DNA-ligante, C. jejuni S: TGGGGCTTCAAATCGGTGCTGA AS: GCGACCGATGATAACATCAAGGCT 17 dnaj a,d proteína chaperona DnaJ, C. jejuni S: AGGCTTTGGCTCATCACGTCG AS: GGTCGCTTCACCGCGTATGG 18 SAT a,c autotransportador de toxina secretada, patotipos de E. coli Legend: a Gene cromossomal; b Gene plasmidial, c S: iniciador senso; AS: iniciador anti-senso pb: pares de bases PCR comum; d PCR Multiplex. S: TCAGAAGCTCAGCGAATCATTG AS: CCATTATCACCAGTAAAACGCACC a 95ºC, 30 a 56ºC, 45" a 72ºC 30 a 95ºC, 30 a 59ºC, 45" a 72ºC 30 a 95ºC, 30 a 64ºC, 45" a 72ºC a 95ºC, 30 a 58ºC, 1' a 72ºC
3 Table 2: Validated bio-markers from the INCT_Biomedicine and their use in international networks RECODISA and MAL_ED. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) PCR conditions Reference 1 ipah a,c E. coli enteroinvasiva (EIEC) S: TGGAAAAACTCAGTGCCTCT AS: CCAGTCCGTAAATTCATTCT 2 aata b,c proteína transportadora antiagregação, E. coli enteroagregativa (EAEC) S: CTGGCGAAAGACTGTATCAT AS: CAATGTATAGAAATCCGCTGTT stx1 a,d shiga-toxina 1, E. coli enterohemorrágica (EHEC) S: CAGTTAATGTGGTGGCGAAGG AS: CACCAGACAATGTAACCGCTG stx2 a,d shiga-toxina 2, EHEC S: ATCCTATTCCCGGGAGTTTACG AS: ATCCTATTCCCGGGAGTTTACG 5 eae a,d intimina, E. coli enteropatogênica (EPEC) S: CCCGAATTCGGCACAAGCATAAGC AS: CCCGGATCCGTCTCGCCAGTATTCG a 95ºC, 30 a 57ºC, 45" a 72ºC MalEd Project, bfpa b,d proteína bfpa, EPEC S: GGAAGTCAAATTCATGGGGGTAT AS: GGAATCAGACGCAGACTGGTAGT 7 LT b,d toxina termolábil, E. coli enterotoxigênica (ETEC) S: CACACGGAGCTCCTCAGTC AS: CCCCCAGCCTAGCTTAGTTT ST b,d toxina termoestável, ETEC S: GCTAAACCAGTAGAGGTCTTCAAAA AS: CCCGGTACAGAGCAGGATTACAACA Virulence gene 9 aap b,d dispersina, EAEC S: ATGAAAAAAATTAAGTTTGTTATCTT a 95ºC, 30 a Sheik et al, ºC, 1 a 72ºC 10 asta b,d EAST1, EAEC AS: GGTCGCGAGTGACGGCTTTGT 112 Piva et al, Legend: a Gene cromossomal; b Gene plasmidial, c S: iniciador senso; AS: iniciador anti-senso pb: pares de bases PCR comum; d PCR Multiplex. Referrences: Sheikh J, Czeczulin JR, Harrington S, et al. A novel dispersin protein in enteroaggregative Escherichia coli. J Clin Invest 2002; 110: Piva IC, Pereira AL, Ferraz LR, et al. Virulence markers of enteroaggregative Escherichia coli isolated from children and adults with diarrhea in Brasilia, Brazil. J Clin Microbiol 2003; 41:
4 Table 3: Bio-markers developed in INCT_Biomedicina for diagnosis and assessment of genetic polymorphism. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification 1 Análise de polimorfismo de um único nucleotídeo no S: GAGTGTAGTTGTTAGACGGAGAC estudo de Intolerância à Lactose (C/T ) AS: ATCAAACATTATACAAATGCAAC a 95ºC, 30 a 54ºC, 1 a 72ºC 2 Análise de polimorfismo de um único nucleotídeo para o S: GGTAGCCTACATTGATTTGC gene do Receptor Toll-Like-5 AS: GAGAATCTGGAGATGAGGTACCCG a 95ºC, 30 a 60ºC, 1 a 72ºC Table 4: Bio-markers validated for the study of polymorphisms in regulatory genes of cytokines. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification Reference 1 Análise de polimorfismo de um único nucleotídeo para o gene de Interleucina 8 humana (IL-8) 2 Análise de polimorfismo de um único nucleotídeo no estudo de Intolerância à Lactose (G/A ) S: ACTATATCTGTCACATGGTACTATG AS: CTTATCAAATACGGAGTATGACG a 95ºC, 30 a 54ºC, 1 a 72ºC S: AACAGGCACGTGGAGGAGTT AS: CCCACCTCAGCCTCTTGAGT a 95ºC, 30 a 60ºC, 1 a 72ºC Jiang et al., 2003 Bünning et al., 2003 References: JIANG, Z. D. et al. Genetic susceptibility to enteroaggregative Escherichia coli diarrhea: polymorphism in the interleukin-8 promotor region. J. Infect. Dis. 2003; 188: BÜNING, C et al. The C/C (-13910) and G/G (-22018) genotypes for adult-type hypolactasia are not associated with inflammatory bowel disease. Scand J Gastroenterol 2003; 38:
5 Table 5: Bio-markers developed to study transport proteins and joints strong in intestinal barrier function. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification 1 Claudina-1 S: TCTACGAGGGACTGTGGATG AS: TCAGATTCAGCAAGGAGTCG a 95ºC, 20 a 55ºC, 45 a 72ºC 2 Claudina-2 para camundongo S: CCCACCACCACCAGCTTAAT AS: GAAATGGCTTCCAGGTCAGC a 95ºC, 20 a 60ºC, 45 a 72ºC 3 Claudina-2 para rato S: AGGACTTCCTGCTGACATCCA AS: TCCACCCACTACAGCCACTCT 4 Zona Ocludens-1 para camundongo S: GACCATCGCCTACGGTTTGA AS: AGGTCTCGGGGATGCTGATT 5 Zona Ocludens-1 para rato S: CTCGCACGTATCACAAGCTGA AS: CCTCAGGATATGGCTCCTTCC 6 Ocludina para camundongo S: AAGAGCAGCCAAAGGCTTCC AS: CGTCGGGTTCACTCCCATTA 7 Ocludina para rato S: AACAGCCCCCTAATGTGGAAG AS: GAGTAGGCCATTGGACTGTCG 8 Beta-catenina para camundongo S: TGGTGTCTGCCATTGTACGC AS: CCACTGGTGACCCAAGCATT 9 Beta-catenina para rato S: CTGGCAGCAGCAATCTTACCT AS: AAAGGACTTGGGAGGTGTCCA 10 Transportador de peptídeo intestinal-1 (PEPT-1) para rato S: CCTGAAGAAGATGACCGTTGG AS: GCTGGGGAAGACTGGAAGAGT 11 GAPDH para camundongo S: AGCCTCGTCCCGTAGACAAA AS: TGAATTTGCCGTGAGTGGAG 12 GAPDH para rato S: GTTACCAGGGCTGCCTTCTCT AS: AACTTGCCGTGGGTAGAGTCA 13 Transportador de peptídeo intestinal-1 (PEPT-1) para coelho 14 Co-transportador Sódio-Glicose intestinal para coelho (SGLT-1) S: GGGAGTCTGCTGTCCACAATC AS: GTACATCCCACTGCCGATGAT S: CTGACTGGGTTCGCTTTTCAC AS: GCATCTCGGAAGATGTGGAAG a 95ºC, 30 a 60ºC, 1' a 72ºC a 95ºC, 20 a 60ºC, 45 a 72ºC a 95ºC, 30 a 60ºC, 1' a 72ºC a 95ºC, 20 a 60ºC, 45 a 72ºC a 95ºC, 30 a 60ºC, 1' a 72ºC a 95ºC, 20 a 60ºC, 45 a 72ºC a 95ºC, 30 a 60ºC, 1' a 72ºC a 95ºC, 30 a 60ºC, 1' a 72ºC a 95ºC, 20 a 60ºC, 45 a 72ºC a 95ºC, 30 a 60ºC, 1' a 72ºC a 95ºC, 20 a 64,6ºC, 45 a 72ºC a 95ºC, 20 a 65ºC, 45 a 72ºC
6 15 GAPDH para coelho S: GCCGTGGGCAAGGTCATCCC AS: GCAGCTTTCTCCAGGCGGCA a 95ºC, 20 a 64,6ºC, 45 a 72ºC Table 6: Bio-markers validated for the study of intestinal glutamine transport. Biomarkers Target gene description Sequência dos iniciadores (5-3 ) Product (pb) 1 Transportador de aminoácidos intestinal (SN-1) para coelho 2 Transportador de aminoácidos intestinal (SN-2) para coelho S: GGCAGGGGTTTCCTACAGA AS: CGATGTCTTCCCCTCGAA S: CTGGGACAGAGGGCATTC AS: CGGATTTGATGATGAACAGGT Amplification 20 a 95ºC, 20 a 62,2ºC, 45 a 72ºC 20 a 95ºC, 20 a 62,2ºC, 45 a 72ºC Reference Talukder et al., 2008 References: Talukder et al. Functional characterization, localization, and molecular identification of rabbit intestinal N-amino acid transporter. Am J Physiol Gastrointest Liver Physiol 2008; 294: G1301 G1310. Table 7: Bio-markers developed for the study of receptor guanylyl cyclases and natriuretic peptide C. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) Amplification 1 Receptor de Guanilato ciclase A de rato (GC-A) S:GAACCGAAGCTTCCAAGGTG a 95ºC, 30 a 58ºC, 1' a 72ºC AS: GTGGATATCCCAGAGGCCAGT 2 Receptor de Guanilato ciclase B de rato (GC-B) S: CATCTGCATCGTCACCGAGT AS: TCCACCACGCAGTTAGAGGAC 3 Receptor de Guanilato ciclase C de rato (GC-C) S: GGCGGGATACAATCCAGAGAG AS: ACGGTGCCGTAGAACTTGGTC 4 Receptor de Peptídeo Natriurético C de rato (NPR-3) S: CCTACAATTTCGACGAGACCAAA AS: TCGCTCACTGCCCTGGAT 5 RNA ribossômico cadeia 18S de rato (18S rrna) S: ACATCCAAGGAAGGCAGCAG AS: GCTGGAATTACCGCGGCTG a 95ºC, 30 a 59ºC, 1' a 72ºC a 95ºC, 30 a 63ºC, 1' a 72ºC a 95ºC, 30 a 59ºC, 1' a 72ºC a 95ºC, 30 a 60ºC, 1' a 72ºC
7 Table 8: Bio-markers developed for the diagnosis of bacterial resistance. Biomarkers Target gene description Primers sequence (5-3 ) Product (pb) PCR conditions 1 katg - catalase-peroxidase, Mycobacterium tuberculosis S: GTCGGCGGTCACACTTTC a 95ºC, 30 a 64ºC, 1 a 72ºC AS: GCTACCACGGAACGACGAC 2 rpob subunidade beta da RNA polimerase direcionada ao DNA, M. tuberculosis S: TACGGTCGGCGAGCTGATCC a 95ºC, 30 a 61ºC, 1 a 72ºC AS: TACGGCGTTTCGATGAACC 3 inha - enoil-(acil proteína carreadora) redutase, M. tuberculosis S: TGCTCGAACTCGACGTGCAA a 95ºC, 30 a 62ºC, 1 a 72ºC AS: CGAAGCATACGAATACGCCGA
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Inventory of the expertise on molecular typing of Verocytotoxin-producing
Understanding the immune response to bacterial infections
Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY
Online EFFECTIVE AS OF JANUARY 2013
2013 A and C Session Start Dates (A-B Quarter Sequence*) 2013 B and D Session Start Dates (B-A Quarter Sequence*) Quarter 5 2012 1205A&C Begins November 5, 2012 1205A Ends December 9, 2012 Session Break
Laboratory Techniques for the Diagnosis of TB what s available? Dr. Annette Jepson
Laboratory Techniques for the Diagnosis of TB what s available? Dr. Annette Jepson Outline of Topics to be Covered Laboratory processing of sputum samples Culture techniques Molecular diagnostics New developments
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes
Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification
Nuevas tecnologías basadas en biomarcadores para oncología
Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
19th Swiss TB Symposium Münchenwiler, 25.03.2010
19 th SWISS TUBERCULOSIS SYMPOSIUM Update on culture and identification Münchenwiler, 25.03.2010 Dr. Thomas Bodmer, M.D. Institute for Infectious Diseases Culture of mycobacteria Cultivation of MTB in
Natalia Taborda Vanegas. Doc. Sci. Student Immunovirology Group Universidad de Antioquia
Pathogenesis of Dengue Natalia Taborda Vanegas Doc. Sci. Student Immunovirology Group Universidad de Antioquia Infection process Epidermis keratinocytes Dermis Archives of Medical Research 36 (2005) 425
Applied molecular genetics testing for quality control in seed testing. Dr. Patrik Stolt ScanBi Diagnostics
Applied molecular genetics testing for quality control in seed testing Dr. Patrik Stolt ScanBi Diagnostics It is hard to find things you do not know that you are looking for! Short reminder about DNA/PCR
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md
Major Advances in Cancer Prevention, Diagnosis and Treatment~ Why Mesothelioma Leads the Way H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland
Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI. Ombretta Turriziani Dipartimento di Medicina Molecolare
Dosaggi Sierologici e Molecolari nelle Epatiti B e C METODI MOLECOLARI Ombretta Turriziani Dipartimento di Medicina Molecolare Dosaggi Sierologici e Molecolari nelle Epatiti B e C Molecular Methods Key
CHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL IDENTIFICATION OF DNA DNA AND HEREDITY DNA CAN GENETICALLY TRANSFORM CELLS
CHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL In 1928, Frederick Griffith was able to transform harmless bacteria into virulent pathogens with an extract that Oswald Avery proved, in 1944,
OpenMedicine Foundation (OMF)
Scientific Advisory Board Director Ronald Davis, Ph.D. Genome Technology Center Paul Berg, PhD Molecular Genetics Mario Capecchi, Ph.D Genetics & Immunology University of Utah Mark Davis, Ph.D. Immunology
Identification and characterisation of Verocytotoxinproducing Escherichia coli (VTEC) by PCR amplification of virulence genes
CRL_Method 01 28_04_2008 Pag 1 of 10 Identification and characterisation of Verocytotoxinproducing Escherichia coli (VTEC) by PCR amplification of virulence genes CRL_Method 01 28_04_2008 Pag 2 of 10 INDEX
Performance Evaluation and Clinical Application of MTB NAAT in Orange County, CA. Minoo Ghajar Orange County Public Health Laboratory
Performance Evaluation and Clinical Application of MTB NAAT in Orange County, CA Minoo Ghajar Orange County Public Health Laboratory TB Case Count and Rate: Orange County, CA and the United States, 2012
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics
Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex
SYMPOSIUM. June 15, 2013. Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Boston University
SYMPOSIUM June 15, 2013 Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Bette Korber Los Alamos National Labs HIV evolution and the neutralizing antibody response We have recently
Chapter 43: The Immune System
Name Period Our students consider this chapter to be a particularly challenging and important one. Expect to work your way slowly through the first three concepts. Take particular care with Concepts 43.2
QUALITY AND SAFETY TESTING
QUALITY AND SAFETY TESTING Large scale of solutions for the identification and rapid detection of micro-organisms. Easier investment in molecular techniques Frédéric BAR, Key Account Manager b2 b3b4 Quality
Clinical Research Infrastructure
Clinical Research Infrastructure Enhancing UK s Clinical Research Capabilities & Technologies At least 150m to establish /develop cutting-edge technological infrastructure, UK wide. to bring into practice
Corvinus University of Budapest Faculty of Food Science Department of Microbiology and Biotechnology
Corvinus University of Budapest Faculty of Food Science Department of Microbiology and Biotechnology DETECTION, PCR-BASED MOLECULAR IDENTIFICATION AND TYPING OF FOOD SAFETY RELATED BACTERIA Theses Ágnes
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river
TURIN Historical capital of Italy City of Art, Nature, Food and Sport Turin is crossed by the Po river, the Italy s longest river The Mole Antonelliana (1863-1889), 167.5 Meters tall is the symbol of the
How to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2011 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation
Autoimmunity and immunemediated. FOCiS. Lecture outline
1 Autoimmunity and immunemediated inflammatory diseases Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline Pathogenesis of autoimmunity: why selftolerance fails Genetics of autoimmune diseases Therapeutic
About Our Products. Blood Products. Purified Infectious/Inactivated Agents. Native & Recombinant Viral Proteins. DNA Controls and Primers for PCR
About Our Products Purified Infectious/Inactivated Agents ABI produces a variety of specialized reagents, allowing researchers to choose the best preparations for their studies. Available reagents include
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
ALPHA (TNFa) IN OBESITY
THE ROLE OF TUMOUR NECROSIS FACTOR ALPHA (TNFa) IN OBESITY Alison Mary Morris, B.Sc (Hons) A thesis submitted to Adelaide University for the degree of Doctor of Philosophy Department of Physiology Adelaide
Quando si parla di PCR quantitativa si intende:
Quando si parla di PCR quantitativa si intende: A. Una PCR che produce grandi quantità di DNA B. Una PCR che emette quanti di luce C. Una PCR che quantifica il numero di molecole stampo presenti all inizio
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
PNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005
Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species
Viral Hepatitis Case Report
Page 1 of 9 Viral Hepatitis Case Report Perinatal Hepatitis B Virus Infection Michigan Department of Community Health Communicable Disease Division Investigation Information Investigation ID Onset Date
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples
Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Interleukin-10 gene promoter polymorphism and risk of liver cirrhosis
Interleukin-10 gene promoter polymorphism and risk of liver cirrhosis Y. Liu 1, M.C. Yu 2, A.Q. Zhang 1, Y.B. Wang 1, K. Jiang 1 and J.H. Dong 1 1 Department of Hepatobiliary Surgery, Chinese PLA General
COMPANY INTRODUCTION. www.cusabio.com
www.cusabio.com COMPANY INTRODUCTION CUSABIO is a leading biotechnology company specialized in production of high quality products for gene, protein, antibody, ELISA kit, in vitro diagnostic raw material,
Targeted Therapy What the Surgeon Needs to Know
Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE E15
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE DEFINITIONS FOR GENOMIC BIOMARKERS, PHARMACOGENOMICS,
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany [email protected] Commercial Disclosure Dag Harmsen is co-founder and partial owner
Genomics Services @ GENterprise
Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Community Psychology Master program at Birzeit University, Palestine
Community Psychology Master program at Birzeit University, Palestine Birzeit University, Birzeit, Palestine; Ibrahim Makkawi Lillehammer University College NTNU, Trondheim; Sven Hroar Klempe The impact
Mini-Medical School on Infectious Diseases. Session #1 - Basic Science
Mini-Medical School on Infectious Diseases Session #1 - Basic Science The Microbial World Michael V. Norgard, Ph.D., Chairman Department of Microbiology U.T. Southwestern Medical Center The Microbial World
Thomson Reuters Biomarker Solutions: Hepatitis C Treatment Biomarkers and special considerations in patients with Asthma
: Hepatitis C Treatment Biomarkers and special considerations in patients with Asthma Abstract This case study aims to demonstrate the process of biomarker identification and validation utilizing Thomson
How to construct transgenic mice
How to construct transgenic mice Sandra Beer-Hammer Autumn School 2012 Bad Schandau Pharmakologie und Experimentelle Therapie (APET) Overview History Generation of embryonic stem (ES) cell lines Generation
Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm
Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm Peter Gerner-Smidt, MD, ScD Enteric Diseases Laboratory Branch EFSA Scientific Colloquium N o
Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases
The International School of Advanced Molecular BioMedicine Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases AciTrezza (Catania), Italy, October 2nd-6th, 2009 Hieronymus Bosch: Garden
Infectious Diarrhea. Michael Yin
Infectious Diarrhea Michael Yin A. Introduction Acute gastrointestinal illnesses rank second only to acute respiratory illnesses as the most common disease worldwide. In children less than 5 years old,
HBV DNA < monitoring interferon Rx
Hepatitis B Virus Suspected acute hepatitis >>Order: Acute Unknown hepatitis screen Suspected chronic hepatitis >>Order: Chronic unknown hepatitis screen Acute HBV or Delayed Anti HBs response after acute
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Core Functions and Capabilities. Laboratory Services
Core Functions and Capabilities British Columbia Centre for Disease Control Laboratory Services Understanding the role and value of British Columbia s public health laboratory in protecting our community
DIAGNOSTIC PRODUCTS CATALOGUE 2015
DIAGNOSTIC PRODUCTS CATALOGUE 2015 TABLE OF CONTENTS Introduction...3 ImmuView - Rapid Tests...4 ELISA...5 PCR...6 Animal Blood Products...7 Sterilisation Control...8 Antigens...9 Antisera... 12 E. coli...
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.
Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression
Sur les traces du Campylobacter au Luxembourg
Environmental sources of Campylobacter infections in Luxembourg Priorité Nationale C09/BM/09 Sur les traces du Campylobacter au Luxembourg Catherine Ragimbeau What sort of germ is Campylobacter? A fragile
CONTENT. Chapter 1 Review of Literature. List of figures. List of tables
Abstract Abbreviations List of figures CONTENT I-VI VII-VIII IX-XII List of tables XIII Chapter 1 Review of Literature 1. Vaccination against intracellular pathogens 1-34 1.1 Role of different immune responses
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Insulin Receptor Substrate 1 (IRS1) Gene Variation Modifies Insulin Resistance Response to Weight-loss Diets in A Two-year Randomized Trial
Nutrition, Physical Activity and Metabolism Conference 2011 Insulin Receptor Substrate 1 (IRS1) Gene Variation Modifies Insulin Resistance Response to Weight-loss Diets in A Two-year Randomized Trial Qibin
Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005
Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)
7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 38 credit hours: 1- Basic requirements: 10 credit hours. 150701, 150702, 150703,
Tuberculosis: a Health Disparity Among Asians in Massachusetts as Compared to the General Population BY SARAH NZIKOBA, STEPHANIE TRAN, PHUNG VUONG
Tuberculosis: a Health Disparity Among Asians in Massachusetts as Compared to the General Population BY SARAH NZIKOBA, STEPHANIE TRAN, PHUNG VUONG 1 WHAT IS TUBERCULOSIS (TB)? http://www.medindia.net/patients/patientinfo/images/tuberculosis-tb.jpg
Molecular Diagnosis of Hepatitis B and Hepatitis D infections
Molecular Diagnosis of Hepatitis B and Hepatitis D infections Acute infection Detection of HBsAg in serum is a fundamental diagnostic marker of HBV infection HBsAg shows a strong correlation with HBV replication
PPD LABORATORIES CENTRAL LAB: SUPERIOR SERVICE, QUALITY DATA WITHOUT COMPROMISES
PPD LABORATORIES CENTRAL LAB: SUPERIOR SERVICE, QUALITY DATA WITHOUT COMPROMISES PPD Laboratories provides world-class scientific expertise with state-of-the-art technologies supported by a commitment
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests?
Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests? Martin Wiedmann Milk Quality Improvement Program November 3, 2011 Fluid milk shelf life What defines shelf life
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
The CVN Development Programme a 4-month update
The CVN Development Programme a 4-month update Peter Simmonds Centre for Infectious Diseases University of Edinburgh Edinburgh CVN Development Programme Initiative announced in 2009 to focus development
Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome
Dietary emulsifiers impact the mouse gut microbiota promoting colitis and metabolic syndrome Andrew T. Gewirtz et al N A T U R E VOL 519 5 M A R C H 2 0 1 5 Background Incidence of IBD Fact 1: increasing
General presentation
Cantacuzino National Institute of Research-Development for Microbiology and Immunology General presentation Cantacuzino National Institute of Research-Development for Microbiology and Immunology (NIRDMIC)
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Reliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
ESCMID Online Lecture Library. by author
Do statins improve outcomes of patients with sepsis and pneumonia? Jordi Carratalà Department of Infectious Diseases Statins for sepsis & community-acquired pneumonia Sepsis and CAP are major healthcare
