Instruction Manual. Baculovirus. 6th Edition, May Expression Vector System
|
|
|
- Joseph Hodges
- 10 years ago
- Views:
Transcription
1 Baculovirus Expression Vector System Instruction Manual 6th Edition, May 1999
2 Baculovirus Expression Vector System Manual 6th Edition May 1999 Instruction Manual General Methods 6xHis and GST Purification Direct Cloning For information or to place an order, please call: MABS (6227) For Technical Assistance call: TALK-TEC ( ) Torreyana Road San Diego, CA USA Tel: (619) Fax: (619) URL:
3
4 Table of Contents Baculovirus Memorandum of Agreement Opening Remarks The Baculovirus Expression Vector System Advantages of using the Baculovirus Expression Vector System AcNPV Baculovirus DNAs AcNPV C6 Wild-type Baculovirus DNA BaculoGold Linearized Baculovirus DNA Linearized AcRP23.lacZ Baculovirus DNA Linearized AcUW1.lacZ Baculovirus DNA General Methods Selecting an Appropriate Baculovirus Transfer Vector Optimizing Gene Expression Cloning your Gene into a Baculovirus Transfer Vector Preparing Vector and Insert Ligating Vector and Insert Propagating Vectors Purifying Vectors Insect Cell Lines General Handling Techniques Monolayer Cultures Suspension Cultures Freezing and Thawing Insect Cells Producing and Maintaining AcNPV-derived Baculoviruses Generating Recombinant Baculoviruses by Co-Transfection End-point Dilution Assay Plaque Assay Plaque Pickup Amplifying Virus Storing Virus Particles Isolating AcNPV Particles Isolating AcNPV DNA Expressing Recombinant Proteins Monolayer Cultures Suspension Cultures Purifying Recombinant Proteins Non-secreted Recombinant Proteins Cell Lysate Preparation Secreted Recombinant Proteins vi vii iii
5 5. Purification Systems xHis Expression and Purification Kit Batch Purification Column Purification GST Expression and Purification Kit Batch Purification Column Purification Dialyzing GST-Fusion Protein Checking Purity and Recovery of Recombinant Protein Cleaving Fusion Proteins using Site-specific Proteases Thrombin Cleavage Factor X a Cleavage Generating 32 P-Labeled GST or 6xHis Fusion Proteins Generating Recombinant Baculovirus by Direct Cloning Troubleshooting Cloning Inserts into Baculovirus Transfer Vectors Insect Cell Culture Co-transfection Plaque Assay Virus Amplification Recombinant Protein Production xHis Expression and Purification System GST Expression and Purification System Thrombin Cleavage References Appendix A: BaculoGold Starter Package and Transfection Kit Appendix B: 6xHis Kits Appendix C: GST Kits Appendix D: vehuni and vecuni Baculovirus Reagent Sets Appendix E: Baculovirus Transfer Vectors I. Polyhedrin Locus-based Vectors Fusion Vectors BioColors Baculovirus Vectors Multiple Promoter Transfer Vectors II. p10 Locus-based Vectors Multiple Promoter Transfer Vectors Index iv
6 Figures 1. The Baculovirus life cycle in vivo and in vitro Design of AcNPV BaculoGold DNA Design of AcRP23.lacZ DNA Design of AcUW1.lacZ DNA Experimental scheme using BEVS Monolayer and suspension Sf cultures Comparison of uninfected and infected Sf9 cell monolayers well End-point Dilution Assay Western blot analysis of Retinoblastoma protein (Rb) in plaques Examples of recombinant protein expression levels in Baculovirus-infected Sf9 cells Characterization of native and Baculovirus-expressed Retinoblastoma protein (Rb) Functional activity of Baculovirus-expressed recombinant protein Expression, purification and cleavage of fusion proteins Strategy for directly cloning EcoRI fragments into the AcMNPV genome Baculovirus vectors for direct cloning BioColors in Sf9 cells Separation of Baculovirus-expression GFP and BFP using fluorescence-activated cell sorting Tables 1. Comparison of BEVS and bacterial expression systems Analysis of recombination frequencies by plaque assays Vector selection Recommended cell numbers and approximate densities for various assays v
7 BACULOVIRUS MEMORANDUM OF AGREEMENT NON-EXCLUSIVE RIGHTS TO USE BACULOVIRUS EXPRESSION VECTOR SYSTEM TECHNOLOGY FOR RESEARCH PURPOSES I. BACKGROUND The Texas Agricultural Experiment Station (TAES) claims rights to technology developed by Dr. Max D. Summers of the Department of Entomology relating to a recombinant Baculovirus expression vector system (BEVS) and the use of such vectors in insect cell culture media for expression of cloned genetic material. TAES is making the system and its components available for noncommercial research purposes. This Baculovirus expression vector system and related subject matter are claimed in two United States Patents, Numbers 4,745,051 and 4,879,236. Commercial rights to BEVS or products thereof are subject to a non-exclusive license, terms of which will be made available upon written request. Information and materials received from TAES relating to BEVS must be taken with the understanding that it is subject to a restrictive license for research purposes only. II. TERMS AND CONDITIONS OF AGREEMENT vi (1) All information and material received under this Agreement shall be used for research purposes only. (2) Access and distribution of the vectors and information must be limited to Recipient and to those personnel who report to Recipient, hereinafter referred to as "Recipient." (3) Recipient agrees to supply TAES preprints of any publications resulting from the use of the BEVS material promptly upon receipt of notice of acceptance from the publishing journal. Preprints should be sent to the attention of the Coordinator of Research Development for Industrial Relations, Texas Agricultural Experiment Station, Texas A&M University, College Station, Texas (4) Recipient and those who report to Recipients are aware of the proprietary interest involved herein and commit to honoring the terms and conditions of this Agreement. (5) Recipient accepts the biological material with the knowledge that it is experimental biological material and that is provided by TAES without warranty of any sort, expressed or implied. Recipient agrees to comply with all applicable governmental regulations for the handling thereof. Recipients shall hold TAES harmless for any damages which may be alleged to result in connection with the use and possession of the requested materials as provided in this Agreement, subject to any relevant state or federal government limitations. (6) This Agreement and Recipient s right to use biological material become effective upon breaking the seal of the package containing biological material and automatically terminates if Recipient fails to comply with any provisions of this Agreement. (7) TAES retains ownership and all rights to biological material not expressly granted and nothing in this Agreement constitutes a waiver of TAES' rights under U.S. Federal, State, or Patent law. NOTE: THESE RESTRICTIONS DO NOT APPLY TO INFORMATION OR TECHNOLOGY WHICH RECIPIENT CAN SHOW ARE IN THE PUBLIC DOMAIN OR FOR WHICH HE/SHE HAD PREVIOUSLY RECEIVED OR DEVELOPED IN GOOD FAITH THROUGH CHANNELS INDEPENDENT OF THE TEXAS AGRICULTURAL EXPERIMENT STATION.
8 Opening Remarks All reagents and materials listed in this manual are for research use only. Safety Requirements These research products have not been approved for human or animal diagnostic or therapeutic use. We suggest that all purchasers follow the NIH guidelines that have been developed for recombinant DNA experiments. All PharMingen products should be handled only by qualified persons trained in laboratory safety procedures. The absence of a product warning is not to be construed as an indication that the product is safe. All possible hazards of many biological products may not be known at this time. Always use good laboratory procedures when handling any of these products. Warranty Information presented in this manual is accurate to the best of our knowledge. It is not, however, guaranteed as such. It is the user s responsibility to investigate and verify the suitability of the supplied materials and procedures for a particular purpose. PharMingen expressly disclaims all warranties of merchantability and fitness for a particular purpose with respect to the use or suitability of the reagents and materials. PharMingen shall in no event be responsible for damages of any nature, directly or indirectly resulting from the use of the products of these kits. Disclaimer This manual is a practical guide for researchers to become familiar with the Baculovirus expression technology as a tool to overexpress foreign genes. It is not intended as a replacement to a textbook about Baculoviruses but rather to serve as an introduction to Baculovirus nomenclature and cite key references to guide the interested reader to additional literature. The information disclosed herein is not to be construed as a recommendation to use the above product in violation of any patents. PharMingen will not be held responsible for patent infringement or other violations that may occur with the use of our products. For commercial use of the 6xHis/Ni-NTA system, licenses may be granted by Hoffmann-La Roche Ltd. (Basel, Switzerland). Please contact QIAGEN Inc., 9600 De Soto Avenue, Chatsworth, CA for further information. All Baculovirus and related products sold by PharMingen are for research use only. The Polymerase Chain Reaction (PCR) is a process patented by Hoffmann-La Roche, Inc. Triton is a trademark of Union Carbide Chemicals and Plastics Co. Technical Assistance and Ordering Information At your request, we will furnish technical assistance and information about our products. Call 800-TALK-TEC ( ) to talk to a Technical Service Specialist. Our specialists have the education and experience necessary to answer your technical questions regarding the reagents and materials listed in this manual. All technical assistance is provided gratis and you assume sole responsibility for results you obtain by relying on that assistance. We make no warranties of any kind with respect to technical assistance or information we provide. Call MABS ( ) to place an order. vii
9 Abbreviations AcNPV Autographa californica nuclear polyhedrosis virus Amp Ampicillin β-gal β-galactosidase BEVS Baculovirus expression vector system BFP Blue fluorescent protein BSA Bovine serum albumin BV Baculovirus CIAP Calf intestinal alkaline phosphatase CsCl Cesium chloride DTE Dithioerythritol DTT Dithiothreitol ECV Extracellular virus EDTA Ethylenediamine tetraacetic acid EtBr Ethidium bromide FACS Fluorescent activated cell sorting FBS Fetal bovine serum GFP Green fluorescent protein GST Glutathione S-transferase h Hour kb Kilobases kd Kilodalton LB Luria-bertani (broth) MCS Multiple cloning site min Minute MOI Multiplicity of infection (plaque-forming units/cell number) NaPi Sodium phosphate NaPPi Sodium pyrophosphate ORF Open reading frame OV Occluded virus particles PAGE Polyacrylamide gel electrophoresis PBS Phosphate buffered saline pfu Plaque-forming unit(s) = virus Pi Inorganic phosphate pi Post infection PMSF Phenylmethylsulfonyl fluoride Rb Retinoblastoma protein RT Room temperature Sf Spodoptera frugiperda Sj Schistosoma japonicum SDS Sodium dodecyl sulfate TBE Tris borate/edta TE Tris/EDTA U Unit v/v Volume: volume ratio wt Wildtype X-gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside YP Yellow protein yr Year viii
10 The 6xHis vectors were developed by PharMingen and produced in collaboration with QIAGEN 1The Baculovirus Expression Vector System The Baculovirus Expression Vector System (BEVS) is one of the most powerful and versatile eukaryotic expression systems available. 1,2 The BEVS is a helper-independent viral system which has been used to express heterologous genes from many different sources, including fungi, plants, bacteria and viruses, in insect cells. The Baculovirus DNA used in PharMingen s BEVS is the Autographa californica nuclear polyhedrosis virus (AcNPV). In this system several Baculovirus genes nonessential in the tissue culture life cycle (polyhedrin, p10, basic) may be replaced by heterologous genes. Since the Baculovirus genome is generally too large to easily insert foreign genes, heterologous genes are cloned into transfer vectors. Co-transfection of the transfer vector and AcNPV DNA into Spodoptera frugiperda (Sf) cells allows recombination between homologous sites, transferring the heterologous gene from the vector to the AcNPV DNA. AcNPV infection of Sf cells results in the shut-off of host gene expression allowing for a high rate of recombinant mrna and protein production. Recombinant proteins can be produced at levels ranging between 0.1% and 50% of the total insect cell protein. Factors influencing foreign gene expression are discussed, although it is difficult to precisely predict how efficiently different genes will be expressed. Baculoviruses (family Baculoviridae) belong to a diverse group of large doublestranded DNA viruses that infect many different species of insects as their natural hosts. 3 Baculovirus strains are highly species-specific and are not known to propagate in any non-invertebrate host. The Baculovirus genome is replicated and transcribed in the nuclei of infected host cells where the large Baculovirus DNA (between 80 and 200 kb) is packaged into rod-shaped nucleocapsids. 4 Since the size of these nucleocapsids is flexible, recombinant Baculovirus particles can accommodate large amounts of foreign DNA. AcNPV is the most extensively studied Baculovirus strain. Its entire genome has been mapped and fully sequenced. 5-7 Infectious AcNPV particles enter susceptible insect cells by facilitated endocytosis or fusion, and viral DNA is uncoated in the nucleus (Fig. 1). DNA replication starts about 6 h post-infection (pi). In both in vivo and in vitro conditions, the Baculovirus infection cycle can be divided into two different phases, early and late. During the early phase, the infected insect cell releases extracellular virus particles (ECV) by budding off from the cell membrane of infected cells. During the late phase of the infection cycle, occluded virus particles (OV) are assembled inside the nucleus. The OV are embedded in a homogenous matrix made predominantly of a single protein, the polyhedrin protein. 8, 9 OV are released when the infected cells lyse during the last phase of the infection cycle. Whereas the first ECV are detectable 10 h pi, the first viral occlusion bodies of wild-type AcNPV virus develop 3 days pi but continue to accumulate and reach a maximum between 5-6 days pi. Occlusion bodies are visible under light microscopy where they appear as dark polygonal-shaped bodies filling up the nucleus of infected cells. Not all known Baculoviruses form occlusion bodies; AcNPV is representative of the group of occlusion body-positive Baculoviruses. The polyhedrin protein, the major component of occlusion bodies, has a molecular weight of 29 kd. 1 During late phases of infection, the polyhedrin protein accumulates to very high levels. Up to 1 mg of polyhedrin protein vehuni and vecuni Baculovirus DNAs allow for direct cloning of heterologous genes into the BV genome (Chapter 6). 1
11 may be synthesized per infected cells accounting for 30-50% of the total insect protein. Although the polyhedrin protein seems to be one of the most abundant proteins in infected insect cells, it is not essential for the Baculovirus life cycle in tissue culture. However, in vivo viral occlusion bodies are an important part of the Baculovirus life cycle, essential for its dissemination into the environment (Fig. 1). Deletional or insertional inactivation of the polyhedrin gene in AcNPV results in the production of occlusion body-negative viruses, a phenomenon which simplifies the identification of recombinant viruses. The plaques formed by occlusion body-negative viruses are distinctly different from those of occlusion body-positive wild-type viruses. Newer modified AcNPV allow either color selection to identify recombinants or permit positive survival selection for recombinants (BaculoGold Cat. No K), rendering the occlusion body-based visual screening method obsolete. A variety of Baculovirus Transfer Vectors have been constructed for use with AcNPV DNA (Appendix E). Each vector contains: 1) an E. coli origin of replication, 2) an ampicillin resistance marker, 3) a promoter from the polyhedrin, p10 or basic protein AcNPV gene, 10 4) a cloning region downstream from promoter in which to insert foreign genes and 5) a large tract of AcNPV sequence flanking the cloning region to facilitate homologous recombination. Purified recombinant vectors containing the gene of interest may be co-transfected with AcNPV Baculovirus DNA into insect cells. After several days, recombinant viruses, which arise by homologous recombination between the transfer vector and AcNPV DNA, are selected. A Endocytosis Secondary Infection of Insect Cells Budding Virus B Transfer Vector Your Gene GST/ 6xHIS Tag Co-transfection BaculoGold DNA Uncoating Replication Homologous Recombination BaculoGold DNA Your Gene Viral Occlusion Fusion (Midgut Cells) Recombinant Protein Secondary Infection of Insect Cells Budding Recombinant Virus Soluble in Gut Primary Infection of Host Insect Ingestion Figure 1. The Baculovirus life cycle in vivo and in vitro. A) In vivo. Two distinct viral populations are formed in infected insect cells, occluded and budded virions. Occluded virions are protected from desiccation in the environment, allowing primary infection in susceptible larva. Once ingested, the occlusion body is solubilized in the gut, releasing virions which fuse with midgut cells. The virion nucleocapsid migrates through the cytoplasm to the nucleus. The core is uncoated from the capsid structure in the nucleus. Here replication takes place. Secondary infection is mediated by the budded form of the virus entering adjacent cells via adsorptive endocytosis. B) In vitro. The Baculovirus genome is too large to directly insert foreign genes easily. Hence, the foreign gene is cloned into a transfer vector that contains flanking sequences which are homologous (5 and 3 to your insert) to the Baculovirus genome. BaculoGold DNA and the transfer vector containing your cloned gene are co-transfected into Sf9 insect cells. Recombination takes place within the insect cells between the homologous regions in the transfer vector and the BaculoGold DNA. Recombinant virus produces recombinant protein and also infects additional insect cells thereby resulting in additional recombinant virus. 2
12 2 Advantages of using the Baculovirus Expression Vector System Choosing the right system for foreign gene expression can be particularly important in obtaining biologically active recombinant protein. Several unique features of the BEVS have made it the system of choice for many applications (Table 1). This chapter highlights the advantages of using BEVS to express recombinant proteins. Often, recombinant proteins expressed in bacterial systems are insoluble, aggregated and incorrectly folded. 11 In contrast, proteins expressed in BEVS are, in most cases, soluble and functionally active. Features BEVS Bacterial Simple to use Protein size unlimited <100 kd Multiple gene expression Signal peptide cleavage Intron splicing Nuclear transport Functional protein sometimes Phosphorylation sometimes Glycosylation Acylation Table 1. Comparison of BEVS and bacterial expression systems. The insect cell, unlike bacterium, is capable of performing many of the processing events that are required for forming biologically active, foreign proteins. 1) Functional activity of the recombinant protein The BEVS typically produces overexpressed recombinant proteins containing proper folding, disulfide bond formation and oligomerization. 2 Additionally, this system is capable of performing several post-translational modifications. This leads to a protein that is similar to its native counterpart, both structurally and functionally. However, in cases where the authentic protein functions as a heterodimer or relies on tissue- or species-specific modifications, the recombinant Baculovirus-expressed protein may not be functionally active, unless its binding partner or modifying enzyme is co-expressed. 2) Post-translational modifications Several post-translational modifications have been reported to occur in the BV, including N- and O-linked glycosylation, phosphorylation, acylation, amidation, carboxymethylation, isoprenylation, signal peptide cleavage and proteolytic cleavage The sites where these modifications occur are often identical to those of the authentic protein in its native cellular environment. However, the BEVS can express the gene of interest at a high expression rate which may overwhelm the ability of the cell to mod- 3
13 ify the protein product. This often results in lower levels of glycosylation or phosphorylation of the target protein than in the native cell line. Also, tissue- or species-specific post-translational modifications will not be performed in the BV, unless the modifying enzyme is being co-expressed. 3) High expression levels Compared to other higher eukaryotic expression systems, the most distinguishing feature of the BEVS is its potential to achieve high levels of expression of a cloned gene. The BV system has proven particularly useful in the generation of large quantities of proteins for structural analysis The highest expression level reported is 50% of the total cellular protein of an infected insect cell corresponding to approximately 1g of recombinant protein per cells. However, many recombinant proteins are not produced at such high amounts and it is usually difficult to predict the amount of protein expression. There are some guidelines one can follow to optimize protein production. Of primary importance is optimizing the design of the recombinant Baculovirus Transfer Vector (Chapter 4.1). 4) Capacity for large inserts The expandability of the capsid structure of Baculoviruses allows the packaging and expression of very large genes. There is no known upper size limit for the insertion of foreign sequences into the BV genome. 5) Capacity to express unspliced genes Insect cells have the capability to perform intron/exon splicing. However, certain virus-, tissue- or species-specific splicing patterns will not be obtained if they require the presence of particular splicing factors which are not available in the infected insect cell environment. In general, for high protein expression levels, a cdna insert rather than a genomic DNA fragment is recommended. 6) Simplicity of technology BaculoGold technology has made expression of full-length proteins fast, easy and reliable. Recombinant Baculovirus can be obtained in two simple steps cloning and co-transfection in as little as 5 days. The ease of use now rivals that of bacterial expression systems and BEVS technology does not require that the recombinant protein be expressed as a fusion protein. With the addition of several vectors containing genes encoding the green fluorescent protein from the jellyfish Aquorea victoria (Appendix E), protein expression can easily be monitored. 7) Simultaneous expression of multiple genes BEVS has the capability to express two or more genes simultaneously within single infected insect cells. Protein complexes that depend on dimer or multidimer formation for activity can be assembled. A well known example is the formation of complete virus capsids from a variety of viruses which have been assembled in vitro, using BEVS, by coexpressing the capsid subunits simultaneously. To this end, several multiple promoter plasmids have been constructed and are described in Appendix E. 4
14 8) Localization of recombinant proteins Baculovirus-expressed recombinant proteins are usually localized in the same subcellular compartment as the authentic protein. Nuclear proteins will be transported to the insect nucleus, membrane proteins will be anchored into the cell membrane, and secreted protein will be secreted by infected insect cells. 9) Ease of purification PharMingen has developed the 6xHis and glutathione S-transferase (GST) Baculovirus Expression and Purification Kits, designed for easy and reliable single-step purification of recombinant proteins. The 6xHis purification system (Cat. No K) relies on the high specificity of the 6xHis tag for Ni-NTA Agarose. The GST purification system (Cat. No K) takes advantage of the high affinity of glutathione agarose beads for reduced glutathione. These kits combine the advantages of expressing functional and soluble recombinant proteins using BEVS technology with the convenience of a GST or 6xHis affinity purification system. Even under the highest expression levels, most GST and 6xHis fusion proteins expressed in insect cells remain predominantly soluble. An extensive line of vectors has been developed for use in these systems. When using the GHLT, HLT or G series of vectors, the inserted gene will be produced as a fusion protein with an affinity tag on the amino terminus. Vectors in the GHLT series produce a fusion protein composed of both a 6xHis and a GST tag. Vectors in the pacg and the pachlt series produce proteins with a GST or a 6xHis tag respectively. The GST and 6xHis tags can be removed by incubating the protein in the presence of a site-specific protease (Chapter 5). 10) Direct cloning Generally, heterologous genes are cloned into transfer vectors, which homologously recombine with the BV genome in insect cells. vehuni and vecuni Baculovirus DNA allow the direct cloning of heterologous genes into the BV genome (Chapter 6). 21 5
15 6
16 3 AcNPV Baculovirus DNAs Infection of susceptible insect cells AcNPV wild-type virus results in the production of occlusion bodies. These opaque, light-refractive particles can be easily visualized under the light microscope (Chapter 4.5). This phenomenon aids in the identification of recombinant Baculoviruses in which the polyhedrin gene has been replaced by a cloned gene of interest. Recombinant viruses expressing the protein of interest rather than the polyhedrin protein fail to produce occlusion bodies and can be visually identified as occlusion body-negative plaques. However, in the past, non-recombinants were the vast majority over recombinants, usually 1,000:1. Modified AcNPV DNA (BaculoGold, AcRP23.lacZ and AcUW1.lacZ DNA) revolutionized the BV technology and made the occlusion body-based visual screen method obsolete. To improve recombination efficiencies, a single restriction site was added behind the polyhedrin or p10 promoter (AcRP23.lacZ or AcUW1.lacZ, respectively) so that the modified Baculovirus DNA can be linearized. Co-transfecting the linearized AcNPV DNA with a Baculovirus Transfer Vector shows an improved recombination frequency of 30%. The addition of three restriction sites in the polyhedrin locus of BaculoGold allows for the deletion of essential portions of the virus genome. Co-transfecting BaculoGold with a Baculovirus Transfer Vector rescues the lethally deleted virus at recombination frequencies greater than 99% (Table 2). Volume Virus Used Number of Plaques Recombination Viral Stock 10 ml 1 ml 0.1 ml 0.01 ml Frequency A. AcNPV wt high titer stock solution >5,000 >5,000 >5,000 1,096 NA B. AcRP23.lacZ R 1, Baculovirus DNA ~34% XylE NR >5, C. BaculoGold R >5, Baculovirus DNA XylE NR R = Recombinant NR = Nonrecombinant ~99.9% Table 2. Analysis of recombination frequencies by plaque assays. Plaque assays were done using viral inoculum from wild-type high titer viral stock (A), and 5-day transfection supernatants from Sf9 cells co-transfected with either AcRP23.LacZ Baculovirus DNA and pvl1392-xyle plasmid DNA (B) or Baculo- Gold Baculovirus DNA and pvl1392-xyle plasmid DNA (C) on X-gal plates. After 7 days the plates were analyzed and the number of recombinant (R) (yellow in the presence of Catechol) versus non-recombinant (NR) (blue in the presence of β-gal) plaques were noted above. Recombination frequencies were determined by the number of R versus NR plaques. Each lot of BaculoGold Baculovirus DNA undergoes testing to insure that the recombination efficiency is greater than 99%. To improve selection and screening methods, a polyhedrin-driven lacz gene coding for β-galactosidase was inserted into the virus genome. Preparation of linearized BaculoGold DNA removes the lacz gene. Non-recombinant, lacz positive plaques stain blue and recombinant, lacz negative plaques are colorless. Recombinant virus are selected as colorless in a plaque assay overlayed with agar containing X-gal: (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside). 7
17 AcNPV C6 Wild-type Baculovirus DNA The wild-type AcNPV DNA is a super-coiled, double-stranded, circular DNA molecule with a molecular weight of 130 kb BaculoGold DNA, AcRP23.lacZ DNA and AcUW1.lacZ DNA are all derivatives of the AcNPV wild-type DNA. Originally, AcNPV wild-type DNA was widely used for co-transfection with recombinant Baculovirus Transfer Vectors to obtain recombinant BV particles. However, the identification of recombinants is time-consuming, requires considerable skills, and the recombination frequency is only 0.1%. Wild-type AcNPV DNA has no advantages over BaculoGold, AcRP23 DNA or AcUW1.lacZ DNA. PharMingen sells purified ready-to-use AcNPV C6 Wild-type Baculovirus DNA (Cat. No D). BaculoGold Linearized Baculovirus DNA BaculoGold DNA 22, 23 is a modified AcNPV Baculovirus DNA which contains a lethal deletion and does not code for viable virus (Fig. 2). Co-transfection of the BaculoGold DNA with a complementing Baculovirus Transfer Vector rescues the lethal deletion by homologous recombination. Since only the recombinant BaculoGold produces viable virus, recombination frequencies exceed 99%. The flanking sequences of the complementing vector s promoter region must be derived from the polyhedrin locus of the AcNPV wild-type DNA. p10 locus derived vectors (pacuw1, pacuw41, pacuw42, pacuw43) will not recover the lethal deletion of BaculoGold. Furthermore, not all polyhedrin derived vectors are compatible with BaculoGold DNA. The lethal deletion in BaculoGold spans 1.7 kb downstream of the polyhedrin gene. Small streamlined vectors may not contain the entire region and will not rescue the lethal deletion. PharMingen sells purified ready-to-use linearized BaculoGold DNA (Cat. No D). AcNPV wt DNA polyhedrin gene p10 gene Bsu36I Bsu36I Bsu36I Uncut BaculoGold DNA ORF603 LacZ ORF1629 polyhedrin promoter Figure 2. Design of AcNPV BaculoGold DNA. The polyhedrin gene locus of AcNPV DNA has been altered in the following ways: (1) a lacz gene has replaced the viral polyhedrin gene; (2) three Bsu36I cutting sites have been added, in ORF 603, 1629 and in lacz, which do not alter the amino acid sequences of their coding regions. The modified AcNPV DNA is linearized at the Bsu36I cutting sites deleting essential portions of the ORF ORF603 LacZ ORF1629 Cleaved BaculoGold DNA containing lethal deletion
18 Linearized AcRP23.lacZ Baculovirus DNA Linearized AcRP23.lacZ DNA is a modified AcNPV Baculovirus DNA in which the viral polyhedrin gene was replaced by a lacz gene (Fig. 3). AcRP23.lacZ is linearized at a single Bsu36I site introduced downstream of the polyhedrin promoter. Homologous recombination occurs during co-transfection of polyhedrin locus derived Baculovirus Transfer Vectors with AcRP23.lacZ. Approximately 30% of the resulting virus will be homologously recombined Baculovirus DNA. Since recombination disables the lacz gene, recombinant Baculoviruses can be selected by plaque assay on X-gal plates. Nonrecombinant virus express the lacz gene and plaques will appear blue. Recombinant virus do not express lacz and plaques appear colorless. PharMingen sells purified readyto-use linearized AcRP23.lacZ DNA (Cat. No D). Note: When using AcRP23.lacZ DNA, a plaque assay is necessary to identify and isolate recombinants from non-recombinant Baculovirus. AcNPV wt DNA polyhedrin gene p10 gene ORF603 Bsu36I LacZ ORF1629 Uncut AcRP23.lacZ DNA polyhedrin promoter ORF603 LacZ ORF1629 Linearized AcRP23.lacZ DNA polyhedrin promoter Figure 3. Design of AcRP23.lacZ DNA. The polyhedrin gene locus of AcNPV DNA has been altered in the following ways: (1) a lacz gene has replaced the viral polyhedrin gene; (2) a single Bsu36I cutting site has been added downstream of the polyhedrin promoter. The modified AcNPV DNA is linearized at the Bsu36I site. 9
19 Linearized AcUW1.lacZ Baculovirus DNA Linearized AcUW1.lacZ DNA is a modified AcNPV Baculovirus DNA which contains a p10 promoter driven lacz gene (Fig. 4). AcUW1.lacZ DNA is linearized at a single single Bsu36I introduced downstream of the p10 promoter. Homologous recombination occurs during co-transfection of p10 locus derived Baculovirus Transfer Vectors with AcUW1.lacZ. Approximately 30% of the resulting virus will be homologously recombined Baculovirus DNA. Since recombination disables the lacz gene, recombinant AcUW1.lacZ DNA can be color-selected by plaque assay on X-gal plates. Non-recombinant virus express the lacz gene and plaques appear blue. Recombinant virus do not express the lacz gene and plaques appear colorless. Both non-recombinant and recombinant virus are occlusion body positive. PharMingen sells purified ready-to-use linearized AcUW1.lacZ DNA (Cat. No D). Note: When using AcUW1.lacZ DNA, a plaque assay is necessary to identify and isolate recombinants from non-recombinant Baculovirus. AcNPV wt DNA polyhedrin gene p10 gene Bsu36I Uncut AcUW1.lacZ DNA p26 LacZ p74 p10 promoter Linearized AcUW1.lacZ DNA p26 LacZ p74 p10 promoter Figure 4. Design of AcUW1.lacZ DNA. The p10 gene locus of AcNPV DNA has been altered in the following way: (1) a lacz gene has replaced the viral p10 gene; (2) a single Bsu36I cutting site was added downstream of the p10 promoter. The modified AcNPV DNA is linearized at the single Bsu36I cutting site. 10
20 4 General Methods The steps necessary to construct recombinant Baculoviruses using BaculoGold DNA (Cat. No D) are outlined in Figure 5. Protocols for each step are given within this chapter. BaculoGold DNA Clone foreign gene into transfer vector Co-transfect into insect cells Amplify recombinant virus Produce recombinant protein Purify recombinant protein Propagate and purify vector containing foreign genes Figure 5. Experimental scheme using BEVS. Choose the appropriate transfer vector and clone in the foreign gene. Propagate the transfer vector containing the foreign gene using competent cells and purify by suitable means. Co-transfect BaculoGold DNA and recombinant transfer vector into Sf9 insect cells. Amplify the resultant recombinant virus in Sf9 insect cells. Use the amplified viral stock to produce protein. Purify your protein using appropriate methods. 4.1 Selecting an Appropriate Baculovirus Transfer Vector The BaculoGold Starter Package and Transfection Kit (Cat. No K and No K) both contain the Transfer Vector Set pvl1392/1393 (Cat. No P) (Appendix A). The pvl1392 and pvl1393 vectors are based on the polyhedrin locus and contain an extended MCS downstream of a polyhedrin promoter (Appendix E). These vectors have been used extensively to express a variety of proteins and should be adequate in most cases (Chapter 4.6). However, your protein expression needs may require that you use a specialized vector. For this reason, a variety of different Baculovirus Transfer Vectors have been constructed. The choice of vector will be determined by the application of the purified recombinant protein and in some cases by the nature of the protein itself. This section is intended as a guide to help researchers choose a vector which best fits their needs. First, decide whether to clone the gene of interest into a Baculovirus Transfer Vector that will produce the authentic protein encoded by its own ATG, or into a fusion-protein vector providing an N-terminal tag. The BEVS allows the expression of full length authentic proteins and does not require the expression of an N-terminal fusion sequence. This is a major advantage over many other expression systems, although, for certain applications it may be desirable to express a fusion protein. The tag may provide a sequence which can be used to label or modify the protein in a desired way that may not be available with the 11
21 authentic protein. The pacgp67 and pacsecg2t vectors incorporate a secretion signal sequence fused to the desired protein to force the recombinant protein into the secretory pathway. A fusion tag may also ease purification of non-secreted proteins. The pacghlt and pachlt vectors contain GST and 6xHis tags which can be purified on glutathione and Ni-NTA Agarose beads, respectively. Secondly, a suitable promoter must also be chosen. Baculovirus encoded promoters can be divided into the following classes according to the time, the viral infection cycle and conditions under which they are activated. PharMingen s vectors contain either late or very late promoters. Immediate Early Promoters: Baculovirus promoters, activated due to the action of insect encoded transcription factors, control early viral transcription factors. Early Promoters: Baculovirus promoters, activated before viral DNA synthesis occurs, usually control genes necessary for the onset of viral replication (not usually used for foreign gene expression). Late Promoters: Baculovirus promoters, active during and after viral DNA synthesis, when the cell is producing Baculovirus components, control genes necessary to assemble the virus particles (e.g., 39K protein promoter, basic protein promoter). Very Late Promoters: Baculovirus promoters, activated very late during the infection cycle, well after virion assembly has been completed, control genes involved in the formation of occlusion bodies and cell lysis. Most genes controlled by very late promoters are non-essential under tissue culture conditions (e.g., p10 promoter, polyhedrin promoter). The early and immediate early promoters are generally very weak and are not routinely used in Baculovirus Transfer Vectors. The late promoters (the 39K and basic protein promoters) are moderately strong promoters which express their products late in the infection cycle when enzymes needed for post-translationally modified proteins are still present. The pacmp2 and pacmp3 transfer vectors (Cat. No P) contain the basic protein promoter and should be considered when the foreign protein is glycosylated, phosphorylated, etc. The polyhedrin and the p10 protein promoters are very strong promoters expressed during the very late phase of viral infection. They are essentially non-competitive and have been used together to construct multiple promoter vectors. The polyhedrin promoter is most commonly used and has been cloned into a variety of Baculovirus Transfer Vectors. Third, consider whether you want to use a single or multiple promoter vector. Multiple promoter vectors are useful for expressing subunits of heterodimers or for expressing a cell type- or tissue type-specific modifying enzyme along with your protein of interest. Table 3 is designed to help you to decide which Baculovirus Transfer Vector may be most appropriate for your work. 12
22 BaculoGold DNA AcRP23.lacZ DNA AcNPV wild-type DNA AcUW1.lacZ DNA Vector Compatibility Promoter Type Fusion Protein Features Cat. # Polyhedrin locus-based Single Promoter Plasmids pvl1392/3 (set) Polyhedrin very late no Standard polyhedrin locus vectors 21201P pacsg2 Polyhedrin very late site dependent Recommended for large inserts, has an ATG 21410P pacmp2/3 (set) Basic protein late no Facilitates post-translational modifications 21209P pacuw21 p10 very late no Allows for in-larval expression, F1 origin 21206P pacghlt-a, -B, -C (set) Polyhedrin very late yes GST-tag, 6xHis-tag thrombin cleavage site 21463P pachlt-a, -B, -C (set) Polyhedrin very late yes 6xHis-tag, thrombin cleavage site 21467P pacg1 Polyhedrin very late yes GST-tag 21413P pacg2t Polyhedrin very late yes GST-tag, thrombin cleavage site 21414P pacg3x Polyhedrin very late yes GST-tag, factor Xa cleavage site 21415P BioColors BV Control (set) Polyhedrin very late yes BioColors Genes 21518P BioColors His (set) Polyhedrin very late yes BioColors Genes, 6xHis tag, thrombin 21522P cleavage site Secretory pacgp67 A, B, C (set) Polyhedrin very late yes Signal sequence 21223P pacsecg2t Polyhedrin very late yes Signal sequence, GST-tag 21469P Multiple Promoter Plasmids pacuw51 Polyhedrin, p10 very late no Simultaneous expression of 2 foreign genes; 21205P F1 origin pacdb3 Polyhedrin, p10 very late no Simultaneous expression of 3 foreign genes; 21532P F1 origin pacab3 Polyhedrin, p10 very late no Simultaneous expression of 3 foreign genes 21216P pacab4 Polyhedrin, p10 very late no Simultaneous expression of 4 foreign genes 21412P p10 locus-based Single Promoter Plasmids pacuw1 p10 very late no Standard p10 locus vectors 21203P Multiple Promoter Plasmids pacuw42/43 (pair) Polyhedrin, p10 very late no Simultaneous expression of 2 foreign genes; 21208P F1 origin 13 Table 3. Vector Selection. The Vector Selection Chart gives a comprehensive overview of the vectors available for use with the BEVS. Please refer to Appendix E for vector maps and descriptions.
23 4.2 Optimizing Gene Expression Once the vector is chosen, the gene of interest is cloned into a restriction enzyme site downstream of the BV promoter. The efficiency of heterologous gene expression in the BV System can differ by approximately 1000 fold due to the intrinsic nature of the gene and the encoded protein. Modifying the heterologous gene will generally influence gene expression by only 2-5 fold. Researchers should not feel compelled to excessively modify their gene. However, there are some general rules for improving gene expression. Since translation will start at the first ATG initiation codon downstream of the chosen BV promoter, there should be no additional ATG codons upstream of the gene. Additionally, the 5 untranslated sequence between the promoter and the start ATG should be kept to a minimum. In some cases, genes have been efficiently expressed from constructs with around 150 nucleotides between the promoter and the start ATG. However, it is advisable to trim down 5 untranslated sequences to less than 50 nucleotides. The 3 untranslated region downstream of the stop codon is of minor importance. There have been conflicting results regarding the importance of the polyadenylation signal. We have found that the expression level is generally not affected by the sequence downstream of the stop codons. 4.3 Cloning your Gene into a Baculovirus Transfer Vector The techniques required for inserting a foreign sequence into a Baculovirus Transfer Vector and preparing high quality plasmid DNA for co-transfections are described in this chapter. Most of the techniques are not unique to BEVS and we suggest referring to 24, 25 molecular biology manuals for supplementary cloning information. Preparing Vector and Insert Examine the endonuclease restriction map for both the transfer vector and your gene of interest. Identify restriction site(s) common to the cloning site of the vector and to your gene of interest. The 5 cloning site of your insert should be as close as possible to the ATG start codon of your gene (not more than 100 bases upstream). A polyadenylation sequence for the 3 cloning site is optional and has not been shown in this system to improve stability or expression of recombinant protein. Both the insert and Baculovirus Transfer Vector DNA should be digested with appropriate restriction enzymes to generate compatible ends for cloning. If a single restriction enzyme is used to prepare the vector, the DNA must be treated with calf intestinal alkaline phosphatase (CIAP) to remove 5 phosphate groups and prevent recirculation of the vector during ligation. When preparing the insert DNA, the correct restriction fragment (gene of choice) should be purified from an agarose gel by electroelution or DNA purification using glass-milk beads. PCR products should be similarly purified. 14
24 Materials Needed Agarose minigel (agarose concentration depends on the size range of the fragments) 0.5 M EDTA TE-saturated phenol/chloroform Chloroform:isoamyl alcohol (24:1) 7.5 M ammonium acetate Ethanol (100% and 70%) TBE gel electrophoresis buffer CIAP [(0.01 U/pmol of ends) if vector has been digested w/single endonuclease] TE buffer 1. Prepare insert and Baculovirus Transfer Vector DNA by restriction endonuclease digestion. The following 20 µl reaction is provided as an example: 5 µl plasmid DNA (1 µg/µl) 1 µl appropriate restriction enzyme (e.g. BamHI, 20 U/µl) 2 µl appropriate restriction buffer (10X) 12 µl sterile deionized water 20 µl final volume 2. Incubate sample(s) at the appropriate temperature (depending on the restriction endonuclease used, usually 37 C) for 2 4 h. 3. If the vector has been digested with a single restriction endonuclease, the DNA should be treated with CIAP. Thus, add the following components directly to the restriction endonuclease digest after the incubation time has been completed: 20 µl previous volume 3 µl CIAP 10X buffer 1 µl CIAP 6 µl sterile deionized water 30 µl new final volume 4. Incubate for 20 min at 37 C. 5. Add 1 volume of TE-saturated phenol/chloroform. Vortex each sample for 10 s and centrifuge samples for 5 min at 12,000 g in a microcentrifuge. 6. Transfer the upper, aqueous phase to a fresh tube and add 1 volume of chloroform:isoamyl alcohol (24:1). Vortex each sample for 10 s and centrifuge samples for 2 min at 12,000 g in a microcentrifuge. 7. Transfer the upper aqueous phase to a fresh tube and add 0.5 volumes of 7.5 M ammonium acetate and 2.5 volumes of ice-cold 100% ethanol. Mix carefully by slowly inverting tubes several times by hand. Precipitate DNA by placing for 1 h at 20 C or 20 min on dry ice. 8. Collect the DNA pellets by centrifugation at 12,000 g for 5 min. 9. Carefully remove the supernatant, wash the pellet with 1 ml of 70% ethanol, dry briefly in a 37 C oven or in a vacuum desiccator. Resuspend pellet in 20 µl TE buffer. Determine the approximate DNA concentration by agarose gel electrophoresis with comparison to known amounts of DNA standards. 15
25 Ligating Vector and Insert An insert DNA:vector molar ratio of 1:3, 1:1 and 3:1 should be used to determine optimal insert:vector ratios. The total amount of DNA for recessive-end cloning per 10 µl volume should be 200 ng. assuming: s i is the size of the insert s v is the size of the vector r iv is the molar ratio of insert:vector t is the amount of total DNA (insert plus vector) i is the amount of insert needed in the DNA ligation reaction v is the amount of vector needed in the DNA ligation reaction the formula for this is as follows: (s i = i x t) t x s and v = v [(s v /r iv ) + s i ] s v + (s i x r iv ) Materials Needed T4 DNA ligase 10X ligase buffer containing 10 mm ATP Sterile deionized water 1. Set up a ligation reaction as described below. This example assumes an insert:vector ratio of 3:1. Therefore, r iv = 3. We define s v = 10 kb and s i = 3.3 kb. The total DNA for recessive end cloning should be 200 ng. Therefore, t = 200 ng. If we insert these values into the formula above we calculate that we need 100 ng of vector DNA and 100 ng of insert DNA. Thus, our sample ligation looks as follows: 1 µl vector DNA (100 ng/µl, 10 kb) 1 µl insert DNA (100 ng/µl, 3.3 kb) 1 µl T4 DNA ligase (1 Weiss unit) 1 µl 10X ligase buffer 6 µl sterile deionized water 10 µl final volume 2. Incubate the mixture at 16 C overnight. 3. Following the ligation reaction, transform the ligated plasmid DNA (usually 1 µl of the ligation mixture) into competent cells of an appropriate host strain (e.g., HB101, DH5α). Note: To monitor the efficiency of the ligation and transformation steps, competent cells should also be transformed with uncut nonrecombinant vector DNA as well as cut vector DNA which has been ligated in the absence of an insert. 16
26 Propagating Vectors There are many different E. coli strains available which are suitable for preparation of competent cells used in transformations, e.g., DH5α or HB101. Many of these strains are available as commercially prepared competent cells. Several comprehensive manuals containing procedures for preparation of competent cells are listed in the Reference section of this manual. PharMingen s transfer vectors are high copy number vectors and should generate yields of up to several milligrams per liter. Transforming bacterial strains Materials Needed SOB Medium (liter): 20 g Bactotryptone 5 g yeast extract 0.5 g NaCl Autoclave solution 2 M Mg solution Mix equal volumes of 2 M MgCl 2 and 2 M MgSO 4 Filter sterilize solution 2 M Glucose Filter sterilize solution LB/Amp (150 µg/ml) plates Competent cells β-mercaptoethanol Before starting: Place DNA and 5 ml culture tubes on ice. Place culture plates in 37 C incubator to dry. Make SOC medium: (1 ml for each transformation) to each ml of SOB medium, add: 10 µl 2M Glucose solution and 10 µl 2M Mg solution Place SOC medium in the 37 C water bath. Make β-mercaptoethanol dilution - 1:20 dilution in sterile water. 1. Thaw competent cells on ice (100 µl/ transformation). 2. Gently thaw cells by hand. Aliquot 100 µl into pre-chilled 15 ml polypropylene tubes (Falcon Cat. No. 2097). 3. Add 1.7 µl of the fresh β-mercaptoethanol dilution to the 100 µl of bacteria, resulting in a final concentration of 25 mm. Gently swirl. 4. Incubate on ice for 10 min, swirling every 2 min. 5. Add ng of recombinant plasmid DNA (1 µl) to cells and swirl gently. As a positive control, add 1 ng of pbr322 to another 100 µl of cells. 6. Incubate on ice for 30 min. Heat shock at 42 C for seconds (critical!). Return to ice for 2 min. 7. Add 0.9 ml of SOC medium preheated to 37 C. Incubate at 37 C for 1 h, shaking at 225 RPM on an orbital shaker. 17
27 8. Spin down bacteria using a table-top centrifuge at 10,000 g for 5 min. Remove all media except for 100 µl. Resuspend bacteria in remaining 100 µl and spread thin on an LB-Amp plate. 9. Incubate plates at 37 C overnight. 10. The next day, pick up several colonies for miniprep DNA isolation to confirm the presence of the recombinant plasmid. Perform restriction endonuclease analysis to confirm the presence and orientation of the insert. Note: After transformation of a suitable E. coli host strain (e.g., HB101, DH5α, etc.) by a Baculovirus Transfer Vector and plating the bacteria on selective medium, cells harboring recombinant plasmid DNA will grow into colonies. Since all current Baculovirus Transfer Vectors contain an ampicillin resistant gene, the selection should be done on LB plates containing 50 µg/ml ampicillin. Purifying Vectors The quality of both the vector and viral DNA is critical for successful co-transfections. Sf cells are sensitive to some contaminant s found in crude plasmid preparations, which cannot be removed by phenol/chloroform extraction or ethanol precipitation. Vector DNA purified by CsCl-EtBr density gradient centrifugation, anion exchange chromatography (QIAEX resin, QIAGEN Inc) or by extraction with glassmilk will be sufficiently pure for co-transfection. Refer to molecular biology manuals for comprehensive purification 24, 25 techniques. 4.4 Insect Cell Lines Several established insect cell lines are highly susceptible to AcNPV virus infection. The two most frequently used insect cell lines are Sf9 and Sf21 (Cat. No L and No L). Both cell lines were originally established from ovarian tissues of Spodoptera frugiperda larvae and are highly recommended for use in the BEVS. Healthy insect cells attach well to the bottom of the plate forming a monolayer and double every h. Infected cells become uniformly round, enlarged, develop enlarged nuclei, don t attach as well and stop dividing. Sf9 and Sf21 cells may also be grown in suspension. Antibiotics are not required, but gentamicin sulfate (50 µg/ml) and Amphotericin B ( Fungizone ) (2.5 µg/ml) are often added to the media. CO 2 supplementation is not required. We routinely use Sf9 cells and will refer to them from here on; however, Sf21 cells may be substituted. We commonly receive questions concerning cell confluency and BEVS assays. Table 4 was designed to help new users determine accurate cell densities per desired assay. Table 4. Recommended cell numbers and approximate densities for various assays. These numbers are routinely used for Sf9 insect cell cultures in PharMingen s laboratories. Individual users may want to further optimize these numbers for their own experimental systems. 18 Plate # Cells % # Cells/ Assay Size per Assay Confluent Confluent Plate Transfection 60 mm 2.0 x 10 6 ~60% 3.2 x 10 6 Dilution Assay 12 well 1.0 x 10 5 ~30% 3.0 x 10 5 Plaque Assay 100 mm 6.2 x 10 6 ~70% 8.8 x 10 6 Viral Amplification 150 mm 2.0 x 10 7 ~70% 2.9 x 10 7 Protein Production 150 mm 2.0 x 10 7 ~70% 2.9 x 10 7
28 General Handling Techniques The following information is helpful when handling insect cells. Healthy Sf9 cells generally double every h when grown in TNM-FH media (Cat. No M). To maintain healthy cultures, Sf9 cells should be subcultured 1:3 when they reach confluency on plates (three times a week). They will grow reasonably well at temperatures between C. However, after infection it is important to keep the temperature at 27 C ±0.5 C; otherwise, recombinant protein production may be poor, although cells will look infected. An adjustment period ranging from a few days to several weeks should be allowed when transferring Sf9 cells between monolayer and suspension cultures. Always equilibrate insect cell culture medium to RT before using. When removing liquid from a plate of cells, tip the flask at a angle so the liquid pools toward the bottom of the flask. Remove the liquid without touching the cell monolayer using a sterile pipette. When seeding cells into a tissue culture plate or flask, be sure the vessels are placed on a flat surface to ensure homogenous cell density. It is extremely important when doing a plaque assay to provide the proper cell density for plaque formation (Table 4). Rock the plate back and forth to evenly distribute the cells over the surface of the plate. To pellet cells, gently dislodge cells from monolayers and transfer the cell suspension to a sterile centrifuge tube of appropriate size. Spin the suspension for 2 5 min at 1,000 g. Carefully remove the supernatant without disrupting the cell pellet. To resuspend the cell pellet for culture, add the desired volume of fresh medium to the side of the tube and gently resuspend the pellet by pipetting the suspension up and down several times. Insect cells are sensitive to centrifugal forces. For resuspension, cells should be centrifuged for 2 5 min at 1,000 g in a GH-3.7 Beckman GPR horizontal rotor or equivalent. TNM-FH and Grace s medium do not contain ph color indicators. These media usually have a ph around 6.2. Cell viability may be checked using trypan blue. To 1 ml of cells add 0.1 ml of a 0.4% stock solution of trypan blue (in PBS or other isotonic salt solution). Non-viable cells will take up trypan blue. Healthy, log-phase cultures should contain more than 97% unstained viable cells. To minimize centrifugation cells may be transferred to a new tissue culture plate using the old medium. Once cells have adhered (10 min), change to fresh media. Insect cells grow well both in suspension and as monolayer cultures and can be transferred from one to the other with minimal adaptation (Fig. 6). Small-scale propagation of cells can be maintained on plates; however, for large scale it is time-consuming and costly to use plates. Spinner flasks are ideal for scaling up insect cell cultures. Both monolayer and suspension cultures should be evaluated for optimal levels of protein expression. 19
29 A B Figure 6. Monolayer and suspension Sf cultures. A) Monolayer cultures. 150 mm tissue culture plates (Falcon Cat. No. 3025) used at PharMingen for protein production. B) Suspension cultures. 2L, 1 L and 5 L (not shown) spinner flasks (Techne) used at PharMingen for cell propagation. Sf9 cells are suspended in Techne spinner flasks by a magnetic arm that spins at ~60 rpm. The culture volume should always remain less than half of the full volume of the flask. For example, a 1-liter flask should contain <500 ml suspended culture. Monolayer Cultures Materials Needed Sf9 cells (Cat. No L) per plate TNM-FH media (Cat. No M) 15 cm tissue culture plate (Falcon Cat. No. 3025) Sterile 10 ml pipets (Falcon Cat. No. 7551) Hemocytometer (Fisher Cat. No ) 27 C incubator In monolayer cultures, you may notice loosely attached cells or cells floating in the medium. These floaters are especially frequent in cultures that are overgrown. In healthy cultures, floaters should be less than 2% of the cell population. When resuspending attached cells, use a stream of medium from a 10 ml pipette or a Pasteur pipette and gently dislodge the cells from the surface. Strongly attached cells may require persistence and more forceful pipetting. Try to minimize foaming. Trypsin and other enzymes are not recommended to dislodge Sf9 cells. Cell scrapers should be used only if absolutely necessary, as scraping may damage cells. Initiate new plate or flask cultures by adding one volume of the cell suspension to two volumes of fresh medium. Confirm that initial cell density is approximately 30%. 20
30 Cells may be grown in BaculoGold Protein-free medium (Cat. No M). Sf9 and Sf21 cells may attach more firmly in Protein-free medium and doubling time may vary. Sf9 cells can be adapted to Protein-free medium by slowly decreasing the ratio of TNM-FH to Protein-free medium (Cat. No M and No M). Split a confluent plate of Sf9 cells, and allow them to attach to a fresh tissue culture plate. Remove the medium and replace it with a 1:2 ratio of Protein-free:TNM- FH media. Incubate cells until confluent. Split the cells and allow them to attach. Remove the media and replace with a 1:1 ratio of Protein-free:TNM-FH medium. Incubate cells until confluent. Split the cells and allow them to attach. Remove the media. and replace with a 2:1 ratio of Protein-free:TNM-FH medium. For the next medium change use pure Protein-free medium. Suspension Cultures Materials Needed TNM-FH media (Cat. No M) Spinner flask (Techne) Sf9 cells per ml of culture (Cat. No L) Hemocytometer (Fisher Cat. No ) 27 C Incubator Spinner apparatus Sf9 and Sf21 cells grow well in suspension cultures. A spinner culture should be started at an initial density of cells/ml. The cell density can be easily determined using a hemocytometer. Incubate spinner flasks at 27 C under constant stirring at rpm. Routine maintenance of spinner cultures requires subculturing when the cell density reaches approximately cells/ml (2-3 times a week). Remove 65-75% of the cell suspension and replace with fresh medium. Re-seed the culture in a clean sterile spinner flask at least every 2 weeks to prevent build-up of by-products or other contaminants. Aeration may be required for large cultures or during infections. Optimum conditions depend on the particular setup and should be determined empirically. 1 Sf9 cells grown in suspension culture may be adapted to serum-free medium by slowly decreasing the ratio of TNM-FH to Protein-free medium. Remove 2/3 of a healthy suspension culture containing cells/ml and replace with Protein-free media. When a density of cells/ml is reached (usually 3 4 days) replace 2/3 of the culture with Protein-free media. Repeat these steps until the culture is 100% Protein-free. 21
31 Generating Recombinant Baculoviruses by Co-Transfection Prepare at least 10 µg of highly purified plasmid DNA for co-transfection. Sf cells are sensitive to some contaminants found in crude plasmid preparations that are not removed during phenol/chloroform extraction or ethanol precipitation. Impure preparations of plasmid DNA are toxic to the cells, and many cells may lyse shortly after transfection. The result is a lower viral titer. At about 24 h post-transfection, Sf9/Sf21 cell viability should be greater than 97%. Materials Needed Sf9 cells (Cat. No L), cells per plate Three 60 mm tissue culture plates (Falcon Cat. No. 3802) 15 ml TNM-FH insect medium (Cat. No M) 1.0 µg BaculoGold DNA (Cat. No D) (0.5 µg per co-transfection) 2-5 µg Recombinant Baculovirus Transfer Vector DNA containing your insert Wild-type AcNPV Virus supernatant (Cat. No E) 2 µg pvl1392-xyle Control Vector (Cat. No P) Transfection Buffer A and B Set (Cat. No A) 100 µl catechol solution (500 µm catechol, 50 µm sodium bisulfate solution) 1. Prepare and label three tissue culture plates, one each for the experimental cotransfection, positive co-transfection control, and negative control. Seed Sf9 cells onto each 60 mm tissue culture plate. Initial cell density should be 50 70% confluent. Cell attachment should be done on a flat and even surface, allowing the cells to attach firmly, usually about 5 min. If cells don t attach after that time, they are either not healthy or the wrong plates have been used (e.g., non-coated petri dishes). Note: A fourth tissue culture plate may be seeded with 2 x 10 6 Sf9 cells for infection with wild-type AcNPV virus as a positive control for infection. 2. Experimental co-transfection: Combine 0.5 µg BaculoGold DNA and 2 5 µg recombinant Baculovirus Transfer Vector, containing your insert, in a microcentrifuge tube. Mix well by gentle vortexing or by flicking the tube. Let mixture sit for 5 min before adding 1 ml of Transfection Buffer B. 3. Positive control co-transfection: Combine 0.5 µg BaculoGold DNA and 2 µg pvl1392-xyle Control Transfer Vector DNA in a microcentrifuge tube. Mix well by gentle vortexing or by flicking the tube. Let mixture sit for 5 min before adding 1 ml of Transfection Buffer B. 4. Aspirate the old medium from the cells on the experimental co-transfection plate and replace with 1 ml of Transfection Buffer A. Make sure that the entire surface of plate is covered to prevent the cells from drying out. 5. Aspirate the old medium from the positive control co-transfection plate and replace it with 1 ml of Transfection Buffer A as in Step Aspirate the old medium from the negative control plate and replace it with 3 ml fresh TNM-FH medium. Nothing else will be added to this plate. 7. Add the 1 ml of Transfection Buffer B/DNA solution from Step 2, drop by drop to the experimental co-transfection plate. After every 3 5 drops, gently rock the plate 23
32 back and forth to mix the drops with the medium. During this procedure, a fine calcium phosphate/dna precipitate should form. This precipitate is characterized by a fine white milky color. 8. Add 1 ml of the Transfection Buffer B/XylE Positive Control DNA solution from Step 3 drop by drop to the positive control co-transfection control plate, as in Step Incubate all three plates at 27 C for 4 h. 10. After 4 h, remove the medium from the experimental and positive control cotransfection plates. Add 3 ml fresh TNM-FH medium and rock the plates back and forth several times before once again removing all the medium. Add 3 ml of fresh TNM-FH medium and incubate the plates at 27 C for 4 5 days. It is not necessary to change the medium of the negative control plate. 11. After 4 days, check the three plates for signs of infection. Compare the negative and positive controls to the experimental co-transfection plate. Infected cells will appear much larger than uninfected ones, will have enlarged nuclei, will stop dividing, and will often float in the medium. 12. After 5 days, collect the supernatant of the positive control and experimental cotransfection plates. Assess co-transfection efficiencies by end-point dilution assay or identify recombinant viruses by plaque assay. Transfection supernatants should be amplified to produce high titer virus stocks that are used for recombinant protein production. Alternatively, single recombinant viruses, obtained by plaque purification or end-point dilution assay, may be used for virus amplification. To check the expression of your protein of interest, lyse the transfected cells or use an aliquot of the supernatant (depending whether the recombinant protein is secreted or not) and spin down debris. Transfected cells expressing the XylE protein can be assayed by adding µl catechol solution to the cells after the cotransfection supernatant has been removed and replaced with fresh media. Infected cells will turn bright yellow in approximately 5 min. End-point Dilution Assay The end-point dilution assay (EPDA) is a versatile assay that is useful for a variety of screens. A 96-well plate EPDA may be used to replace the plaque assay and plaque purification as a method for either determining viral titer or identifying and purifying recombinant virus. 1 We use a modified 12-well plate EPDA on a routine basis. In the 12-well EPDA, individual wells containing equal amounts of insect cells are inoculated with 100, 10, 1 or 0 µl aliquots of the original transfection supernatant, wild-type virus, or recombinant XylE positive control viral (typically pvl1392-xyle) supernatant (Fig. 8). This modified EPDA is useful for determining the efficiency of the initial co-transfection, identifying infected cells, approximating viral titers, and amplifying viral titer. Cells are visually inspected for signs of infection following an initial co-transfection in tissue culture plates. However, it may be difficult to identify infected cells as signs of infection are not always visually apparent, particularly if the transfection efficiency is low. The EPDA is then used to amplify the viral titer, and a visual comparison between cells inoculated with 100, 10, 1 and 0 µl of the original transfection supernatant is used to ascertain whether or not the initial co-transfection was successful. For example, if cells receiving 100 µl of the initial co-transfection supernatant look infected in the EPDA, but cells receiving 10, 1 and 0 µl do not, then it is likely that the viral titer is low and should be amplified to produce a high titer stock. If the EPDA is used as an amplification step to generate a high titer stock, care should be taken to avoid cross-contamination between 24
33 wells containing different viruses. Wild-type virus is highly infectious and can contaminate wells containing recombinant virus. If cells receiving 100 µl of the original co-transfection supernatant look similar to those receiving 0 µl, it is likely that the original cotransfection did not result in a significant viral titer, and must be amplified. Two types of positive EPDA controls are recommended. The supernatant from a pvl1392 XylE transfection is a particularly useful positive control. Cells expressing the gene turn yellow in the presence of catechol and are easily identifiable (Fig. 8B). A small number of infected cells may not turn yellow. For example, cells which are newly infected will show signs of infection (stop dividing, become enlarged and float) but may not yet be producing protein. Additionally, cells near the 5th day of infection may have begun to lyse and much of their protein may be dispersed throughout the media. The wild-type virus, a viral stock of known titer, can be used as a standard against which to approximate viral titers. Cells infected with wild-type virus will, in addition to showing typical visual signs of infection, contain occlusion bodies. This criterion is particularly useful for first-time users who have not previously visualized infected cells. The wildtype virus can also be used to verify the health and infectivity of the cells. Viral titers may be approximated by performing the 12-well EPDA with your transfection supernatant and a viral stock of known titer. A high titer stock at 2 X 10 8 pfu/ml (wild type viral stock, Cat. No E) will show equal signs of infection in all three (100, 10 and 1 µl) infected wells, 3 days pi. Each well of the 12-well plate contains 3X10 5 cell and a high titer stock contains 2 X 10 5 virus/µl, resulting in nominal cell proliferation and total cell infection three days pi. If your transfection supernatant shows a 10-fold decrease in the number of infected cells between dilutions, you should amplify the virus once or twice more to generate a high titer stock for protein production. High titer virus stocks are used for infection of cells at optimal multiplicity of infection (MOI = No.virus/No.cells) resulting in maximum protein production. 100 µl 10 µl 1 µl 0 µl A. AcNPV wild-type viral stock B. Recombinant AcNPV-XylE C. Recombinant AcNPV-IL-2 Figure well End-point Dilution Assay. A twelve-well tissue culture plate was seeded at 30% confluency with Sf9 cells and infected with 100, 10, 1 and 0 µl aliquots of viral inoculum from AcNPV wild-type high titer stock (A), Recombinant AcNPV-XylE transfection supernatant (B) and recombinant AcNPV-IL2 transfection supernatant (C). Photographs of each well were taken 3 days pi. 25
34 Materials Needed Sf9 cells (Cat. No L) One 12-well tissue culture plate (Falcon Cat. No. 3043) 12 mls TNM-FH insect medium (Cat. No M) Baculovirus transfection supernatant 1. Seed Sf9 cells per well on a 12-well plate. Allow cells to attach firmly. Replace medium with fresh TNM-FH. 2. Add 100, 10, 1 and 0 µl of the recombinant virus supernatant (usually obtained 5 days after the start of transfection) to separate wells. Do the same for the positive control, e.g., pvl1392-xyle supernatant or wild-type viral stock. 3. Incubate the cells at 27 C for three days. Examine the cells for signs of infection. 4. A successful transfection should result in uniformly large infected cells in the 100, 10, and 1 µl experimental wells. The cells in the 0 µl control wells should not look infected because they were not inoculated with virus. 5. If only the 100 µl and 10 µl wells seem to have infected cells and the 1 µl well looks more like the control, then the titer of your virus supernatant is low. Amplify the virus an additional time before you proceed with protein production. 6. The cells from the 100 µl well can be harvested and lysed in lysis buffer (Chapter 5.6.1). The desired protein production may be checked by western blot analysis (if antibodies are available) or by Coomassie blue-stained SDS-PAGE gel. 7. It is recommended that the virus supernatant from the 100 µl well is kept as the first viral amplification stock, however care should be taken to avoid crosscontamination between wells containing different virus. 8. To further purify the virus population, a plaque assay purification may be performed. It is optional for BaculoGold DNA users, but required if any other AcNPV DNA was used for co-transfection. Plaque Assay The plaque assay can be used to plaque purify virus or to determine viral titer in plaque-forming units per ml (pfu/ml) so that known amounts of virus can be used to infect cells during subsequent experimental work. In this assay, cell monolayers are infected with a low ratio of virus, such that only isolated cells become infected. An overlay of agarose keeps the cells stable and limits the spread of virus. When each infected cell produces virus and eventually lyses, only the immediate neighboring cells become infected. Each group of infected cells is referred to as a plaque. Uninfected cells are dispersed throughout the culture, surrounding the plaques. After several infection cycles, the infected cells in the center of the plaques begin to lyse and the peripheral infected cells remain surrounded by uninfected cells. This phenomenon causes the light passing through the infected cells to refract differently than the surrounding uninfected cells, and the plaque can be visualized either by the naked eye or by light microscopy. Each plaque represents a single virus. Therefore, clonal virus populations may be purified by isolating individual plaques. Individual plaques obtained from varying dilutions of a viral stock can be counted to determine the viral titer (pfu/ml) 26
35 of a given transfection amplification supernatant. The condition of the cells and their even distribution over the surface of the tissue culture plate is important to the success of a plaque assay. Cells should be healthy and in log growth phase at the time of the assay and at least 90% viable. Clumpy cells, cells that are not evenly distributed at the correct density (~ 70%) over the plate, and cells that do not adhere to the tissue culture dishes within about 2 h after plating are detrimental to the assay. A kd B kd Figure 9. Western blot analysis of Retinoblastoma protein (Rb) in plaques. 10 randomly picked plaques were amplified from plates inoculated with pvl1392-rb rescued BaculoGold virus (A) and plates inoculated with BaculoGold alone (B). As expected, Rb expression was only detected in plaques obtained from cultures inoculated with pvl1392-rb (A), and not in the background plaques in non-rescued cultures (B). Rb was detected using an anti-human Rb monoclonal antibody (clone G3-245, Cat. No A). Materials Needed Sf9 cells (Cat. No L) Three 100 mm tissue culture plates (Falcon Cat. No. 3003) 130 ml TNM-FH insect medium (Cat. No M) Baculovirus transfection supernatant 1-2 g Agarplaque-Plus Agarose (Cat. No A) 100 ml protein-free insect medium (Cat. No M) 1. Seed Sf9 cells at cells on a 100 mm plate. Allow the cells to attach firmly to the plate (10 min). It is important that this is done on a level surface to allow the cells to spread evenly over the bottom of the plate. 2. Replace medium with 10 ml fresh TNM-FH. 3. Add virus inoculum to the plate. Commonly, serial dilutions of the viral transfection supernatant (10 3, 10 4, 10 5 ) are made and 100 µl of each dilution is added to the medium of each plate. Mix gently by rocking the plate. Larger dilutions will be necessary for high titer stock solutions. 4. Incubate the plates at 27 C for 1 h to allow virus particles to infect the cells. 27
36 5. While the cells are incubating, prepare a 2% agarose solution using Agarplaque- Plus Agarose (low melting point agarose) in protein-free medium. Heat the solution in a microwave until the agarose is dissolved; allowing the solution to reach boiling will help to ensure its sterility. Take care that all the agarose is melted but do not overheat. High heat will cause precipitation of certain nutrients. Cool to 45 C in waterbath. Prewarm 1X volume of TNM-FH to room temperature (RT). 6. Mix equal volumes of the agarose solution and pre-warmed TNM-FH medium. The final agarose solution should be between 0.8% and 1%. A final agarose concentration less than 0.8% will not solidify well, whereas concentrations over 1% will cause damage to the cells. Remove plates from incubator and remove medium. Overlay cells with 10 ml of the Agarplaque-Plus Agarose solution by carefully adding agarose to the side of the tilted plate. Allow plates to sit undisturbed on a level surface until agarose hardens (about 20 min). If color selection is required (e.g., AcRP23.lacZ or AcUW1.lacZ), add 100 µl of an X-gal stock solution (25 mg/ml X-gal in DMF) to 10 ml of agarose solution before pouring it onto the plates. 7. Plates should be kept in a humid atmosphere at 27 C until visible plaques develop (6-10 days). Plaques can be visualized by inverting the plates on a dark background and illuminating them with a strong light source from the side of the plate, or by holding them at a 45 angle into a light source. Plaques can be used to determine virus titer or for screening to identify recombinant virus. Plaque Pickup To ensure proper isolation, it is best that plaques are picked from plates containing fewer than 50 plaques. Plate several dilutions of the virus to ensure that a sufficiently low number of plaques are obtained. Plaques maybe picked up using sterile micropipette tips (1,000 µl) or microcapillary tubes. 1. Mark the plate under the plaque with a marker. Using a sterile pipette tip, remove an agarose plug directly over the plaque; pick up between 10 and 100 plaques in this manner. 2. Place each agarose plug in separate microcentrifuge tubes containing 1 ml tissue culture medium. Elute the virus particles out of the agarose by rotating the tube overnight at 4 C. 3. Add 200 µl of each plaque pickup to separate wells of a 12-well tissue culture plate seeded with cells per well in 1 ml fresh TNM-FH media. Incubate the plates for 3 days at 27 C. 4. The virus supernatant of this passage one stock can be collected and centrifuged for 5 min at 1,000 g at 4 C to remove debris. Store at 4 C. 28 Materials Needed Sf9 cells (Cat. No L), 12-well tissue culture plate (Falcon Cat. No. 3043) 100 mm tissue culture plate (Falcon Cat. No. 3003) TNM-FH media (Cat. No M) Sterile micropipette tips or capillary tubes Microcentrifuge tubes
37 5. Seed a 100 mm tissue culture plate with cells for each plaque pickup. Allow cells to attach and replace medium with 10 ml fresh TNM-FH media. 6. Add 200 µl of the passage one stock to the 100 mm plate and incubate at 27 C for 4 days. Save the remaining 800 µl passage one stock at 4 C as a backup. 7. Harvest the viral supernatant and centrifuge to remove debris. Determine the titer of this passage two stock. If the titer remains below pfu/ml, proceed to Amplifying Virus. Amplifying Virus Prepare large stocks of virus by infecting insect cells at a low MOI (<1) and harvesting supernatant 4 5 days pi. It is critical to use a low MOI because passaging the virus at high MOI increases the number of virus with extensive mutations in their genome. 1 The number of mutant virus is also increased by serial passage, and it may be advantageous to maintain a low passage seed stock from which larger working stocks are amplified. Eventually the titer in the seed stock will be reduced through storage, and it becomes necessary to generate a new passage seed stock. Since BaculoGold recombinants are greater than 99% of the total virus population, it is not generally necessary to initially prepare all stocks from a clonal viral population. However, if there is a reduction in protein production after multiple passages of a viral stock, it may be necessary to isolate clonal viral populations by EPDA or plaque purification. 1 After verification of protein production, the clonal virus population can be amplified to produce a high titer stock. The viral stock is then ready for large-scale protein production. Materials Needed Sf9 cells (Cat. No L) per plate 15 cm tissue culture plate (Falcon Cat. No. 3025) 100 mls TNM-FH insect medium (Cat. No M) Baculovirus low titer virus stock 1. Seed Sf9 cells on a 15 cm plate. Allow them to attach for 15 min and change to fresh TNM-FH. 2. Add 100 µl-1 ml of your low titer recombinant stock to the plate. If you know the virus titer of your stock solution, make sure that the MOI is below one. Repetitive infections with an MOI of substantially higher than one will select for deletion mutants which may no longer express your gene. 3. Incubate the cells at 27 C for 3 days. Check for signs of infection 2 days pi. 4. Harvest the supernatant from the plate, then spin down the cellular debris in a table-top centrifuge 10,000 g. 5. Store the virus supernatant in a sterile tube at 4 C for up to 6 months. For longer storage periods, virus supernatant should be frozen at 80 C. Store in a dark area; the viral titer appears to decrease when exposed to fluorescent light for prolonged periods of time. 6. Determine the viral titer of your amplification solution using the plaque assay procedure. Amplification typically is done 2 or 3 times to attain a high viral titer ( pfu/ml). 29
38 Storing Virus Particles Supernatants containing Baculovirus particles may be stored at 4 C for up to 6 months or frozen at 80 C for a longer period of time. If frozen, avoid multiple freeze and thaw cycles. Upon freezing, the viral titer may decrease and should be reamplified when thawed. Store viral stocks in the dark; titers appear to decrease when exposed to fluorescent light for prolonged periods of time. The best way to preserve a recombinant virus is to isolate its DNA and store it at 80 C. Isolating AcNPV Particles For long-term storage, you may want to isolate the recombinant Baculovirus particles and purify the viral DNA. 1. Produce several liters of high titer Baculovirus stock solution. Remove cell debris by spinning the stock solution at 10,000 g for 5 min. 2. Transfer the supernatant to ultracentrifuge tubes (Nalgene Cat. No ) and pellet the virus particles by spinning the supernatant at 40,000 g for 30 min (18,000 rpm in an SS34 rotor). A bluish-white pellet should be visible at the bottom of each tube. 3. Decant the supernatant and invert the centrifuge tubes on a paper towel for a few minutes. Wipe the residual medium from the inside of the tubes. Carefully avoid touching the virus pellet. 4. Resuspend virus pellet in 10 ml of TE buffer. 5. Prepare a 5%/40% sucrose step gradient in an ultracentrifuge tube: pipette several milliliters of a 40% sucrose cushion into the tube, and carefully layer 3 ml of a 5% sucrose cushion on top of it. 1 Finally, place a layer of the resuspended viral particles on top of the 5% layer. 6. Spin the tubes at 40,000 g for 30 min. During that time, the viral particles will move through the 5% sucrose layer and will be collected at the interface between the 5% and 40% sucrose solution layers. It will appear as a white band. Most contaminants will either float on top of the 5% sucrose layer or precipitate to the bottom of the tube. 7. Use a sterile 9-inch Pasteur pipette to harvest the virus particles located between the two layers. 8. Transfer the harvested virus to a new ultracentrifuge tube and fill up the tube with TE buffer. If necessary, this resuspension can be stored at 4 C for a few days. 9. Spin the tube at 40,000 g for 30 min to pellet the virus. 10. Decant the supernatant and invert the centrifuge tubes on a paper towel for a few minutes. Wipe the residual buffer from inside of the tubes. Avoid touching the virus pellet. 11. Resuspend the virus pellet in an appropriate volume of TE buffer (1 ml per viruses). 12. If necessary, store the virus resuspension for a few days at 4 C. Otherwise, proceed with DNA isolation. 30
39 Isolating AcNPV DNA 1. Digest the resuspended virus particles with RNase A (10 µg/ml final concentration) for 30 min at 37 C. 2. Add 10% SDS to the resuspended virus particles such that the final SDS concentration is 0.5%. 3. Digest with Proteinase K (10 µg/ml final concentration) for 30 min at 37 C. 4. Extract once with phenol/chloroform: Add one volume of phenol to the solution, mix well but avoid vortexing. Spin mixture in a table-top centrifuge to separate the organic and aqueous layers, and then transfer the upper layer to a new tube. Add one volume of phenol/chloroform (1:1 mixture) to the aqueous layer. Mix well and spin tubes in a table-top centrifuge to separate the organic and aqueous layer. Transfer the upper aqueous layer to a new tube. Add one volume of chloroform to the aqueous layer. Mix well and spin tubes in a table-top centrifuge to separate the organic and aqueous layers. Remove the top aqueous layer to a new tube, being careful not to remove any chloroform. 5. Dialyze the aqueous layer against TE (ph 8.0) to eliminate traces of chloroform. We recommend 3 dialysis changes: 2 2 h, 1 overnight. 6. Measure the A 260 of the obtained viral DNA solution to determine concentration and measure the 260/280 ratio to verify purity. The 260/280 for DNA ~1.8. Run a 0.5% agarose gel to verify that the purified DNA is intact and of high molecular weight. 7. The DNA should be aliquoted and stored at 4 C. Since the Baculovirus genome is large, avoid freezing which may shear the DNA. 4.6 Expressing Recombinant Proteins Recombinant proteins have been produced in the Baculovirus system at levels ranging between 0.1% and 50% of the total insect cell protein. For optimal protein production, the MOI should be between 3 and 10. Researchers should test different MOI to empirically determine optimum levels for protein production. The supernatant from protein production should not be used as a viral stock. Since the MOI used was much higher than one, a considerable portion of the virus population may contain deletion mutations. Several variables influence protein levels, functional activity and post-translational modifications of Baculovirus-expressed protein (refer to Chapter 4.2). An example of the variation of expression levels between four proteins cyclin A, cdk2, TR2 orphan receptor, and androgen receptor is seen in Fig. 10(A). The percent of protein expressed in the system is highly dependent on the intrinsic property of the protein. The cyclin A from Fig. 10(A) was not visible by Coomassie blue-staining, and was analyzed by western blot analysis Fig. 10(B). Figure 10(C) shows post-translationally modified IL 4. A comparative analysis of phosphorylated Baculovirus-expressed and native retinoblastoma protein (Rb) is shown in Fig. 11. Figure 12 shows assays used to measure the functional activity of Baculovirus-expressed granulocyte macrophage colony stimulated factors (GM-CSF) and Interleukin-4 (IL-4). We suggest that the user consult the literature pertinent to their recombinant protein to gain information regarding expected post-translational modifications and levels of functional activity. 31
40 A kd Cyclin A Cdk2 TR2 Androgen R B kd Anti-Cyclin A Control C kd IL IL SDS-PAGE 1 2 Western Blot 6 SDS-PAGE Figure 10. Examples of recombinant protein expression levels in Baculovirus-infected Sf9 cells. A) Protein expression levels. Amido black SDS-PAGE of total insect cell lysate (20 µg/lane) containing Baculovirus-expressed cyclin A (lane 1), Cdk2 (lane 2), TR2 (lane 3), or androgen receptor (lane 4). B) Western blot analysis of Baculovirus-expressed cyclin A. Anti-cyclin A monoclonal antibody (clone BF683, Cat. No A) (lane 1). Isotype (negative) IgE control (lane 2). C) SDS-PAGE analysis of Baculovirus-expressed, purified mouse IL-4. IL-4 was purified using an anti-mouse IL-4 monoclonal antibody (clone BVD6-24G2, Cat. No D). The gel was stained with coomassie blue. Note that although Baculovirus-expressed cyclin A was not visible by staining (A, lane 1) it was readily visible by western blot analysis (B, lane 1). IL-4 migrates as two bands due to differential glycosylation (C). For large-scale protein production, we have found that cell propagation in spinner flasks and protein production on tissue culture plates is optimal. Protein may be produced in suspension, but often the levels are lower than on plates. Monolayer Cultures 1. Seed several individual 15 cm tissue culture plates with Sf9 cells per plate. Add fresh TNM-FH medium to make up a total of 30 ml media per plate. 2. Calculate the amount of virus needed using the formula: ml of inoculum needed = MOI (pfu/cell) number of cells/titer of virus per ml. 3. Infect seeded cells with high titer recombinant Baculoviruses stock solution (virus titer should be pfu/ml). For optimal protein production, the MOI should be between 3 and 10. Often researchers will test different MOIs to empirically determine the optimum level of infection. 32 Materials Needed 15 cm tissue culture plate (Falcon Cat. No.3025) High titer viral stock ( pfu/ml) Sf9 cells (Cat. No L) per plate TNM-FH media (Cat. No M) 27 C Incubator
41 4. Incubate the cells for 3 days at 27 C. Check for signs of infection 2 3 days after inoculation. Cells should be enlarged in size (about 2 fold) and a large nucleus should be visible. 5. Harvest the cells and supernatant from the plates and spin down the cells at 10,000 g for 5 min using a table-top centrifuge. Non-secreted proteins will be found in the cell pellet, which can be stored at 80 C. Secreted proteins will be found in the supernatant, which can be stored at 80 C. When purifying secreted protein, the cell pellet should be tested to determine the amount of protein, if any, that remains in the cells. Suspension Cultures Materials Needed TNM-FH media (Cat. No M) Spinner flask (Techne) Sf9 cells per ml of culture (Cat. No L) Hemocytometer (Fisher Cat. No ) 27 C Incubator Spinner apparatus 1. Seed approximately Sf9 cells/ml in a spinner flask. The cells should be healthy (98% viable). 2. Calculate the amount of virus needed using the formula: ml of inoculum needed = MOI (pfu/cell) x number of cells/titer of virus per ml. The desired MOI for protein production is Add the inoculum to the flask. Incubate the flask at 27 C with stirring for 2-4 days. Check the progress of the infection by examining aliquots of the culture under the microscope. 4. To harvest, pellet cells by centrifugation. For secreted protein, store the supernatant in sterile tubes. For non-secreted proteins, store the cell pellet at 80 C and discard the supernatant. 33
42 A kd MOLT-4 Q G1 S M B Rb Sf9 + Rb Sf pprb prb C MOLT-4 Sf + Rb D Sf9 + Rb PAP + PAP Rb pprb prb 1a 2a Rb 1 2 1b 2b Figure 11. Characterization of native and Baculovirus-expressed Retinoblastoma protein (Rb). A) Western blot analysis of native Rb during different stages of the MOLT-4 (a human leukemia cell line) cell cycle. Native Rb migrates as multiple bands due to varying degrees of phosphorylation. Cell cycle stages are denoted as Q (quiescent), G1, S, and M. B) SDS-PAGE analysis of recombinant Rb. Rb is detected in Baculovirus-infected (lane 1) but not in mock-infected (lane 2) Sf9 cell lysates. The gel was stained with Coomassie blue. C) Comparative analysis of native and Baculovirus-expressed Rb by western blot. Rb expressed in MOLT-4 cells (lane 1) is more highly phosphorylated than Rb expressed in Baculovirus-infected Sf9 cells (lane 2). D) Analysis of phosphorylation in Baculovirus-expressed Rb. Baculovirus-infected Sf9 cells were labeled with 32 P orthophosphate and treated or not treated with placental alkaline phosphatase (PAP). Both untreated (lanes 1a and 1b) and treated (lanes 2a and 2b) lysates were immunoprecipitated with anti-rb antibody (clone G3-245, Cat. No A). Detection by autoradiography (top gel) shows that the radioactive label (lane 1a) is greatly reduced (lane 2a) following PAP-treatment. Western blot analysis of the autoradiographs (bottom gel) show that Rb in untreated lysates migrated at a higher molecular weight (lane 1b) than Rb in PAP-treated lysates (lane 2b). Collectively, the data indicate that Baculovirusexpressed Rb is phosphorylated, although at a lower level than native Rb. Abbreviations: prb, underphosphorylated Rb. pprb, phosphorylated and highly phosphorylated Rb species. 34
43 A CPM TdR Incorporated TF-1 Based GM-CSF Assay hgm-csf B kd Serial 3-Fold Dilutions C CPM TdR Incorporated CTLL-2 Based mil-4 Assay mil Serial 3-Fold Dilutions D kd Figure 12. Functional activity of Baculovirus-expressed recombinant protein. hgm-csf and mil-4 were cloned into pvl1393 and expressed in Sf9 cells. A) hgm-csf assay. hgm-csf activity was measured using the continuous cytokine dependent human cell line, TF hgm-csf, at 10 µg/ml, was serially diluted 3 fold in 12 wells across a 96-well flat-bottom microtiter plate in 50 µl. 50 µl of TF-1 cells at cells/ml were then added to each well for a final cell density of /ml. After a 44 h incubation at 37 C in the presence of 5% CO 2, the cultures were pulsed with 0.5 µci tritiated thymidine (20 Ci/mM) for an additional 4 h. The cultures were then harvested and the incorporated thymidine measured by scintillation counting. The data shown represent the cpm of thymidine incorporation versus 3 fold serial dilutions of hgm-csf. Each point represents the mean of three replicates. B) Western blot analysis of hgm-csf. Recombinant human GM-CSF (Cat. No V) loaded at 100 ng/lane and tested by Western blot analysis against purified anti-human GM-CSF (Cat. No D) at 1 µg/ml (lane 1) and normal rat serum at 1:500 dilution (lane 2). C) mil-4 assay. IL-4 activity was measured using the continuous IL-2 dependent murine cell line, CTLL-2. 27,28 mil-4 at 10 µg/ml was serially diluted 3 fold in 12 wells across a 96-well flat-bottom microtiter plate in 50 µl. 50 µl of CTLL-2 cells at cells/ml were then added to each well for a final cell density of /ml. After a 20-h incubation at 37 C in the presence of 5% CO 2, the cultures were pulsed with 0.5 µci tritiated thymidine (20 Ci/mM) for an additional 4 h. The cultures were then harvested and the incorporated thymidine measured by scintillation counting. The data shown represents the cpm of thymidine incorporated versus 3 fold serial dilutions of mil-4. Each point represents the mean of three replicates. D) Western blot analysis of mil-4. Recombinant mil- 4 lysate (Cat. No N) was loaded at 100 ng/lane and tested by Western blot analysis using purified anti-mouse IL-4 (Cat. No D) at 5 µg/ml (lane 1), and normal rat serum at 1:500 dilution (lane 2). 35
44 4.7 Purifying Recombinant Proteins Proteins expressed in the BEVS may be either secreted or non-secreted proteins. Proteins may be isolated by any conventional means including polyacrylamide gel electrophoresis and affinity columns. The purification of GST and 6xHis tagged proteins using affinity columns is described in Chapter 5. Additional protein purification methods are beyond the scope of this manual and are described in specialized manuals. 24 Non-secreted Recombinant Proteins Non-secreted proteins will remain in the cells. Cells should be pelleted and lysed to release the protein. Cell Lysate Preparation 1. Harvest cells infected with recombinant virus 3 days pi. 2. Spin down cells at 2,500 g for 5 min. 3. Resuspend cell pellet in ice-cold Insect Cell Lysis Buffer (Cat. No A) containing reconstituted Protease Inhibitor Cocktail (Cat. No Z). Use 1 ml of lysis buffer per cells. Lyse cells on ice for 45 min. 4. Clear lysate from cellular debris by centrifuging at 40,000 g for 45 min, or filter lysate through a 0.22 µm filter. 5. Harvest clear supernatant, which should contain your recombinant protein. 6. Run an SDS-PAGE gel to determine the amount of your recombinant protein in the total insect lysate. Note: Insect cells infected with either wild-type AcNPV or with XylE recombinant virus should be lysed as a negative control for western blot analysis. This lysate should lack the protein band derived from your cloned gene of interest. If occlusion body-positive virus particles are used for infection, an additional intense band of 29 kd should be visible, which represents the polyhedrin protein of the wild-type virus. If XylE infected cells are used, an additional band should be visible at 35 kd. 36
45 Secreted Recombinant Proteins In general, secreted recombinant proteins are much easier to purify than non-secreted proteins. The ratio between the recombinant protein and host proteins in the medium is much higher than in lysates, especially when protein-free medium has been used. The general strategy for purifying secreted protein from the medium depends on the nature of the recombinant protein. If an antibody against the desired protein is available in large quantities, it can be used for affinity purification. Otherwise, conventional ion-exchange chromatography matrices may perform equally well. Oftentimes, a percentage of the protein tagged for secretion will remain cell-bound due to the intrinsic nature of the protein. Researchers should assay the cell lysate as well as the supernatant to determine the effectiveness of the secretion sequence with their protein. The polyhedrin promoter driven gp67 secretion sequence (contained in PharMingen vectors pacsecg2t and pacgp67, Cat. No P and No P) may be useful in forcing a recombinant protein to secrete. Even non-secreted proteins are secreted using this secretion sequence, unless the proteins are insoluble or are structural components inside the cell. The following protocol is suggested for harvesting protein-containing tissue culture supernatant: 1. If infected cells are growing attached to tissue culture plates, the supernatant can be harvested without detaching the cells from the plates. For infected cells maintained in spinner culture bottles, the whole cell suspension should be harvested and cells removed by centrifuging the suspension at 5,000 g for 10 min. 2. Clear the supernatant by centrifuging it at 10,000 g for an additional 10 min. 3. This cleared medium will still contain a high titer stock of recombinant virus particles which will most likely not influence the protein purification. If you are concerned, you can pellet the virus by centrifuging the solution for 1 h at 50,000 g. A bluish-white pellet will appear, which represents the virus particles. If protein-free insect medium is used, the supernatant will contain only a few secreted viral proteins, including the recombinant protein of your choice. However, it will still contain other contaminants including amino acids, sugars and lipids. 37
46 38
47 5 Purification Systems PharMingen has developed two Baculovirus Expression and Purification Kits, one using the 6xHis affinity tag and the other using the glutathione S-transferase (GST) affinity tag (Appendices B and C for kit components and product descriptions). The 6xHis and the GST Expression and Purification Kits (Cat. No K and No K) combine the advantages of expressing functional and soluble recombinant proteins using Baculovirus expression technology with the purification power of the 6xHis and GST affinity purification systems. Even under the highest expression levels, most 6xHis and GST fusion proteins expressed in insect cells remain predominantly soluble xHis Expression and Purification Kit The 6xHis Purification Kit contains the pachlt-a,b and C transfer vectors which encode an N-terminal 6xHis tag followed by a proteolytic thrombin cleavage site, and an extended MCS. The MCS is in a different reading frame in each of the vectors to simplify cloning (Appendix E). A protein kinase A site is present downstream of the 6xHis tag which allows efficient in vitro phosphorylation of the recombinant protein without destroying the proper folding and functional properties of the protein. The expressed recombinant protein will be a 6xHis fusion protein suitable for affinity purification on Ni-NTA Agarose. Approximately 1 to 2 mg of 6xHis recombinant fusion protein is routinely obtained per liter of insect cell culture. The 6xHis purification method is based upon the high affinity of recombinant proteins equipped with a 6xHis affinity tag for Ni-NTA Agarose (a metal chelating agent). 29 PharMingen selected Ni-NTA Agarose over other metal chelating resins due to its superior affinity purification for 6xHis-tagged proteins. Ni-NTA Agarose has an extremely high affinity for 6xHis residues. The binding affinity is approximately Kd=10 13, which is higher than most antibody/antigen or enzyme/substrate interactions. 30 The 6xHis- Ni 2+ NTA interaction can tolerate stringent washing conditions needed to remove nonspecifically bound host proteins. Since the 6xHis tag is very small in size and uncharged under physiological ph conditions, it is not immunogenic and does not alter the folding, compartmentalization or biochemical properties of the recombinant protein. Therefore it is usually not necessary to remove the 6xHis tag. However, the 6xHis tag can be proteolytically cleaved from the recombinant protein at the thrombin site located between the affinity tag and the MCS (Chapter 5.4). 6xHis fusion proteins may be purified using either the batch or column procedures detailed below. Batch binding for an extended time may be preferable when purifying dilute proteins. We recommend including insect cell lysate or supernatant from an infection using pachlt-xyle recombinant virus as a positive control in the affinity purification procedure. 39
48 A B Affinity Matrix or 6xHIS GST or 6xHis Your Tag Protein GST Insect Protein Thrombin Your Protein GST or 6xHis Tag Your Protein GST or 6xHis Tag C D kd Sf9+GST-XylE GST-XylE Sf9+6xHis-XylE 6xHis-XylE kd Sf9+GST-XylE GST-XylE XylE + GST XylE GST Figure 13. Expression, purification and cleavage of fusion proteins. A) Single-step protein purification methodology. Recombinant GST or 6xHis fusion protein is expressed in Sf cells, and total cell lysate is mixed with the appropriate affinity matrix. After centrifugation, the supernatant containing all untagged proteins is discarded, and the GST- or 6xHis-tagged proteins are eluted from the affinity matrix. B) The fusion tags can be proteolytically cleaved from the recombinant protein at the thrombin cleavage site downstream of both the GST and 6xHis sequences. C) Purification of Baculovirus-expressed GST-XylE and 6xHis-XylE from Sf9 cells. SDS-PAGE analysis of total cell protein containing GST-XylE (lane 1), purified GST-XylE (lane 2), total cell protein containing 6xHis-XylE (lane 3) and purified 6xHis-XylE (lane 4). D) SDS-PAGE analysis of Baculovirusexpressed GST-XylE before and after thrombin cleavage. Total Sf9 cell protein containing GST-XylE (lane 1) was purified (lane 2), and then incubated with thrombin, yielding GST and XylE (lane 3). GST was removed with glutathione agarose beads, resulting in purified XylE (lane 4). Residual GST was eluted from the glutathione agarose beads (lane 5). GST-XylE (black arrow). XylE (gray arrow). GST (white arrow). XylE is a Pseudomonas putrida gene. GST-XylE was purified using glutathione agarose beads. 6xHis-XylE was purified using Ni-NTA agarose beads. Gels were stained with Coomassie blue. 40
49 Materials Needed Please see Appendix B for kit components and product descriptions. Batch Purification 1. Bead preparation for batch purification. Gently resuspend the Ni-NTA Agarose. Transfer the Ni-NTA slurry into a sterile tube. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Carefully remove the supernatant by pouring off or aspirating. Wash the beads two times with 5 10 bead volumes of 6xHis Wash Buffer (Cat. No A) to remove the ethanol preservative. After each wash, centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Carefully remove the supernatant by pouring off or aspirating. Add enough 6xHis Wash Buffer to the beads to make a 50% slurry. 2. Add lysate to equilibrated Ni-NTA Agarose for batch purification. Mix 10 volumes of insect cell lysate containing the recombinant 6xHis fusion protein with 1 volume of the Ni-NTA Agarose. One ml of Ni NTA Agarose will bind approximately 5 10 mg of 6xHis fusion protein. Incubate the slurry for 1 h at 4 C on a rocking platform. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Draw off the supernatant. Keep the supernatant fractions to run on SDS- PAGE to determine whether the binding capacity of the Ni-NTA Agarose was exceeded and whether all of the 6xHis fusion protein bound to the matrix. 3. Wash. Note: The 10:1 volume ratio mentioned above is an approximation. Expression levels should be empirically determined by the researcher. Wash the bead slurry in 10 bead volumes of 6xHis Wash Buffer (Cat. No A). Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Discard the washes. Repeat wash steps until the wash A 280 is less than 0.01 (approximately 4 washes). Note: For stringent washes, mm imidazole should be added to the 6xHis Wash Buffer. 4. Elute the fusion protein with imidazole. Add the desired amount of imidazole to the 6xHis Elution Buffer (note below). Add 1 bead volume of the 6xHis Elution Buffer (Cat. No A) containing imidazole to the Ni-NTA Agarose from Step 3. 41
50 Gently mix the slurry. Incubate the slurry for 2 min at RT on a rocking platform. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Collect the eluted fraction. Repeat this step two more times (each time increase the amount of imidazole) or use a linear gradient. Pool the three eluted fractions. Determine the purity and amount of protein by SDS-PAGE and spectrophotometry. Note: The optimal amount of imidazole (0.1 M to 0.5 M) needed for elution will vary based upon the properties of the bound protein and should be empirically determined by the researcher. Column Purification 1. Bead preparation for column purification. Gently resuspend the Ni-NTA Agarose. Place the Ni-NTA Agarose into a suitable chromatography column. One ml of Ni-NTA Agarose will bind approximately 5-10 mg of 6xHis fusion protein. Allow the beads to settle and the column to drain. Wash the beads two times with 3-5 bead volumes of 6xHis Wash Buffer (Cat. No A) to remove the ethanol preservative. Allow the column to drain but not to dry out. Note: The 10:1 volume ratio mentioned above is an approximation. Expression levels should be empirically determined by the researcher. 2. Add lysate to equilibrated Ni-NTA Agarose for column purification. Apply the clarified lysate to the column. Adjust the column flow rate to a maximal 5 column volumes per hour. Keep the flow-through fraction to run on SDS-PAGE to determine whether the binding capacity of the Ni-NTA Agarose was exceeded. 3. Wash. Wash the column with 10 bead volumes of 6xHis Wash Buffer (Cat. No A). Allow the column to drain. Repeat wash step until the wash A 280 is less than 0.01 (approximately 4 washes). Discard the washes. Add the desired amount of imidazole to the 6xHis Elution Buffer (note below). Note: For stringent washes, mm imidazole should be added to the 6xHis Wash Buffer. 42
51 4. Elute the fusion protein with imidazole. Add 3 bead volumes of the 6xHis Elution Buffer (Cat. No A), including imidazole either as a step or a linear gradient, to the column. Adjust the column flow rate to a maximum of 1 ml/min per ml of beads. Allow the column to drain completely. Collect the eluted fractions. Note: The optimal amount of imidazole (0.1 M to 0.5 M) needed for elution will vary based upon the properties of the bound protein and should be empirically determined by the researcher. 5.2 GST Expression and Purification Kit The GST Expression and Purification Kit (Cat. No K) contains the pacghlt-a, B and C transfer vectors which encode N-terminal GST and 6xHis tags followed by an extended MCS. The MCS is in a different reading frame in each of the vectors to simplify cloning (Appendix E). A protein kinase A site follows the 6xHis tag for convenient labeling of the recombinant fusion protein. Because the GST vectors also contain a 6xHis sequence the expressed recombinant protein will be a 6xHis-containing GST fusion protein. The recombinant fusion protein can be affinity purified using either glutathione or Ni-NTA agarose beads. The GST tag can be proteolytically removed from the recombinant protein at the thrombin site located between the affinity tag and the MCS (Chapter 5.4). The GST purification method is based on the remarkable selectivity and affinity of recombinant proteins equipped with a GST affinity tag for glutathione immobilized on a resin. 31 The expressed GST fusion proteins may be purified without the use of detergents under completely non-denaturing conditions. Purifications to greater than 90% homogeneity are easily achieved in a single step by affinity chromatography using glutathione agarose beads. The affinity of GST for glutathione is so strong that it allows a highly efficient separation of GST fusion proteins from contaminating polypeptides even under non-denaturing conditions. GST fusion proteins may be purified using either batch or column procedures detailed below. Batch binding for an extended time may be preferable when purifying dilute proteins. We recommend including insect cell lysate from an infection using pacghlt-xyle recombinant virus as a positive control in the affinity purification procedure. Materials Needed Please see Appendix C for kit components and product descriptions. 43
52 Batch Purification 1. Bead preparation for batch purification. Determine the amount of glutathione agarose beads needed. One ml of glutathione beads will bind approximately 5 mg of GST fusion protein. 1 2 mg of GST fusion protein is routinely obtained per liter of insect cell culture. Gently resuspend the glutathione agarose beads (Cat. No B). Place the glutathione agarose beads as a slurry in a sterile tube. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Carefully remove the supernatant by pouring off or aspirating. Wash the beads two times with 5 10 bead volumes of PBS Wash Buffer (Cat. No A) to remove the 20% ethanol preservative. After each wash, centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Draw off the supernatant. 2. Add lysate to equilibrated glutathione beads for batch purification. 44 Add the clarified lysate to the beads. Mix 10 volumes of insect cell lysate containing the recombinant GST fusion protein of choice with 1 volume glutathione agarose beads. Incubate the slurry for 30 min at 4 C on a rocking platform. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Draw off the supernatant. Keep the supernatant fractions to run on SDS-PAGE to determine whether the binding capacity of the glutathione beads was exceeded and whether all of the GST fusion protein bound to the matrix. 3. Wash. Note: The 10:1 ratio mentioned above is an approximation. Expression levels should be empirically determined by the researcher. Wash the slurry beads twice with 5 bead volumes of PBS Wash Buffer Cat. No A). Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Discard the washes. 4. Elute the fusion protein with reduced glutathione. Add 1 bead volume of the reconstituted GST Elution Buffer (Cat. No Z and No A) to the bead matrix. (See Appendix C for reconstitution of GST Elution Buffer). Gently mix the slurry. Incubate the slurry for 2 min at RT. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. Collect the eluted fraction. Repeat the elution steps two more times. Pool the three eluted fractions.
53 Column Purification 1. Bead preparation for column purification. Determine the amount of glutathione agarose beads needed. One ml of glutathione beads will bind approximately 5 mg of GST fusion protein. 1 2 mg of GST fusion protein is routinely obtained per liter of insect cell culture. Gently resuspend the glutathione agarose beads (Cat. No B). Repeat the elution steps two more times. Place the glutathione beads as a slurry in a suitable chromatography column. Allow the beads to settle and the column to drain. Wash the beads two times with 3 5 bead volumes of PBS Wash Buffer (Cat. No A) to remove the 20% ethanol preservative. Allow the column to drain but not to dry out. 2. Add lysate to equilibrated glutathione beads for column purification. Apply the clarified lysate to the column. Adjust the column flow rate to a maximal 5 ml/min per ml of beads. Keep the flow-through fraction to run on SDS-PAGE to determine whether the binding capacity of the glutathione beads was exceeded. 3. Wash. Wash the column twice with 5 bead volumes of PBS Wash Buffer (Cat. No A). Allow the column to drain. Discard the washes. 4. Elute the fusion protein with reduced glutathione. Add 3 bead volumes of the GST Elution Buffer (Cat. No Z and No A) to the column. Adjust the column flow rate to a maximal 1 ml/min per ml of beads. Allow the column to drain completely. Collect the eluted fraction. Note: The addition of 150 mm NaCl, 5 mm CaCl 2 (or for some proteins 5 mm MgCl 2 ) or 0.1% β-mercaptoethanol to the GST Elution Buffer is optional but may be required for the solubility of some proteins. Dialyzing GST-Fusion Protein Remove the free glutathione by dialysis against 100 volumes of 50 mm Tris- HCl (ph 8.0) at 4 C. Dialyze a minimum of 4 h. Change dialysis buffer after 2 h. Alternative GST Purification Procedure In the aforementioned purification protocols, a second purification step is used to dissociate the GST from the protein of interest. 31 In an alternate approach, only one affinity step is required. Briefly, the affinity resin-bound GST fusion protein is equili- 32, 33 brated in thrombin cleavage buffer (1 wash) followed by the addition of 2 µg thrombin 45
54 per mg fusion protein. The reaction mixture is gently shaken on a rocking platform at RT for 20 min. In this reaction, the protein of interest is cleaved from the GST carrier protein and can be recovered in the supernatant after brief centrifugation. The entire procedure can be completed within a few hours and results in highly purified protein. Recovered protein should be stored at 80 C. 5.3 Checking Purity and Recovery of Recombinant Protein Add 2 volumes of 3X SDS sample buffer to 1 volume of the clarified lysates. Run the samples on a 5 15% SDS-PAGE. Stain the gel with Coomassie blue. Check for the amount of recombinant fusion protein in the sample. Note: PharMingen s monoclonal antibody to GST (clone G , Cat. No A) may be used to detect recombinant GST-fusion proteins. 5.4 Cleavage Fusion Proteins using Site-specific Proteases The His vector set (pachlt-a, -B, -C), the GST vector set (pacghlt-a, -B, -C) and several individual GST vectors (pacg2t, pacsecg2t) contain a thrombin cleavage site and pacg3x contains a factor X a cleavage site. These sites enable the proteolytic cleavage of the recombinant protein from the fusion partner. Removal of the fusion partner is optional for many applications. Thrombin Cleavage Mix 1 mg of purified GST or 6xHis fusion protein containing a thrombin cleavage site with 200 µg (10 thrombin units) of bovine thrombin (Cat. No Z and No A). Incubate at RT for up to 12 h (in many cases a min incubation will be sufficient). GST and uncleaved GST fusion protein may be removed by directly adding 2 volumes of glutathione-coupled resin (50% v/v) at the end of the cleavage reaction. Similarly, the 6xHis and uncleaved 6xHis fusion protein may be removed by directly adding Ni-NTA Agarose at the end of the cleavage reaction. The sample is then incubated for 30 min at 4 C and centrifuged for 10 min at 5,000 g. The supernatant will contain the purified protein as well as thrombin and can be stored frozen at 80 C. Some proteins may require the addition of BSA or glycerol (final concentration 50%) for stability. Note: Thrombin cleaves in 50 mm Tris-HCl buffer and does not require specific metal ions for its activity. 34 However, Guan and Dixon have recommended using a buffer containing 50 mm Tris-HCl (ph 8.0), 150 mm NaCl, 2.5 mm CaCl 2 and 0.1% β-mercaptoethanol for efficient cleavage. 32 An efficient thrombin cleavage primarily depends on the sequence of the thrombin consensus site and the three-dimensional structure surrounding that site. 46
55 Design of the Thrombin Cleavage Site The thrombin cleavage consensus site is XXP(K/R)*BB7, where X stands for hydrophobic apolar amino acids, P stands for proline, (K/R) symbolizes that either lysine or arginine works in this position, and B stands for non-acidic amino acids. The asterisk (*) represents the cleavage position which is at the carboxy-terminal side of the arginine or the lysine residue. The thrombin site used in the pacghlt and pachlt vectors is LVPR*GS. The desired gene is inserted at the BamHI site (at the amino acids GS), thrombin coding sequence. Cleavage by thrombin will then release the nearly authentic protein. Factor X a Cleavage Mix 1 mg of your purified GST fusion protein containing a factor X a cleavage site with 10 mg factor X a (factor X a is not available from PharMingen). Incubate at RT for up to 12 h. 5.5 Generating 32 P-Labeled GST or 6xHis Fusion Proteins Purified, radiolabelled 6xHis or GST fusion proteins can be generated using the pachlt (Cat. No P) and pacghlt (Cat. No P) vectors. Fusion proteins encoded by these vectors contain the peptide recognition sequence (RRASV) for the catalytic subunit of camp-dependent protein kinase from heart muscle, between the 6xHis or GST tag gene and the foreign protein. 36 The gene of interest should be cloned into either the pachlt or pacghlt vector and purified on either Ni-NTA or glutathione agarose beads, respectively, as described earlier in this chapter. In this protocol, the fusion protein is radiolabelled while it is still bound to the glutathione or Ni-NTA agarose beads. Materials Needed 1X HMK Buffer: 20 mm Tris [ph 7.5] 100 mm NaCl 12 mm MgCl 2 1X HMK STOP Buffer 10 mm sodium phosphate [ph 8.0] 10 mm sodium pyrophosphate 10 mm EDTA 1 mg/ml BSA NETN Buffer 20 mm Tris [ph 8.0] 100 mm NaCl 1 mm EDTA 0.5% NP 40 camp-dependent protein kinase 1 mm dithiothreitol (DTT) 1 µci/ml [γ -32 P] ATP 23 G needle 47
56 All steps should be carried out at 4 C. 1. Wash the agarose beads (coupled with the fusion protein of interest from the sections listed above) once with HMK buffer. 2. Centrifuge the slurry at 500 g for 3 5 min to sediment the matrix. 3. Aspirate off the supernatant with a 23 G needle. 4. Resuspend the agarose beads in 2 3 volumes of HMK buffer containing 1 U/µl concentration of the catalytic subunit of camp-dependent protein kinase, 1µCi/µl [γ- 32 P] ATP (6,000 Ci/mMol, 10 mci/ml) and 1 mm DTT. 5. Allow the kinase reaction to proceed for 30 min. 6. Terminate the reaction by adding 1 ml of HMK Stop buffer. 7. Remove the supernatant. 8. Wash the agarose beads five times with NETN. 9. After the final wash, aspirate the residual supernatant. 10. Elute the labelled fusion protein according to the elution protocol in Step 4 of Chapters 5.1 or
57 6 Generating Recombinant Baculovirus by Direct Cloning The Baculovirus genome is generally too large to easily clone foreign genes directly into the genome. A newly developed method allows for the generation of recombinant Baculovirus by direct cloning of heterologous genes into the Baculovirus genome (Fig. 14). This method may be especially useful in generating high diversity expression libraries in Baculovirus. 21 Two modified AcNPV DNAs, vehuni and vecuni, have been constructed containing either the hsp70 promoter of Drosophila melanogaster, or a hybrid minimal synthetic late/enhanced polyhedrin promoter P capminxiv, respectively, (Fig. 15). 21 Cleavage of Bsu36I sites produces linear Baculovirus DNA with overhanging TTA ends, which after incubation with dttp and the Klenow fragment of DNA polymerase I leaves TT overhanging ends. The gene to be cloned must be flanked by EcoRI sites which must be partially filled in with datp and the Klenow fragment to generate AA overhanging ends. The gene can then be cloned directly into vehuni or vecuni and transfected into insect cells to generate recombinant virus. PharMingen sells vehuni and vecuni reagent sets containing either undigested, untreated vehuni or vecuni DNA with vehuni or vecuni high titer stock, respectively (Appendix D). Materials Needed 0.5 µg vehuni (Cat. No P) or vecuni (Cat. No P) linearized, partially filled-in Baculovirus DNA 0.5 mm dttp 0.5 mm datp µg purified gene of interest, flanked by EcoRI sites Reaction buffer A, (10 mm Tris-HCl buffer, ph7.5, 10 mm MgCl 2 ) 10 U large fragment of DNA Polymerase I (Klenow) 25:24:1 phenol/chloroform/isoamyl alcohol 1X TE buffer 2 U T4 DNA ligase Prepare vehuni or vecuni Baculovirus DNA 1. Digest the vehuni or vecuni Baculovirus DNA with Bsu36I for 16 h at 37 C. 2. Incubate µg of digested vehuni or vecuni with 5 U Klenow DNA polymerase I and 0.5 mm dttp in the presence of 20 µl Reaction Buffer A for 15 min at 30 C. 3. Stop the reaction by heating to 75 C for 10 min or by adding 1 µl of 0.5 M EDTA. 4. Extract with one volume of 25:24:1 phenol/chloroform/isoamyl alcohol (1:1), ethanol precipitate and resuspend DNA in 10 µl of 1 X TE buffer. 49
58 vehuni or vecuni egt promoter Bsu36I CCTAAGG GGATTCC Bsu36I CCTTAGG GGAATCC egt Vector Digest w/bsu36i GAATTC CTTAAG EcoRI Gene GAATTC CTTAAG EcoRI vehuni or vecuni Digest w/ecori egt promoter CC GGATT TTAGG CC egt AATTC G Gene G CTTAA Incubate w/dttp + Klenow Incubate w/datp + Klenow vehuni or vecuni egt promoter CCT GGATT TTAGG TCC egt AATTC AAG Gene GAA CTTAA ligate vehuni or vecuni egt promoter CCTAATTC GGATTAAG Gene GAATTAGG CTTAATCC egt Figure 14. Strategy for directly cloning EcoRI fragments into the AcNPV genome. On the left, an AcNPV DNA has been altered to contain 2 Bsu36I sites (vehuni or vecuni). After digestion with Bsu36I, the DNA is treated with dttp and Klenow DNA polymerase I to generate a linear viral DNA with TT overhanging ends. On the right, a foreign gene (PCR or cdna synthesis product) with flanking EcoRI sites is digested with EcoRI. The resultant overhanging ends are digested with datp and Klenow DNA polymerase I to generate AA overhanging ends. The compatible viral DNA and heterologous gene DNA are then combined, ligated and transfected into insect cells. 50
59 Prepare gene fragment 1. Digest the vector containing the gene, PCR or cdna synthesis product of interest with EcoRI for 16 h at 37 C. Isolate the gene of interest containing flanking sites, EcoRI, by gel purification. 24 Note: If gene of interest doesn t contain flanking EcoRI sites, a PCR with specific EcoRI containing primers can be used to insert flanking EcoRI sites. Alternatively, EcoRI linkers can be ligated to the purified gene Incubate µg EcoRI-digested and purified gene, PCR or cdna synthesis product of interest in presence of 5 U Klenow DNA polymerase I and 0.5 mm datp in 20 µl 1X Reaction buffer A for 15 min at 30 C. 3. Stop the reaction by heating to 75 C for 10 min or by adding 1 µl of 0.5 M EDTA. 4. Extract with one volume of 25:24:1 phenol/chloroform/isoamyl alcohol (1:1), ethanol precipitate and resuspend DNA in 10 µl of 1 X TE buffer. Ligate vehuni or vecuni with treated gene fragment Mix 0.5 µg of vehuni or vecuni DNA with µg of the treated gene fragment from above (about 1:60 molar ratio of viral DNA to gene fragment) and 2 units of T4 DNA ligase overnight at 15 C. The ligated AcNPV DNA is now ready to be transfected into susceptible insect cells. A vehuni egt hsp 70 promoter egt Bsu36I Sse8387I Bsu36I Sse8387I CCTAAGGCCTGCAGGCCCGGGCCTTAGGCCTGCAGG Srfl B vecuni egt CAPminXIV egt Bsu36I Sse8387I Bsu36I Sse8387I CCTAAGGCCTGCAGGCCCGGGCCTTAGGCCTGCAGG Srfl Figure 15. Baculovirus vectors for direct cloning. A) Design of vehuni direct cloning vector: An hsp70 promoter from Drosophila melanogaster, and a multiple cloning site (MCS) containing two Bsu36I restriction sites were inserted into the nonessential Ecdysteroid UDP-glucosyltransferase (egt) gene of the wild-type AcNPV genome. Recognition sites within the MCS are bracketed. B) Design of vecuni direct cloning vector. A P capminxiv hybrid late/very late promoter and a MCS containing 2 different Bsu36I restriction sites were inserted into the nonessential egt gene of the wild-type AcNPV genome. Recognition sites within the MCS are bracketed. 51
60 52
61 7 Troubleshooting Throughout this manual, protocols and suggestions have been made to optimize the outcome during the various steps involved in using BEVS. However, as in all experimental systems, difficulties do occur. This trouble-shooting guide has been developed both from our laboratory experience with BEVS, and from questions received by our technical service department. We always welcome additional suggestions from users. 7.1 Cloning Inserts into Baculovirus Transfer Vectors In any cloning system, there may be occasional problems with inserting foreign DNA into a vector. This may be due to the reagents or to the characteristics of the DNA fragment itself which may make it difficult to insert into a particular restriction enzyme site. Refer to references 24 and 25 for comprehensive cloning manuals. Most common problems arising from inserting foreign DNA. Suboptimal purity of Baculovirus Transfer Vector stock: Purify vector DNA according to one of the methods described in Chapter 4.3. Check that DNA is readily cleavable with restriction enzymes and appears clean on an agarose gel. DNA should have a 260/280 nm ratio of High background of non-recombinant bacterial colonies after transformation of E. coli: Incomplete restriction digestion of transfer vector will mask recombinants. Use agarose gel electrophoresis to check transfer vector after restriction digestion. Be sure to use an optimized molar ratio of insert:vector. Difficulty in cloning in large inserts: Use a smaller transfer vector like pacsg2 rather than a larger vector like pvl1392/ Insect Cell Culture Healthy insect cell cultures are essential to obtaining success with BEVS. Several types of problems may be encountered with cell culture, fortunately most are easily addressed. Cells do not double every 24 h. Cells are floating or enlarged. Cells have reduced protein production. Cells are unhealthy. Cells that have been left too long between passages do not thrive well, and may be floating in the medium. Cells can still be subcultured at this stage, but may not be optimal for experimental work. To obtain healthy, log phase cells for experimental work, subculture when cells have just formed a confluent monolayer. Cells continuously passaged for more than 6 months may show reduced protein production. Retrieve low passage cells from liquid nitrogen. 53
62 Check for microbial contamination under high magnification (40X). Mycoplasma contamination can be easy to miss in the early stages. Cells will have a grainy appearance with motile organisms inside. Cells that are contaminated with wild-type virus will have polyhedra inside. The medium or temperature may not be correct. The cells are infected by Baculovirus particles. Cells are sticking to the plate and it is difficult to remove them for subculture. Cells may be seeded too thinly. Sf9 cells rely on growth factors from one another for healthy logarithmic growth and tend to adhere more tightly when dilute. Initial cell density should not be less than 30%. Allow cells to overgrow. Usually overgrown cells will be easier to remove. Pipet streams of media over cells to dislodge them. The media may contain non-heat inactivated FBS. It has been reported that non-heat inactivated FBS may increase how vigorously Sf cells stick to tissue culture plates. PharMingen s TNM-FH media (Cat. No M) contains heat inactivated FBS. Cells are growing very slowly in protein-free media. Attempt to wean only healthy, log phase cells into protein-free media. It may be easier to wean cells of lower rather than higher passage. An adjustment period ranging from a few day to several weeks should be allowed for when Sf9 cells are subjected to any variation in environmental conditions. In protein-free medium, cells may attach more firmly and doubling time may vary. 7.3 Co-transfection We strongly recommend using PharMingen s Transfection Buffer Set (Cat. No A) for co-transfections. Each batch is rigorously tested in a co-transfection using Baculo- Gold DNA and a Baculovirus Transfer Vector. There is no precipitate. 54 Check ph of Transfection Buffer B. It should be ph 7.1 ± If buffer is old or stored improperly the ph may be altered. Note: The precipitate may not be identifiable under a microscope. A successful precipitation is characterized by a milky white color which is visible to the naked eye. All the cells die within a day after transfection. Check purity of your plasmid DNA. Dirty DNA can cause cell death. See purifying vectors in Chapter 4.3. For a suspected microbial contamination, ethanol precipitate the DNA again and resuspend in freshly prepared, sterile, TE buffer. When using lipid-based transfection kits. Check that you did not use media with FBS. Use serum-free medium for lipofection. There may be lot-to-lot variations between different batches of lipofection.
63 7.4 Plaque Assay This technique often poses a challenge for new users. It is essential to use cells that are exponentially growing and at least 90% viable. Cells should adhere to tissue culture dishes within about 2 h after plating. Otherwise, discard dishes and obtain fresh cells. Use extreme caution to avoid dislodging cells when replacing media prior to inoculating cells with viral dilutions. Cells are dead. The temperature of the agarose overlay may have been too high when it was added to cells. Make sure the agarose is cooled to 45 C prior to adding to RT (22-27 C) medium. FBS may have been omitted from the overlay medium. There are cracks in the agarose overlay. Make sure that the medium containing the virus inoculum is totally removed after the 1 h incubation period. Any liquid remaining on the cells will interfere with the gelling process and produce cracks. Cells underneath the cracks will not be properly covered. No visible plaques. Check to be sure your agarose has a low sulfide concentration and is low-melting-point. Be sure you did not initially plate out too many cells which could cause the cells to overgrow the plaques. Initial density should be 70%. Has enough time passed to give the plaques time to grow? Plaques take 6 10 days to appear. Does your viral dilution have a sufficient titer? A viral dilution that is too low will not yield visible plaques. Repeat assay with lower dilutions of virus. The viral dilution may be too high, resulting in a complete cell lysis. Plaques are so small that they are barely visible. Cells seeded too densely will reach confluence too quickly and inhibit virus replication resulting in small plaques. Try reducing initial cell plating density from 70% to 50% confluent. Wait several days to see if plaques become larger. Plaques are mostly on the perimeter of the cell culture dish. Make sure that the virus inoculum is added to the center of the cell monolayer. Gently rock dishes 3 or 4 times during the 1 h viral incubation period to make sure that virus evenly covers the monolayer. There are holes in the cell monolayer that resemble plaques and it is difficult to distinguish holes from plaques. Holes result in damage to the cell monolayer. Use caution to avoid dislodging cells when removing medium from the plates, adding fresh medium to the plates, inoculating plates with virus and adding the overlay medium. 55
64 7.5 Virus Amplification No visible signs of infection. Check the initial density of cells. Cells seeded too densely will overgrow, masking the signs of the infection. Virus titer may be low. Amplify the viral stock to increase titer. 7.6 Recombinant Protein Production The most common methods for verifying protein expression include analysis of Coomassie blue-stained polyacrylamide gels, Western blot analysis, immunoprecipitation, and indirect immunofluorescence. When protein is not detected, users may need to analyze the viral DNA to check the integrity of the foreign insert, analyze RNA levels, use a more sensitive protein detection method, and/or optimize their experimental system. Low expression. 56 Analyze the recombinant Baculovirus genome by Southern hybridization or by sequencing the DNA across cloning junctions to verify that the foreign protein coding sequences have been inserted correctly. Check whether the protein coding sequence of the insert is cloned in the proper translational frame by DNA sequence analysis. Conduct a concurrent time course of mrna expression levels by Northern hybridization and of protein expression to determine the correlation between the mrna and protein expression. A point mutation in the polyhedrin promoter may reduce mrna levels. Amplify your recombinant Baculovirus infection stock to at least 10 8 pfu/ml. Optimize the infection period to maximize protein expression. Conduct a time course to determine the optimal time for harvesting your recombinant protein. Optimize the multiplicity of infection (MOI). For protein expression, the MOI should generally be between MOIs that are too high or too low may affect protein expression. Grow and infect insect cells on plates instead of spinner bottles. Seed cells at a different cell density. Try a different insect cell line for protein expression. Use a different insect cell culture medium. Maintain a constant temp of 27 C during protein expression. Multiple passages of viral stock may cause a loss of your gene of interest. Always keep a stock of low passage virus to use as an infection source. Sf9 cells in continuous culture for more than a year may lose the ability to express foreign proteins efficiently. Your protein may be mildly toxic to the insect cell. Harvest the infected cells earlier in the infection cycle.
65 Some proteins may not be stable in virus-infected cells. Compare mrna and protein levels. Membrane-bound glycoproteins and secreted proteins may be produced at lower levels than proteins that remain in the cytoplasm or are targeted to the nucleus. Check for your protein in both the cell pellet and supernatant xHis Expression and Purification System We recommend using the pachlt-xyle control vector (Cat. No P) as a positive control in this system. 6xHis protein does not bind to the Ni-NTA Agarose. Check ph of all buffers and solutions. Check that imidazole concentrations are not too high. Check that reducing agents such as DTT and DTE were not used. They reduce the Ni 2+ ions and cause them to dissociate from the Ni-NTA Agarose. Reduce or eliminate the use of chelating agents such as EDTA and EGTA. They may chelate the Ni 2+ ions and cause them to dissociate from the Ni-NTA Agarose. Check that the 6xHis tag is present and in the correct reading frame by sequencing the ligation junctions. The 6xHis tag may be hidden due to folding of the protein. 6xHis protein is insoluble or nonfunctional. Review the biological properties of your protein. Does your protein require a cell-specific or tissue-specific modification enzyme not present in insect cells? If your protein requires post-translational modifications, using a late promoter (the basic protein or 39K protein promoters) may result in better modifications and possibly active protein. Harvest infected insect cells earlier in the infection cycle. Infect insect cells with a lower MOI. Try a different insect cell line for protein expression. Co-express a dimerization partner which may keep your protein in solution. Try to solubilize your protein with detergents or by denaturing. 6xHis protein precipitates during purification. Check that the temperature is not too low. Purification may be repeated at RT. To prevent the purified protein from aggregating, solubilizing reagents such as Triton -X100 ( %), Tween -20 ( %), β-mercaptoethanol (10 mm) or NaCl (0.1 1 M) may be added to all buffers. 57
66 Inefficient or no elution of 6xHis. 58 The elution conditions may be too mild. Determine optimal elution conditions by varying ph (generally ) and imidazole concentrations ( M). Protein has precipitated on the agarose. Elute under denaturing conditions. Avoid high local concentrations of proteins by binding and eluting using a batch format. 6xHis eluate contains contaminating proteins. Reduce the amount of Ni-NTA Agarose to decrease non-specific binding of contaminating proteins. Determine optimal elution conditions by varying ph (generally ) and imidazole concentrations ( M). Increase salt (0.1 1 M NaCl) or detergent (0.1 1% Triton -X100) levels to disrupt non-specific protein interactions. Increase glycerol concentrations up to 30% in the 6xHis Elution Buffer to reduce hydrophobic interactions. Add 1 10 mm β-mercaptoethanol to the lysis buffer. This will reduce disulfide bonds which may link contaminating host proteins to the 6xHis fusion protein. 6xHis protein elutes in the wash buffer. The wash stringency may be too high. Increase the ph or lower the concentration of imidazole. Check ph of all buffers and solutions. Check that reducing agents such as DTT and DTE were not used. They may reduce the Ni 2+ ions and cause them to dissociate from the Ni-NTA Agarose. Reduce or eliminate the use of chelating agents such as EDTA and EGTA. They may chelate the Ni 2+ ions and cause them to dissociate from the Ni-NTA Agarose. The 6xHis tag may be partially hidden due to protein folding. Reduce the washing stringency. Purify under denaturing condition. 7.8 GST Expression and Purification System We recommend using the pacghlt-xyle control vector (Cat. No P) as a positive control in this system. GST Fusion Protein expression is low or absent. Refer to Troubleshooting Section 7.6. GST Fusion Protein is insoluble 36 or non-functional. Harvest infected insect cells earlier in the infection cycle. Infect insect cells with a lower MOI. Try a different insect cell line for protein expression. Review the biochemical properties of your protein. Co-express a dimerization partner which may keep your protein in solution.
67 GST Fusion Protein does not bind to glutathione agarose beads. Check binding of the unfused GST protein and the GST-XylE protein. In case of weak binding due to altered conformation of the GST fusion protein, lower binding temperature to 4 C and limit the number of washes. Inefficient elution of GST Fusion Protein. Make fresh elution buffer from dry reduced glutathione. Increase incubation time of beads in elution buffer. Increase volume of elution. Increase glutathione concentration in elution buffer. Add increasing amounts of NaCl to elution buffer ( mm). Try an overnight elution at RT or at 4 C. 7.9 Thrombin Cleavage Inefficient thrombin cleavage. Increase the amount of thrombin (up to 100 cleavage units/mg of fusion protein). We recommend 50 cleavage units/mg of fusion protein. Add heparin (1 20 mm) to your thrombin cleavage buffer. Heparin has been shown to enhance thrombin cleavage. 37 Increase the incubation temperature. If your protein is stable at 37 C and the preparation is low in proteases, try a 4-16 h incubation at 37 C. Increase the incubation time. If your protein is not degraded by extensive incubation in presence of thrombin, increase the reaction time (up to 24 h). Verify the existence of a functional thrombin site by sequencing. Ensure that your cloning strategy has not altered the consensus thrombin site. If the cloning of your desired protein destroyed the thrombin site, you will need to reclone your gene using a different cloning site or strategy. The heat shock step is critical. Heat shock at 42 C for seconds. 59
68 60
69 8 References 1. O Reilly, D., L.K. Miller and V.A. Luckow Baculovirus expression vectors: A laboratory manual. W.H. Freeman and Company, New York, NY. 2. Kidd, I.M. and V.C. Emery The use of baculoviruses as expression vectors. Applied Biochemistry and Biotechnology. 42: Matthews, R.E.F Classification and nomenclature of viruses. Fourth report of the international committee on taxonomy of viruses. Karger, Basel. 4. Burgess, S Molecular weights of lepidopteran baculovirus DNAs: Derivation by electron microscopy. J. Gen. Virol. 37: Ayres, M.D., S.C. Howard, J. Kuzio, M. Lopez-Ferber and R.D. Possee The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology. 202: Kool, M. and J.M. Vlak The structural and functional organization of the Autographa californica nuclear polyhedrosis virus genome. Arch. Virol. 130: Harrap, K.A The structure of nuclear polyhedrosis viruses. The inclusion body. Virology. 50: Rohrmann, G.F Polyhedrin structure. J. Gen. Virol. 67: Summers, M.D., and G.E. Smith Baculovirus structural polypeptides. J. Virol. 84: Smith, G.E., M.J. Fraser and M.D. Summers Molecular engineering of the Autographa californica nuclear polyhedrosis virus genome: Deletion mutations within the polyhedrin gene. J. Virol. 46: Marston F.A The purification of eukaryotic polypeptides synthesized in Escherichia coli. J. Biochem. 240: Hoss, A., I. Moarefi, K.H. Scheidtmann, L.J. Cisek, J.L. Corden, I. Dornreiter, A.K. Arthur and E. Fanning Altered phosphorylation pattern of simian virus 40 T antigen expressed in insect cells by using a baculovirus vector. J. Virol. 64: Kloc, M,. B. Reddy, S. Crawford and L.D. Etkin, A novel 110-kDa maternal CAAX box-containing protein from Xenopus is palmitoylated and isoprenylated when expressed in baculovirus. J. Biol. Chem. 266: Kuroda, K., M. Veit and H.D. Klenk, Retarded processing of influenza virus hemagglutinin in insect cells. Virology. 180: Baixeras, E., S. Roman-Roman, S. Jitsukawa, C. Genevee, S. Mechiche, E. Viegas-Pequignot, T. Hercend and F. Triebel Cloning and expression of a lymphocyte activation gene (Lag-1). Mol. Immunol. 27: Brandt-Carlson, C. and J.S. Butel Detection and characterization of a glycoprotein encoded by the mouse mammary tumor virus long terminal repeat gene. J. Virol. 65: Caroni, P., A. Rothenfluh, E. McGlynn and C. Schneider S-cyclophilin. J. Biol. Chem. 266: Christensen, J., T. Storgaard, B. Bloch, S. Alexandersen and B. Aasted Expression of Aleutian mink disease parvovirus proteins in a baculovirus vector system. J. Virol. 67: Mattion, N.M., D.B. Mitchell, G.W. Both and M.K. Estes Expression of rotavirus frames of genome segment 11. Virology. 181:
70 20. Hsu, C.Y., D.R. Hurwitz, M. Mervic and A. Zilberstein Autophosphorylation of the intracellular domain of the epidermal growth factor receptor results in different effects on its tyrosine kinase activity with various peptide substrates. J. Biol. Chem. 266: Lu, A. and L.K. Miller Generation of recombinant baculoviruses by direct cloning. Biotechniques. 21: Serrano, M.,G.J. Hannon and D. Beach A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature. 366: Frankel, A., H. Roberts, L. Afrin, J. Vesely and M. Willingham Expression of ricin B chain in Spodoptera frugiperda. Biochem. J. 303: Ausubel, F.M., R. Brent, R. E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl, eds Current protocols in molecular biology. (2 vols: 1. Molecular biologytechnique, 2. Molecular biology-laboratory manuals). Current Protocols. Greene Publishing Associates, Inc. and John Wiley and Sons, Inc. USA. 25. Sambrook, J., E.F. Fritsch and T. Maniatis Molecular cloning: A laboratory manual second edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 26. Kitamura, T., T. Tange, T. Terasawa, S. Chiba, T. Kuwaki, K. Miyagawa, Y. Piao, K. Miyazono, A. Urabe and F. Takaku Establishment and characterization of a unique human cell line that proliferates dependently on GM-CSF, IL-3, or Erythropoietin. J. Cell Physiol. 140: Gillis, S., M.M. Ferm, W. Ou and KA. Smith T cell growth factor: Parameters of production and a quantitative microassay for activity. J. Immunol. 120: Grabstein, K., J. Eisenman, D. Mochizuki, K. Shanebeck, P. Conlon, T. Hopp, C. March and S. Gillis Purification to homogeneity of B cell stimulating factor. J. Exp. Med. 163: Janknecht, R., G. de Martynoff, J. Lou, R. Hipskind, A. Nordheim and H.G. Stunnenberg Rapid and efficient purification of native histidine-tagged protein expressed by recombinant vaccinia virus. Proc. Natl. Acad. Sci. USA. 88: Crowe, J. and K. Henco The QIAexpressionist, QIAexpress: The high level expression & protein purification system. QIAGEN GmbH, QIAGEN Inc. 31. Smith, D.B. and K.S. Johnson Single-step purification of polypeptides expressed in Escherichia coli. as fusions with glutathione S-transferase. Gene. 67: Guan, K. and J.E. Dixon Eukaryotic proteins expressed in Escherichia coli: An improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem Gearing, D.P., N.A. Nicola, D. Metcalf, S. Foote, T.A. Willson, N.M. Gough and R.L. Williams Production of leukemia inhibitory factor in Escherichia coli by a novel procedure and its use in maintaining embryonic stem cells in culture. Bio. Technol. 7: Wu, Hai-Feng, G.C. White II, E.F. Workman, Jr., J.W. Jenzano and R.L. Lundblad Affinity chromatography of platelets on immobilized thrombin: Retention of catalytic activity by platelet-bound thrombin. Thrombosis Res. 67: Kaelin Jr, W.G., W. Krek, W.R. Sellers, J.A. DeCaprio, F. Ajchenbaum, C.S. Fuchs, T. Chittenden, Y. Li, P.J. Farnham, M.A. Blanar, D.M. Livingston and E.K. Flemington Expression cloning of a cdna encoding a retinoblastomabinding protein with E2F-like properties. Cell. 70: Frangioni, J.V. and B.G. Neel Solubilization and purification of enzymatically active glutathione S-transferase (pgex) fusion proteins. Analytical Biochem. 210: Chang, J.Y Thrombin specificity. Requirement for apolar amino acids adjacent to the thrombin cleavage site of polypeptide substrate. Eur. J. Biochem. 151: Smith, G.E., G. Ju, B.L. Ericson, J. Moschera, H-W Lahm, R. Chizzonite, and M.D. Sum- 62
71 mers Modification and secretion of human interleukin 2 produced in insect cells by a baculovirus expression vector. Proc. Natl. Acad. Sci. USA. 82: Vaughn, J.L., R.N. Goodwin, G.J. Thompkins and P. McCawley The establishment of two cell lines from the insect Spodoptera frugiperda. In Vitro. Cell Devel. Biol. 13: Davies, A.H., J.B.M. Jowett and I.M. Jones Recombinant baculovirus vectors expressing glutathione-s-transferase fusion proteins. Bio. Technol. 11: Hill-Perkins, M.S. and R.D. Possee A baculovirus expression vector derived from the basic protein promoter of Autographa californica nuclear polyhedrosis virus. J. Gen. Virol. 71: Livingstone, C. and I. Jones Baculovirus expression vectors with single strand capability. Nucl. Acids Res. 17: Whitford, M., S. Stewart, J. Kuzio and P. Faulkner Identification and sequence analysis of a gene encoding gp67, an abundant envelope glycoprotein of the baculovirus Autographa californica nuclear polyhedrosis virus. J. Virol. 63 (3): Stewart L.M.D., M. Hirst, M.L. Ferber, A.T. Merryweather, P.J. Cayley and R.D. Possee Construction of an improved baculovirus insecticide containing an insectspecific toxin gene. Nature. 352: Kain, S.R., M. Adams, A. Kondepudi, T.-T. Yang, W.W. Ward and P. Kitts Green fluorescent protein as a reporter of gene expression and protein localization. BioTechniques. 19: Chalfie, M., Y. Tu, G. Euskirchen, W.W. Ward and D.C. Prasher Green fluorescent protein as a marker for gene expression. Science. 263: Heim, R., D.C. Prasher and R.Y. Tsien Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc. Natl. Acad. Sci. USA. 91: Delagrave, S., R.E. Hawtin, C.M. Silva, M. M. Yang and D.C. Youvan Red-shifted excitation mutants of the green fluorescent protein. Bio. Technol. 13: Crossen, R.E., C. Torres, H. Liu, L.S. Stein, S. Singh and S. Gruenwald Separation of baculovirus-expressed green fluorescent protein (GFP) variants using fluorescenceactivated cell sorting. J. NIH Res., Application Note. 8: Wu, C., H. Liu, R. Crossen, S. Gruenwald and S. Singh Novel green fluorescent protein (GFP) baculovirus expression vectors. Gene 190: Belyaev, A.S. and P. Roy Development of baculovirus triple and quadruple expression vectors: Co-expression of three or four bluetongue virus proteins and the synthesis of bluetongue virus-like particles in insect cells. Nucleic Acids Res. 21:
72 64
73 Appendix A BaculoGold Starter Package and Transfection Kit Contents of the BaculoGold Starter Package (Cat. No K) Cat. No. Component Contents 21100D Linearized BaculoGold Baculovirus DNA 2.5 µg 21201P pvl1392/1393 Baculovirus Transfer Vector Set 5 µg each 21484P pvl1392-xyle Baculovirus Control Vector 5 µg 21103E AcNPV Wild-Type High Titer Stock Solution 1 ml 21227M PharMingen's TNM-FH Medium 1 liter 21300L Live Sf9 Insect Cells ( ) 1 flask 21483A Transfection Buffer A & B Set 5 ml each 21403A Agarplaque-Plus Agarose 50 g N/A Baculovirus Procedures & Methods Manual 1 manual Description: The BaculoGold Starter Package (Cat. No K) contains the critical components necessary to begin using the BEVS. The package provides sufficient materials for five co-transfections. Contents of the BaculoGold Transfection Kit (Cat. No K) Cat. No. Component Contents 21100D Linearized BaculoGold Baculovirus DNA 2.5 µg 21201P pvl1392/1393 Baculovirus Transfer Vector Set 5 µg each 21484P pvl1392-xyle Baculovirus Control Vector 5 µg 21103E AcNPV Wild-Type High Titer Stock Solution 1 ml 21483A Transfection Buffer A & B Set 5 ml each N/A Baculovirus Procedures & Methods Manual 1 manual Description: The BaculoGold Transfection Kit (Cat. No K) contains the critical basic components necessary to use the BEVS. Supplementary components may be purchased separately. The kit provides sufficient materials for five co-transfections. Description of Provided Reagents Linearized BaculoGold DNA (Cat. No D) 2.5 µg in 25 µl BaculoGold DNA is a modified linearized AcNPV Baculovirus DNA which contains a lethal deletion and does not code for viable virus. Co-transfection of BaculoGold DNA with a complementing plasmid construct, including pvl1393/1392, rescues the lethal deletion of this virus DNA and results in production of viable virus particles in transfected insect cells. When using BaculoGold DNA for co-transfection, more than 99% of all virus particles will be recombinant and will express the gene of interest. For one transfection, 5 µl (500 ng) of linearized BaculoGold DNA should be used in combination with 2-5 µg of purified recombinant Baculovirus transfer DNA (e.g., pacghlt, pachlt). Store at 4 C. 65
74 pvl1329/1393 Transfer Vector Set (Cat. No P) 5 µg in 50 µl, each vector The pvl1392 (Cat. No P) and pvl1393 (Cat. No P) Baculovirus Transfer Vectors are sold only as a set (Cat. No P). pvl1392 and pvl1393 contain an extended MCS in opposite orientation for simplified cloning. The plasmid DNA has been purified on silica and dissolved in TE buffer (10 mm Tris-HCl, ph 7.5; 1 mm EDTA). Store at 20 C. Refer to Appendix E for detailed information and restriction maps. pvl1392-xyle Baculovirus Control Vector (Cat. No P) 5 µg in 50 ml The pvl1392-xyle Control Vector is a purified Baculovirus Transfer Vector which can be used as a positive control in co-transfection with PharMingen s BaculoGold Baculovirus DNA (Cat. No D). In this vector a Pseudomonas putrida gene XylE was cloned into the pvl1392 Baculovirus Transfer Vector. Co-transfection with BaculoGold DNA will generate recombinant Baculoviruses that express the XylE protein which runs as a 35 kd protein on SDS-PAGE. Infected insect cells producing the XylE protein will turn yellow in the presence of catechol (500 µm catechol, 50 µm bisulfate). Store at 20 C. AcNPV Wild-Type High Titer Viral Stock Solution (Cat. No E) AcNPV wild-type high titer stock contains pfu/ml. It is an excellent choice for an occlusion body positive control for insect cell infection. Store at 4 C. TNM-FH Insect Medium (Cat. No M) 1 ml 1 liter TNM-FH medium is fully supplemented Grace s medium including trace metals, lactalbumin hydrolysate, yeastolate, 10% heat inactivated FBS, and gentamicin (50 µg/ml). This medium is ideally suited for growth, infection, and protein expression of invertebrate cell lines derived from the Fall armyworm, Spodoptera frugiperda (Sf). This medium may be used for suspension or monolayer cultures. Store at 4 C. Live Sf9 Insect Cells (1x10 7 ) (Cat. No L) 1 flask The Sf9 cell line was cloned by Gale E. Smith and Carol L. Cherry in from the parent line, IPLB-Sf21 AE 39, which was derived from pupal ovarian tissue of the Fall armyworm, Spodoptera frugiperda. The Sf9 cell line is highly susceptible to infection with AcNPV and other Baculoviruses, and can be used with all Baculovirus expression vectors. Sf21 (Cat. No L) cells are available upon request. Propagate immediately upon arrival. Transfection Buffer A & B Set (Cat. No A) 5 ml each Transfection Buffer A contains Grace s Medium supplemented with 10% FBS and should be at ph It should be used for co-transfections of Baculovirus DNA and Baculovirus transfer plasmids as specified in the Baculovirus Manual. Store at 4 C. Transfection Buffer B contains 25 mm Hepes, ph 7.1; 125 mm CaCl 2 ; 140 mm NaCl. It should be used for co-transfections of Baculovirus DNA and Baculovirus transfer plasmids as specified in the Baculovirus Manual. Store at 4 C. Agarplaque-Plus Agarose (Cat. No A) 50 g Agarplaque-Plus Agarose is an optimized agarose with low-melting temperature ( 65 C), low gelling temperature (29 C), no toxic metals, and low sulfate content ( 0.08%). These features enable Agarplaque-Plus Agarose to be used for maximum plaque size, safe plating, and optimal growth of plated Sf9, Sf21, or other insect cells. Agarplaque-Plus Agarose is easy to use and guaranteed to provide consistent results. This agarose is recommended for applications including plaque assay for determination of Baculovirus titers as well as viral purification by single plaque pick-up. Store at RT. 66
75 Appendix B 6xHis Kits PharMingen sells a novel Baculovirus affinity tag expression and purification kit, the 6xHis Expression and Purification Kit (Cat. No K). Contents of the 6xHis Expression and Purification Kit (Cat. No K) Cat. No. Component Contents 21100D Linearized BaculoGold DNA 2.5 µg 21467P pachlt-a, B, C Baculovirus Transfer Vector Set 20 µg each 21471P pachlt-xyle Control Vector 5 µg 21430Z Thrombin Powder 20 mg/1000u 21454A Thrombin Dilution Buffer 1 ml 21426Z Protease Inhibitor Cocktail lyophilized 21425A 1X Insect Cell Lysis Buffer 50 ml N/A Ni-NTA Agarose 10 ml 21476A 6xHis Elution Buffer 40 ml 21472A 6xHis Wash Buffer 250 ml 21473Z 3M Imidazole Solution 125 ml 21483A Transfection Buffer A & B 5 ml each N/A Baculovirus Procedures & Methods Manual 1 manual PharMingen s 6xHis Vectors Each of the pachlt vectors contain an N-terminal 6xHis tag with an extended multiple cloning region in which to insert the desired gene (Appendix E). The resultant protein will be a 6xHis-containing fusion protein which can be affinity purified using Ni- NTA Agarose. Ni-NTA Agarose has an extremely high affinity for 6xHis residues. The binding affinity is approximately Kd=10 13, which is higher than most antibody/antigen or enzyme/substrate interactions. 30 Approximately 1 to 2 mg of 6xHis fusion protein is routinely obtained per liter of insect cell culture. The 6xHis-Ni 2+ NTA interaction can tolerate stringent washing conditions needed to remove non-specifically bound host proteins. Since the 6xHis tag is very small in size and uncharged under physiological ph conditions, it is not immunogenic and does not alter the folding, compartmentalization or biochemical properties of the recombinant protein. Therefore it is usually not necessary to remove the 6xHis tag. However, if desired, the 6xHis tag can be removed by incubating the 6xHis fusion protein in the presence of thrombin. Description of Provided Reagents Linearized BaculoGold DNA (Cat. No D) 2.5 µg in 25 µl BaculoGold DNA is a modified linearized AcNPV Baculovirus DNA which contains a lethal deletion and does not code for viable virus. Co-transfection of BaculoGold DNA with a complementing plasmid construct (e.g., pachlt) rescues the lethal deletion of this virus DNA and results in production of viable virus particles in transfected insect cells. When using BaculoGold DNA for co-transfection, more than 99% of all virus particles will be recombinant and will express the gene of interest. For one transfection, 5 µl (500 ng) of linearized BaculoGold DNA should be used in combination with 2-5 µg of purified recombinant Baculovirus transfer DNA (e.g., pachlt). Refer to PharMingen s Baculovirus Manual for a detailed description of all the protocols necessary to use BaculoGold DNA for constructing recombinant AcNPV Baculoviruses. Store at 4 C. 67
76 pachlt-a, -B, -C Transfer Vector Set (Cat. No P) 20 µg in 20 µl; each vector Individual Cat. Nos P, 21465P and 21466P for pachlt-a, -B and -C, respectively. The pachlt vectors contain an N-terminal 6xHis tag with an extended multiple cloning region. The vector DNA has been purified on silica and dissolved in TE buffer (10 mm Tris-HCl, ph 7.5; 1 mm EDTA). The 6xHis vectors should be kept at 20 C for long-term storage. Refer to Appendix E for detailed information and restriction maps. pachlt-xyle Control Vector (Cat. No P) 5 µg in 50 µl The pachlt-xyle Control Vector is purified Baculovirus transfer DNA for control transfection experiments. In this construct a Pseudomonas putrida gene XylE was cloned in frame with the 6xHis tag cloning region. Co-transfection with BaculoGold DNA will generate recombinant Baculoviruses that express the 6xHis-XylE fusion protein which runs as a 40 kd protein on SDS-PAGE. Infected insect cells producing the 6xHis-Xyle fusion protein will turn yellow in the presence of catechol (500 µm catechol, 50 µm bisulfate). This protein can be purified using the 6xHis purification system (Cat. No K) and the authentic XylE protein can be recovered by cleaving away the 6xHis fusion tag with thrombin. Store at 20 C. Thrombin Powder (Cat. No Z) 20 mg (1,000 U) 20 mg (1,000 U) of bovine thrombin is provided as a lyophilized powder. One unit of thrombin digests 100 µg of recombinant protein containing a single thrombin site within 1 h under standard assay conditions. Before usage, dissolve the Thrombin Powder (20 mg, 1,000 U, Cat. No Z) in 1 ml of Thrombin Dilution Buffer (Cat. No A). The resulting thrombin solution is ready to use and should be stored at 20 C. Warning: Thrombin may be fatal if it enters the blood stream and is a possible sensitizer. Target organs include the vascular system. Do not use if skin is cut or scratched, wash thoroughly after handling. Thrombin Dilution Buffer (Cat. No A) The Thrombin Dilution Buffer is used to reconstitute the Thrombin Powder (Cat. No Z) above. Dissolve 20 mg Thrombin Powder (Cat. No Z) in 1 ml Thrombin Dilution Buffer (10 mm Tris- HCl, ph 8.0; 1 mm EDTA). The resulting thrombin solution is ready to use and should be stored at 20 C. Ni-NTA Agarose 1 ml 10 ml beads 10 ml of Ni-NTA Agarose beads are shipped as a 50% slurry in 10 mm NaOAc with 30% ethanol as a preservative. Ni-NTA Agarose contains the Nitrilo-tri-acetic-acid (NTA) chelating ligand charged with Ni 2+ ions bound to Sepharose CL-6B. The agarose has a high affinity to proteins which contain a 6xHis tag. The Ni 2+ ion has six coordination sites, four of which interact with NTA ligand leaving two sites free for the binding of the 6xHis tag. 29 The Ni-NTA Agarose is very stable and will retain full activity through prolonged storage. For long-term storage, the agarose can be stored at either RT or 4 C in 30% ethanol to inhibit microbial growth. The agarose resuspended in 6xHis Wash Buffer may be kept at RT for up to one week. Additional Ni-NTA Agarose can be purchased from QIAGEN and its distributors. 6xHis Elution Buffer (Cat. No A) 40 ml 6xHis Elution Buffer contains 50 mm Na-phosphate, 300 mm NaCl, 10% glycerol, ph 6.0. Imidazole (Cat. No Z) should be added to the 6xHis Elution Buffer to make either a step or linear gradient for elution. A maximum concentration of 0.5 M imidazole is recommended for the final elution using either the step or linear gradient. The optimal concentration of imidazole must be empirically determined by the researcher. Store at 4 C. 6xHis Wash Buffer (1X) (Cat. No A) 2 bottles of 125 ml each 6xHis Wash Buffer contains 50 mm Na-phosphate, 300 mm NaCl, 10% glycerol, ph 8.0. For a more stringent wash the ph may be adjusted to 6.0 and mm imidazole may be added. The optimal concentration of imidazole must be empirically determined by the researcher. Store at 4 C. 68
77 3M Imidazole Solution (Cat. No Z) 125 ml Imidazole is an organic crystalline base, C 3 H 4 N 2, that competes with histidine residues to bind to Ni-NTA Agarose. It should be added to the 6xHis Elution Buffer (Cat. No A) at concentrations between 0.1 M to 0.5 M to displace 6xHis tagged proteins. Imidazole may also be added to the 6xHis Wash Buffer (Cat. No A) at concentrations between mm to facilitate the elution of nonspecific contaminating host proteins. Store at RT. Protease Inhibitor Cocktail (Cat. No Z) lyophilized The Protease Inhibitor mix is provided as lyophilized powder. Before use, add 1 ml of pure ethanol to obtain a 50X Protease Inhibitor Cocktail. The reconstituted 50X Protease Inhibitor Cocktail will have the following ingredients: 800 µg/ml benzamidine HCl, 500 µg/ml phenanthroline, 500 µg/ml aprotinin, 500 µg/ml leupeptin, 500 µg/ml pepstatin A, 50 mm PMSF. Always store the reconstituted protease inhibitor cocktail at 20 C. Insect Cell Lysis Buffer (1X) (Cat. No A) 50 ml Insect Cell Lysis Buffer contains 10 mm Tris, ph 7.5; 130 mm NaCl; 1% Triton -X-100; 10 mm NaF; 10 mm NaPi, 10 mm NaPPi. Store at 4 C. Transfection Buffer A & B Set (Cat. No A) 5 ml each Transfection Buffer A contains Grace s Medium supplemented with 10% fetal bovine serum and should be ph It should be used for co-transfections of Baculovirus DNA and Baculovirus transfer plasmids as specified in the Baculovirus Manual. Store at 4 C. Transfection Buffer B contains 25 mm Hepes, ph 7.1, 125 mm CaCl 2, 140 mm NaCl. It should be used for co-transfections of Baculovirus DNA and Baculovirus transfer plasmids as specified in the Baculovirus Manual. Store at 4 C. 69
78 70
79 Appendix C GST Kits PharMingen sells a novel Baculovirus affinity tag GST Expression and Purification Kit (Cat. No K). Refer to Table 1 below for the kit components. Contents of the GST Expression and Purification Kit (Cat. No K). Cat. No. Component Contents 21100D Linearized BaculoGold DNA 2.5 µg 21463P pacghlt-a, B, C Baculovirus Transfer Vector Set 20 µg each 21470P pacghlt-xyle Control Vector 5 µg 21430Z Thrombin Powder 20 mg/1000u 21454A Thrombin Dilution Buffer 1 ml 21426Z Protease Inhibitor Cocktail lyophilized 21425A 1X Insect Cell Lysis Buffer 50 ml 21429Z Glutathione Powder 62 mg 21427B Glutathione Agarose Beads 10 ml 21455A GST Elution Buffer 40 ml 21428A 1X PBS Wash Buffer 375 ml 21483A Transfection Buffer A & B 5 ml each N/A Baculovirus Procedures & Methods Manual 1 manual PharMingen s GST Vectors The GST fusion vectors are designed for high-level expression of genes or gene fragments as fusion proteins with glutathione S-transferase from Schistosoma japonicum (Sj). 40 PharMingen sells a novel set of Baculovirus GST Transfer Vectors directing the expression of cloned genes as GST fusion proteins in insect cells (Appendix E). Expressed GST fusion proteins are easily purified to near homogeneity from the cell lysate by affinity chromatography using glutathione agarose. The expressed GST fusion proteins are authentically processed and may be purified without the use of detergents under completely non-denaturing conditions. This system eliminates the insolubility problem often encountered with overexpressed heterologous proteins in bacterial expression systems. Description of Provided Reagents Linearized BaculoGold DNA (Cat. No D) 2.5 µg in 25 µl BaculoGold DNA is a modified linearized AcNPV Baculovirus DNA which contains a lethal deletion and does not code for viable virus. Co-transfection of BaculoGold DNA with a complementing plasmid construct (e.g., pacghlt) rescues the lethal deletion of this virus DNA and results in production of viable virus particles in transfected insect cells. When using BaculoGold DNA for co-transfection, more than 99% of all virus particles will be recombinant and will express the gene of interest. For one transfection, 5 µl (500 ng) of linearized BaculoGold DNA should be used in combination with 2-5 µg of purified recombinant Baculovirus transfer DNA (e.g., pacghlt, pachlt). Refer to PharMingen s Baculovirus Manual for a detailed description of all the protocols necessary to use BaculoGold DNA for constructing recombinant AcNPV Baculoviruses. Store at 4 C. 71
80 pacghlt-a, -B, -C Transfer Vector Set (Cat. No P) 20 µg in 20 µl, each vector Individual Cat. No P, No P and No P for pacghlt-a, -B and -C respectively. The pacghlt vectors encode N-terminal 6xHis and GST tags followed by an extended MCS. The plasmid DNA has been purified on silica and dissolved in TE buffer (10 mm Tris-HCl, ph 7.5; 1 mm EDTA). The GST vectors should be kept at 20 C for long-term storage. Refer to Appendix E for detailed information and restriction maps. pacghlt-xyle Control Vector (Cat. No P) 5 µg in 50 µl The pacghlt-xyle Control Vector is purified Baculovirus transfer plasmid DNA for control transfection experiments. In this construct a Pseudomonas putrida gene XylE was cloned in-frame with the glutathione S-transferase coding sequence in the pacghlt vector. Co-transfection with BaculoGold DNA will generate recombinant Baculoviruses that express the GST-XylE fusion protein which runs as a 60 kd protein on SDS-PAGE. Infected insect cells producing the XylE-GST fusion protein will turn yellow in the presence of catechol (500 µm catechol, 50 µm bisulfate). This protein can be purified using either the GST or 6xHis purification system (Cat. No K or No K) and the authentic XylE protein can be recovered by cleaving away the fusion tag with thrombin. Store at 20 C. Thrombin Powder (Cat. No Z) 20 mg (1,000 U) 20 mg (1,000 U) of bovine thrombin is provided as a lyophilized powder. One unit of thrombin digests 100 µg of recombinant protein containing a single thrombin site within 1 h under standard assay conditions. Before usage, dissolve the Thrombin Powder (20 mg, 1,000 U, Cat. No Z) in 1 ml of Thrombin Dilution Buffer (Cat. No A). The resulting thrombin solution is ready to use and should be stored at 20 C. Warning: Thrombin may be fatal if it enters the blood stream and is a possible sensitizer. Target organs include the vascular system. Do not use if skin is cut or scratched, wash thoroughly after handling. Thrombin Dilution Buffer (Cat. No A) The Thrombin Dilution Buffer is used to reconstitute the Thrombin Powder (Cat. No Z) above. Dissolve 20 mg thrombin powder (Cat. No Z) in 1 ml Thrombin Dilution Buffer (10 mm Tris- HCl, ph 8.0; 1 mm EDTA). The resulting thrombin solution is ready to use and should be stored at 20 C. Glutathione Agarose Beads (Cat. No B) 1 ml 10 ml beads 10 ml of Glutathione Agarose Beads are shipped in PBS with 20% ethanol as a preservative. Their binding capacity is approximately 5 mg of recombinant GST fusion protein (e.g., GST-XylE) per ml bead volume. No significant loss of binding capacity is detected when glutathione agarose beads are exposed to 100 mm acetate (ph 4.0), 0.1 N NaOH (ph 13), 70% ethanol, 6 M guanidine hydrochloride or 6 M urea. However, the agarose should never dry out, be stored frozen, be exposed to excessive heat, boiled nor autoclaved. For long-term storage, store the beads at 4 C. For shortterm storage, the beads may be stored in 1X PBS Wash Buffer at 4 C. To inhibit bacterial growth add 0.1% sodium azide. Glutathione Agarose beads are stored in 20% ethanol. Highly Flammable, Keep container tightly closed and in a well-ventilated place. Keep away from sources of ignition - No smoking. If swallowed, seek medical advice immediately and show this container or label. Glutathione Powder (Cat. No Z) 62 mg Glutathione is provided as lyophilized powder because reduced glutathione is not stable in solution. Dissolve the powder in 40 ml of GST Elution Buffer (Cat. No A) to obtain a 5 mm glutathione solution. Store dry glutathione at 4 C and dissolved glutathione at 20 C. 72
81 GST Elution Buffer (Cat. No A) 40 ml Dissolve the lyophilized Glutathione Powder (Cat. No Z) in 40 ml of the GST Elution Buffer (50 mm Tris-HCl, ph 8.0). Store the new glutathione solution at 20 C. For best results make small aliquots of the glutathione elution buffer. This will allow you to avoid multiple freeze-thaw cycles which may oxidize glutathione and inactivate the capacity of this buffer to compete with the GST fusion protein for binding to the glutathione beads. Protease Inhibitor Cocktail (Cat. No Z) lyophilized The protease inhibitor mix is provided as lyophilized powder. Before use, add 1 ml of pure ethanol to obtain a 50X Protease Inhibitor Cocktail. The reconstituted 50X Protease Inhibitor Cocktail will have the following ingredients: 800 µg/ml benzamidine HCl, 500 µg/ml phenanthroline, 500 µg/ml aprotinin, 500 µg/ml leupeptin, 500 µg/ml pepstatin A, 50 mm PMSF. Always store the reconstituted protease inhibitor cocktail at 20 C. Insect Cell Lysis Buffer (1X) (Cat. No A) 50 ml Insect Cell Lysis Buffer contains 10 mm Tris ph, 7.5; 130 mm NaCl; 1% Triton X-100; 10 mm NaF; 10 mm NaPi; 10 mm NaPPi. Store at 4 C. PBS Wash Buffer (1X) (Cat. No A) 3 bottles of 125 ml each PBS Wash Buffer contains 140 mm NaCl; 2.7 mm KCl; 10 mm Na 2 HPO 4 ; 1.8 mm KH 2 PO 4 dissolved in distilled, autoclaved water. The ph has been adjusted to 7.4 using hydrochloric acid. Store at 4 C. Transfection Buffer A & B Set (Cat. No A) 5 ml each Transfection Buffer A contains Grace s Medium supplemented with 10% FBS and should be ph It should be used for co-transfections of Baculovirus DNA and Baculovirus transfer plasmids as specified in the Baculovirus Manual. Store at 4 C. Transfection Buffer B contains 25 mm Hepes, ph 7.1, 125 mm CaCl 2, 140 mm NaCl. It should be used for co-transfections of Baculovirus DNA and Baculovirus transfer plasmids as specified in the Baculovirus Manual. Store at 4 C. 73
82 74
83 Appendix D vehuni and vecuni Baculovirus Reagent Sets Contents of the vehuni Baculovirus Reagent Set (Cat. No K) Cat. No. Component Contents 21524P vehuni Baculovirus DNA 5 µg 21525E vehuni High Titer Virus Stock 1 ml Description of Provided Reagents vehuni Baculovirus DNA (Cat. No P) 5 µg in 50 µl vehuni Baculovirus DNA is a modified AcNPV DNA in which an hsp70 promoter from Drosphila melanogaster and a multiple cloning site (MCS) containing two Bsu36I restriction sites were inserted into the nonessential Ecdysteroid UDP-glucosyltransferase (egt) gene of the wild type AcNPV genome. vehuni Baculovirus DNA is provided undigested and untreated. Store at 20 C. vehuni High Titer Virus Stock (Cat. No E) vehuni High Titer Viral Stock contains pfu/ml. vehuni virus is provided to allow for production of vehuni DNA. For isolating AcNPV particles and DNA see Section 4.4. Store at 4 C. 1 ml Contents of the vecuni Baculovirus Reagent Set (Cat. No K) Cat. No. Component Contents 21527P vecuni Baculovirus DNA 5 µg 21528E vecuni High Titer Virus Stock 1 ml Description of Provided Reagents vecuni Baculovirus DNA (Cat. No P) 5 µg in 50 µl vecuni Baculovirus DNA is a modified AcNPV DNA in which a P capminxiv hybrid late/very late polyhedrin promoter and a multiple cloning site (MCS) containing two Bsu36I restriction sites were inserted into the nonessential Ecdysteroid UDP-glucosyltransferase (egt) gene of the wild type AcNPV genome. vecuni Baculovirus DNA is provided undigested and untreated. Store at 20 C. vecuni High Titer Virus Stock (Cat. No E) vecuni High Titer Viral Stock contains pfu/ml. vecuni virus is provided to allow for production of vecuni DNA. For isolating AcNPV particles and DNA see Section 4.4. Store at 4 C. 1 ml 75
84 76
85 Appendix E Baculovirus Transfer Vectors PharMingen sells a diverse line of BV vectors ranging from polyhedrin-derived single promoter to p10 derived multiple promoter vectors. Table 3, Chapter 4 provides an overview to help in your vector selection. Contact PharMingen Technical Service at 800-TALK-TEC for vector sequences that are available free of charge on disk (Macintosh or IBM compatible) or by . I. Polyhedrin Locus-based Transfer Vectors A. Single Promoter Transfer Vectors pvl1392, pvl1393 Baculovirus Transfer Vector Set PvuII (9547) NdeI (9424) HindIII (1) AlwNI (7772) PvuII (7183) ScaI (8732) ColE ori R Amp pvl1392/ bp unique sites underlined SacII (868) PvuII (1307) ApaI (1395) StyI (1501) XhoI (1901) SphI (2131) BclI (2232) NsiI (2669) PvuII (6752) HindIII (6217) SalI (6175) polyhedrin promoter NaeI (3770) EcoRV (3998) HindIII (5181) KpnI (4634) MCS HindIII (4253) SalI (2947) NsiI (3169) SalI (3232) MCS pvl1392 Unique sites EagI (4144) BglII (4134) NotI (4143) PstI (4138) XbaI (4159) EcoRI (4155) BamHI (4174) SmaI (4170) AGATCTGCAGCGGCCGCTCCAGAATTCTAGAAGGTACCCGGGATCC TCTAGACGTCGCCGGCGAGGTCTTAAGATCTTCCATGGGCCCTAGG polyhedrin promoter MCS pvl1393 Unique sites BamHI (4129) SmaI (4133) EcoRI (4148) XbaI (4144) NotI (4158) EagI (4159) BglII (4169) PstI (4165) CGGATCCCGGGTACCTTCTAGAATTCCGGAGCGGCCGCTGCAGATCT GCCTAGGGCCCATGGAAGATCTTAAGGCCTCGCCGGCGACGTCTAGA polyhedrin promoter Catalog No P Set Individual: 21485P, 21486P Description: The pvl1392 and pvl1393 Baculovirus Transfer Vectors are derivatives of the plasmid pvl941. They contain the complete polyhedrin gene locus including flanking regions of AcNPV cloned into the puc8 vector, but they lack part of the polyhedrin gene coding region. A MCS region has been inserted 37 nucleotides downstream of the ATG polyhedrin start codon, which has been changed into an ATT. pvl1392 and pvl1393 contain the MCS in opposite ori- 77
86 entation to one another. The MCS regions reads: BglII, PstI, NotI, EcoRI, XbaI, SmaI/XmaI and BamHI (from 5 to 3 for pvl1392 and from 3 to 5 for pvl1393). The insert of choice must provide its own ATG start signal at the 5 end of the gene. The distance between the cloning site and the ATG start of the gene should not be longer than 100 nucleotides, otherwise the protein expression will be poor. These vectors may be used for high level expression of non-fused foreign proteins under the strong polyhedrin promoter of AcNPV. These vectors are recommended for use in conjunction with PharMingen s BaculoGold Baculovirus DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. Note: The plasmid pvl941 (PharMingen) was a predecessor form of pvl1392 and pvl1393. Instead of the MCS of the latter two it had a single BamHI cloning site. 78
87 pacsg2 Baculovirus Transfer Vector ScaI (4849) PvuI (4738) EcoO109I (5346) NaeI (361) EcoRV (589) MCS BglI (4485) GsuI (4456) BsaI (4438) AlwNI (3889) Amp R ColE ori polyhedrin promoter pacsg bp unique sites underlined SnaBI (933) HindIII (1297) AgeI (1783) ClaI (1906) MCS pacsg2 SapI (3355) PvuII (3300) HpaI (3098) BspE1 (3042) BstBI (2947) PvuII (2869) SalI (2292) HindIII (2334) MscI (2513) Unique sites DsaI (708) XhoI (690) StyI (708) Sse8387I (727) KpnI (734) EcoRI (696) NcoI (708) NotI (720) SacI (714) PstI (728) StuI (702) BanII (714) EagI (721) SmaI (740) BglII (746) polyhedrin promoter CTCGAGGAATTCAGGCCTCC ATG GGA GCT CGC GGC CGC CTG CAG GGT ACC CCC GGG AGA TCT met gly ala arg gly arg leu asn gly thr pro gly arg ser Catalog No P Description: The pacsg2 Baculovirus Transfer Vector is a newly developed, streamlined derivative of pvl941. It contains the essential parts of the polyhedrin gene locus of the AcNPV, cloned into a derivative of the puc8 vector. To create a vector small in size, several non-essential parts of the polyhedrin locus have been deleted, including out-of-frame portions of the polyhedrin gene and portions of ORF 603. The MCS immediately follows the end of the polyhedrin promoter for improved expression levels. The MCS region of pacsg2 reads (from 5 to 3 ): XhoI, EcoRI, StuI, NcoI/StyI, SacI, NotI, EagI, PstI, KpnI, SmaI/XmaI and BglII. The pacsg2 has an ATG inside the NcoI site, thus sequences cloned downstream of the NcoI must NOT contain their own start codon or they must be in-frame with the ATG of the NcoI site. Sequences cloned upstream of the NcoI site must provide their own ATG and will be expressed as a non-fusion protein. This vector may be used to produce high level expression of foreign proteins under the strong polyhedrin promoter of AcNPV. Because of its small size, it may be used to accommodate inserts as large as 8 kb. The pacsg2 vector can be used in conjunction with PharMingen s BaculoGold Transfection Kit (Cat. No K) to achieve virtually 100% recombination efficiencies. 79
88 pacmp2, pacmp3 Baculovirus Transfer Vector Set pacmp2: NdeI (9632) pacmp3: NdeI (9637) pacmp2: ScaI (8940) pacmp3: ScaI (8945) XcmI (739) SacII (868) BanII (1395) pacmp2: AlwNI (7980) pacmp3: AlwNI (7985) pacmp2: SapI (7446) pacmp3: SapI (7451) ori pacmp bp pacmp bp SphI (2131) unique sites underlined Basic Protein Promoter NaeI (3770) pacmp3: SnaBI (5029) pacmp2: SnaBI (5024) MCS MCS pacmp2 Unique sites NotI (4351) PstI (4346) EagI (4352) EcoR1 (4363) XbaI (4367) BamHI (4382) GGATCTGCAGCGGCCGCTCCAGAATTCTAGAAGGTACCCGGGATCC CCTAGACGTCGCCGGCGAGGTCTTAAGATCTTCCATGGGCCCTAGG basic protein promoter Unique sites MCS pacmp3 BamHI (4342) XbaI (4357) EcoR1 (4361) NotI (4371) BglII (4382) PstI (4378) EagI (4352) GGATCCCGGGTACCTTCTAGAATTCCGGAGCGGCCGCTGCAGATCT CCTAGGGCCCATGGAAGATCTTAAGGCCTCGCCGGCGACGTCTAGA basic protein promoter Catalog No P Set Individual: 21210P, 21211P Description: The pacmp2/pacmp3 Baculovirus Transfer Vectors are derivatives of the aforementioned pvl1392/1393 vectors. The pacmp2/3 plasmids contain a copy of the AcNPV basic protein promoter instead of the AcNPV polyhedrin promoter. They will recombine with the polyhedrin locus of the AcNPV virus since the vectors contain residual out-of-frame polyhedrin gene coding sequences and their flanking regions. The pacmp2/pacmp3 vectors have a MCS inserted downstream of the basic protein promoter. This MCS reads BamHI, XbaI, EcoRI, NotI, EagI, PstI and BglII (from 5 to 3 for pacmp3 and from 3 to 5 for pacmp2). These vectors permit foreign gene expression in the late phase of virus infection, i.e., prior to the very late phase when polyhedrin and p10 promoter-driven genes are expressed. While expression levels may be somewhat reduced in comparison to polyhedrin and p10 promoterdriven expression, post-translational modifications (e.g., glycosylation and phosphorylation) are more readily accomplished. 41 These vectors are recommended for use in conjunction with PharMingen s BaculoGold Baculovirus DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. Note: The plasmid pacmp1 (PharMingen) was a predecessor form of pacmp2 and pacmp3. Instead of the MCS of the latter two it had a single BamHI cloning site. 80
89 pacuw21 Baculovirus Transfer Vector AlwNI (8493) SphI (230) SapI (9029) GsuI (7929) ColE ori BstXI (1248) DraIII (6618) BanII (6545) NaeI (6515) EagI (5920) Amp R f1 ori pacuw bp unique sites underlined p10 promoter polyhedrin promoter polyhedrin gene KpnI (3539) MscI (5311) SnaBI (3721) HindIII (5132) AgeI (4571) HindIII (4086) NaeI (1869) XcmI (2255) EcoRI (2548) BglII (2554) PacI (2597) AflII (2790) BamHI (3079) PpuMI (3091) HindIII (3158) Catalog No P Description: The pacuw21 Baculovirus Transfer Vector is an AcNPV polyhedrin locusbased vector that contains the AcNPV p10 promoter and SV40 transcription termination signals inserted upstream of the complete AcNPV polyhedrin gene. Foreign genes may be cloned into the BglII or EcoRI site located downstream of the p10 promoter. The recombinant virus will be occlusion body-positive. This vector will be of use to those researchers interested in producing recombinant protein in insect larvae. pacuw21 contains the f1 origin of replication and can produce, by helper phage mediation, single strand DNA, useful in sequencing and mutagenesis. pacuw21 is best used in conjunction with BaculoGold DNA (Cat. No D). 81
90 Fusion Vectors pacghlt-a, -B, -C Baculovirus Transfer Vector Set AlwNI (7983) PvuII (8575) SphI (230) GsuI (7419) R Amp ColE ori pacghlt-a, -B, -C 8757 bp polyhedrin promoter unique sites underlined BstXI (1248) NaeI (1869) EcoRV (2099) EcoNI (2212) DraIII (6108) NaeI (6005) PvuII (5735) glutathione S- transferase BamHI (2862) 6xHis Tag Protein Kinase A Thrombin Cleavage MCS PvuII (5157) SnaBI (3211) HindIII (3576) HindIII (4622) AgeI (4061) Catalog No P Set Individual: 21460P, 21461P, 21462P Description: The pacghlt-a, -B and -C Baculovirus Transfer Vectors are derivatives of the pacg1 vector. They contain a 6xHis tag and a glutathione S-transferase (GST) tag upstream of the MCS. The recombinant protein will be expressed as a 6xHis-containing GST fusion protein. 6xHis fusion proteins bind with high affinity to Ni-NTA Agarose and GST fusion proteins have a high affinity for reduced glutathione. 40 Therefore, a highly efficient single step affinity purification can be done on GST-6xHis-tagged proteins using either Ni-NTA Agarose (a metal chelating agent) 30 or Glutathione Agarose Beads (Cat. No B). Purified recombinant proteins can be phosphorylated at a protein kinase A site which follows the 6xHis sequence. This phosphorylation should not alter the binding affinity of the recombinant proteins to any of its ligands. After purification, the GST and 6xHis tags can be removed by incubating the fusion protein in the presence of thrombin. All foreign inserts must be in frame with the GST open reading frame (ORF). These vectors are recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 82
91 Multiple Cloning Regions of pacghlt-a, -B and -C pacghlt-a 8757 bp 2851 BamHI (2862) CCA CCA AAA TCG GAT CCG ATG GGA CAT CAT CAT CAT CAT CAC GGA AGG AGA AGG GCC AGT GTT GCG Pro Pro Lys Ser Asp Pro Met Gly His His His His His His Gly Arg Arg Arg Ala Ser Val Ala GST protein 6xHis tag Protein kinase A site Thrombin cut NdeI (2958) StuI (2980) EcoRI (2974) GCG GGA ATT TTG GTC CCT CGT GGA AGC CCA GGA CTC GAT GGC ATA TGC TCG ATC GAG GAA TTC AGG Ala Gly Ile Leu Val Pro Arg Gly Ser Pro Gly Leu Asp Gly Ile Cys Ser Ile Glu Glu Phe Arg Thrombin cleavage site StyI (2986) Kpn I (3012) NcoI (2986) NotI (2998) Sse8387I (3005) XmaI (3018) DsaI (2986) BglII (3024) SacI (2992) PstI (3006) SmaI (3018) CCT CCA TGG GAG CTC GCG GCC GCC TGC AGG GTA CCC CCG GGA GAT CTG TAC CGA CTC TGC TGA Pro Pro Trp Glu Leu Ala Ala Ala Cys Arg Val Pro Pro Gly Asp Leu Tyr Arg Leu Cys Stop pacghlt-b 8755 bp 2851 BamHI (2862) CCA CCA AAA TCG GAT CCG ATG GGA CAT CAT CAT CAT CAT CAC GGA AGG AGA AGG GCC AGT GTT GCG Pro Pro Lys Ser Asp Pro Met Gly His His His His His His Gly Arg Arg Arg Ala Ser Val Ala 6xHis tag Protein kinase A site GST protein Thrombin cut XhoI (2966) StuI (2978) EcoRI (2972) GCG GGA ATT TTG GTC CCT CGT GGA AGC CCA GGA CTC GAT GGC ATA TAT GCT CGA GGA ATT CAG GCC Ala Gly Ile Leu Val Pro Arg Gly Ser Pro Gly Leu Asp Gly Ile Tyr Ala Arg Gly Ile Gln Ala Thrombin cleavage site StyI (2984) KpnI (3010) NcoI (2984) NotI (2996) Sse8387I (3003) BglII (3022) XmaI (3016) DsaI (2984) SacI (2990) PstI (3004) SmaI (3016) TCC ATG GGA GCT CGC GGC CGC CTG CAG GGT ACC CCC GGG AGA TCT GTA CCG ACT CTG CTG AAG... Ser Met Gly Ala Arg Gly Arg Leu Gln Gly Thr Pro Gly Arg Ser Val Pro Thr Leu Leu Lys pacghlt-c 8753 bp 2851 BamHI (2862) GST protein CCA CCA AAA TCG GAT CCG ATG GGA CAT CAT CAT CAT CAT CAC GGA AGG AGA AGG GCC AGT GTT GCG Pro Pro Lys Ser Asp Pro Met Gly His His His His His His Gly Arg Arg Arg Ala Ser Val Ala 6xHis tag Protein kinase A site Thrombin cut StyI (2982) XhoI (2964) StuI (2976) NcoI (2982) NdeI (2958) EcoRI (2970) DsaI (2982) GCG GGA ATT TTG GTC CCT CGT GGA AGC CCA GGA CTC GAT GGC ATA TGC TCG AGG AAT TCA GGC CTC Ala Gly Ile Leu Val Pro Arg Gly Ser Pro Gly Leu Asp Gly Ile Cys Ser Arg Asn Ser Gly Leu Thrombin cleavage site Sse8387I (3001) KpnI (3008) BglII (3020) NotI (2994) XmaI (3014) SacI (2988) PstI (3002) SmaI (3014) CAT GGG AGC TCG CGG CCG CCT GCA GGG TAC CCC CGG GAG ATC TGT ACC GAC TCT GCT GAA GAG... His Gly Ser Ser Arg Pro Pro Ala Gly Tyr Pro Arg Glu Ile Cys Thr Asp Ser Ala Glu Glu 83
92 pachlt-a, -B and -C Baculovirus Transfer Vector Set AlwNI (7338) PvuII (7930) SapI (7874) SphI (230) BclI (331) GsuI (6774) ScaI (6381) EcoO109I (5883) DraIII (5463) NaeI (5360) PvuII (5090) R Amp ColE ori pachlt-a, -B, -C 8112 bp unique sites underlined polyhedrin promoter BstXI (1248) NaeI (1869) EcoRV (2097) 6xHis Tag Protein Kinase A Thrombin Cleavage MCS SnaBI (2566) HindIII (2931) PvuII (4512) MscI (4156) HindIII (3977) AgeI (3416) Catalog No P Set Individual: 21464P, 21465P, 21466P Description: The pachlt-a, -B and -C Baculovirus Transfer Vectors are derivatives of the pacg1 vector. They contain a 6xHis tag upstream of the MCS and the recombinant protein will be expressed as a 6xHis-containing fusion protein. The presence of a 6xHis tag substantially eases the purification of the recombinant proteins since 6xHis fusion proteins bind with high affinity to Ni-NTA Agarose (a metal chelating agent). 30 Most host cell proteins do not bind to such a matrix. Therefore, a highly efficient single-step affinity purification can be done with 6xHis-tagged proteins. Purified recombinant proteins can be phosphorylated at a protein kinase A site which follows the 6xHis sequence. This phosphorylation should not alter the binding affinity of the recombinant protein to any of its ligands. If desired, the 6xHis tag can be removed by incubating the fusion protein in the presence of thrombin. Additional features of these vectors include their expanded MCS. All foreign inserts must be in frame with the 6xHis ORF. These vectors are recommended for use in conjunction with PharMingen s Baculo- Gold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 84
93 Multiple Cloning Regions of pachlt-a, -B and -C pachlt-a 8112 bp polyhedrin promoter 2206 ATG TCC CCT ATA GAT CCG ATG GGA CAT CAT CAT CAT CAT CAC GGA AGG AGA AGG GCC AGT GTT GCG Met Ser Pro Ile Asp Pro Met Gly His His His His His His Gly Arg Arg Arg Ala Ser Val Ala 6xHis tag Protein kinase A site Thrombin cut StyI (2341) KpnI (2367) NcoI (2341) NotI (2353) Sse8387I (2360) XmaI (2373) DsaI (2341) BglII (2379) SacI (2347) PstI (2361) SmaI (2373) Stu I (2335) EcoR I (2329) GCG GGA ATT TTG GTC CCT CGT GGA AGC CCA GGA CTC GAT GGC ATA TGC TCG ATC GAG GAA TTC AGG Ala Gly Ile Leu Val Pro Arg Gly Ser Pro Gly Leu Asp Gly Ile Cys Ser Ile Glu Glu Phe Arg Thrombin cleavage site Nde I (2313) CCT CCA TGG GAG CTC GCG GCC GCC TGC AGG GTA CCC CCG GGA GAT CTG TAC CGA CTC TGC TGA Pro Pro Trp Glu Leu Ala Ala Ala Cys Arg Val Pro Pro Gly Asp Leu Tyr Arg Leu Cys Stop pachlt-b 8110 bp 2206 ATG TCC CCT ATA GAT CCG ATG GGA CAT CAT CAT CAT CAT CAC GGA AGG AGA AGG GCC AGT GTT GCG Met Ser Pro Ile Asp Pro Met Gly His His His His His His Gly Arg Arg Arg Ala Ser Val Ala polyhedrin 6xHis tag Protein kinase A site promoter Thrombin cut Xho I (2321) Stu I (2333) EcoR I (2327) GCG GGA ATT TTG GTC CCT CGT GGA AGC CCA GGA CTC GAT GGC ATA TAT GCT CGA GGA ATT CAG GCC Ala Gly Ile Leu Val Pro Arg Gly Ser Pro Gly Leu Asp Gly Ile Tyr Ala Arg Gly Ile Gln Ala Thrombin cleavage site StyI (2339) KpnI (2365) NcoI (2339) NotI (2351) Sse8387I (2358) BglII (2377) XmaI (2371) DsaI (2339) SacI (2345) PstI (2359) SmaI (2371) TCC ATG GGA GCT CGC GGC CGC CTG CAG GGT ACC CCC GGG AGA TCT GTA CCG ACT CTG CTG AAG... Ser Met Gly Ala Arg Gly Arg Leu Gln Gly Thr Pro Gly Arg Ser Val Pro Thr Leu Leu Lys pachlt-c 8108 bp polyhedrin promoter 2206 ATG TCC CCT ATA GAT CCG ATG GGA CAT CAT CAT CAT CAT CAC GGA AGG AGA AGG GCC AGT GTT GCG Met Ser Pro Ile Asp Pro Met Gly His His His His His His Gly Arg Arg Arg Ala Ser Val Ala 6xHis tag Protein kinase A site Thrombin cut StyI (2337) XhoI (2319) StuI (2331) NcoI (2337) NdeI (2313) EcoRI (2325) DsaI (2337) GCG GGA ATT TTG GTC CCT CGT GGA AGC CCA GGA CTC GAT GGC ATA TGC TCG AGG AAT TCA GGC CTC Ala Gly Ile Leu Val Pro Arg Gly Ser Pro Gly Leu Asp Gly Ile Cys Ser Arg Asn Ser Gly Leu Thrombin cleavage site KpnI (2363) Sse8387I (2356) BglII (2373) NotI (2349) XmaI (2369) SacI (2343) PstI (2357) SmaI (2369) CAT GGG AGC TCG CGG CCG CCT GCA GGG TAC CCC CGG GAG ATC TGT ACC GAC TCT GCT GAA GAG... His Gly Ser Ser Arg Pro Pro Ala Gly Tyr Pro Arg Glu Ile Cys Thr Asp Ser Ala Glu Glu 85
94 pacg1 Baculovirus Transfer Vector PvuII (8332) SphI (230) AlwNI (7740) GsuI (7176) DraIII (5865) BanII (5792) PvuII (5492) EagI (5167) Amp R ColE ori pacg bp unique sites underlined PvuII (4914) HindIII (4379) polyhedrin promoter glutathione S- transferase BstXI (1248) EcoRV (2097) EcoNI (2212) BamHI (2862) SmaI (2867) XmaI (2867) EcoRI (2872) SnaBI (2968) HindIII (3333) AgeI (3818) GST protein BamHI (2862) EcoRI (2872) SmaI (2867) CCA AAA TCG GAT CCC CGG GAA TTC ATC GTG ACT GAC TGA Pro Lys Ser Asp Pro Arg Glu Phe Ile Val Thr Asp Stop Catalog No P Description: The pacg1 Baculovirus Transfer Vector is a derivative of the paccl29 vector. 42 Foreign genes are expressed as GST fusion proteins when cloned into one of the available restriction enzyme sites (BamHI, SmaI or EcoRI). All foreign inserts must be in frame with the GST ORF. The GST fusion protein expression is under the control of the strong AcNPV polyhedrin promoter. Because GST fusion proteins have a high affinity for reduced glutathione, they can be purified in a single step using glutathione agarose beads. 40 This vector is recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 86
95 pacg2t Baculovirus Transfer Vector PvuII (8348) SphI (230) AlwNI (7756) GsuI (7192) Amp R ColE ori pacg2t 8530 bp unique sites underlined polyhedrin promoter BstXI (1248) EcoRV (2097) EcoNI (2212) DraIII (5881) BanII (5808) PvuII (5508) EagI (5183) PvuII (4930) HindIII (4395) glutathione S- transferase AgeI (3834) BamHI (2878) SmaI (2883) XmaI (2883) EcoRI (2888) SnaBI (2984) HindIII (3349) Thrombin cut BamHI (2878) EcoRI (2888) SmaI (2883) GST protein CTG GTT CCG CGT GGA TCC CCG GGA ATT CAT CGT GAC TGA Leu Val Pro Arg Gly Ser Pro Gly Ile His Arg Asp Stop Thrombin cleavage site Catalog No P Description: The pacg2t Baculovirus Transfer Vector is a derivative of the paccl29 vector. 43 Foreign genes are expressed as GST fusion proteins when cloned into one of the available restriction enzyme sites (BamHI, SmaI or EcoRI). All foreign inserts must be in frame with the GST ORF. The GST fusion protein expression is under the control of the strong AcNPV polyhedrin promoter. Because GST fusion proteins have a high affinity for reduced glutathione, they can be purified in a single step using glutathione agarose beads. 40 After purification, the GST affinity tag can be removed by incubating the fusion protein in the presence of the site-specific protease, thrombin. This vector is recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 87
96 pacg3x Baculovirus Transfer Vector PvuII (8352) SphI (230) AlwNI (7760) GsuI (7196) Amp R ColE ori pacg3x 8534 bp polyhedrin promoter unique sites underlined BstXI (1248) EcoRV (2097) EcoNI (2212) DraIII (5885) BanII (5812) PvuII (5512) EagI (5187) PvuII (4934) HindIII (4399) glutathione S- transferase AgeI (3838) Factor Xa site BamHI (2882) SmaI (2887) EcoRI (2892) SnaBI (2988) HindIII (3353) Factor Xa cleavage site BamHI (2882) EcoRI (2892) SmaI (2887) ATC GAA GGT CGT GGG ATC CCC GGG AAT TCA TCG TGA Ile Glu Gly Arg Gly Ile Pro Gly Asn Ser Ser Stop GST protein Factor Xa recognition sequence Catalog No P Description: The pacg3x Baculovirus Transfer Vector is a derivative of the paccl29 vector. 42 Foreign genes are expressed as GST fusion proteins when cloned into one of the available restriction enzyme sites (BamHI, SmaI or EcoRI). All foreign inserts must be in frame with the GST ORF. The GST fusion protein expression is under the control of the strong AcNPV polyhedrin promoter. Because GST fusion proteins have a high affinity for reduced glutathione, they can be purified in a single step using glutathione agarose beads. 40 After purification, the GST affinity tag can be removed by incubating the fusion protein in the presence of the site-specific protease, factor X a. This vector is recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 88
97 pacsecg2t Baculovirus Transfer Vector PvuII (8459) SphI (230) AlwNI (7867) GsuI (7303) DraIII (5992) BanII (5919) NaeI (5889) PvuII (5619) EagI (5294) Amp R PvuII (5041) ColE ori pacsecg2t 8641 bp polyhedrin promoter unique sites underlined gp67 leader sequence HindIII (4506) glutathione S-transferase AgeI (3945) BstXI (1248) NaeI (1869) EcoRV (2097) SpeI (2205) StyI (2223) EcoNI (2326) BamHI (2992) SmaI (2997) EcoRI (3002) HindIII (3460) 2200 ATG CTA CTA GTA AAT CAG TCA CAC CAA GGC TTC AAT AAG GAA CAC ACA AGC AAG ATG GTA AGC GCT Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr Ser Lys Met Val Ser Ala gp67 secretion signal sequence (underlined) polyhedrin Signal peptide cleavage site promoter ATT GTT TTA TAT GTG CTT TTG GCG GCG GCG GCG CAT TCT GCC TTT GCG GAT CTG ATG TCC CCT... Ile Val Leu Tyr Val Leu Leu Ala Ala Ala Ala His Ser Ala Phe Ala Asp Leu Met Ser Pro gp67 secretion signal sequence (underlined) Thrombin cut EcoRI (3002) BamHI (2992) XmaI (2997) SmaI (2997) glutathione S-transferase gene... CTG GTT CCG CGT GGA TCC CCG GGA ATT CAT CGT GAC TGA Leu Val Pro Arg Gly Ser Pro Gly Ile His Arg Asp Stop Thrombin cleavage site Catalog No P Description: The pacsecg2t Baculovirus GST-fusion expression is a derivative of the paccl29 vector. 42 Foreign genes are inserted downstream of the GST coding region into one of the available restriction enzyme sites (BamHI, SmaI or EcoRI). All foreign inserts must be in frame with the GST ORF. The GST gene is preceded by an in-frame gp67 signal sequence to allow secretion of the GST-fusion protein. The AcNPV polyhedrin-promoterdriven synthesis generates a fusion protein composed of the gp67 signal sequence, GST, and the foreign sequence. The gp67 signal sequence is cleaved from the fusion protein during its transport across the cell membrane. The GST fusion protein is purified from the infection supernatant. Because GST fusion proteins have a high affinity for reduced glutathione, they can be purified in a single step using glutathione agarose beads. 40 After purification, the GST affinity tag can be removed by incubating the fusion protein in the presence of the site-specific protease, thrombin. This vector is recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 89
98 pacgp67-a, -B and -C Baculovirus Transfer Vector Set SapI (7360) PvuII (7305) GsuI (8461) AlwNI (7894) HindIII (1) PvuII (9669) NdeI (9546) ScaI (8854) ColE ori Amp R pacgp67-a, -B, -C 9761 bp unique sites underlined PacI (579) XcmI (739) SacII (868) BstEII (923) PvuII (1307) ApaI (1395) XhoI (1901) SphI (2131) BclI (2232) PvuII (6874) polyhedrin promoter HindIII (6339) HindIII (5303) SnaBI (4938) NaeI (3770) EcoRV (3998) gp67 Secretion Signal MCS HindIII (4375) Catalog No P Set Individual: 21220P, 21221P, 21222P Description: The acidic glycoprotein gp67 (syn.: gp64) is the most abundant envelope surface glycoprotein of the AcNPV, and is essential for the entry of Baculovirus particles into susceptible insect cells. 43 Since large amounts of this protein are secreted and anchored to the virus peplomer, its gene contains one of the most effective Baculovirus-encoded signal sequences for protein secretion. 44 We have constructed Baculovirus Transfer Vectors (pacgp67-a, -B and -C) 15 that contain the gp67 signal sequence upstream of a MCS (5 -BamHI, SmaI, XbaI or NcoI, EcoRI, NotI, EagI, PstI and BglII-3 ). A gene of choice can be inserted in one of these cloning sites and the protein of interest will be expressed as a gp67 signal peptide fusion protein under the control of the strong Baculovirus polyhedrin promoter. The signal peptide mediates the forced secretion of the recombinant protein, even if it is normally not secreted. During transport across the cell membrane, the signal peptide is cleaved and the native protein is easily purified from the infection supernatant when protein-free insect culture medium (Cat. No M) is used. This vector is recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 90
99 Multiple Cloning Regions of pacgp67-a, -B and -C pacgp67-a 9761 bp 4135 SpeI (4140) polyhedrin promoter ATG CTA CTA GTA AAT CAG TCA CAC CAA GGC TTC AAT AAG GAA CAC ACA AGC AAG ATG GTA AGC GCT Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr Ser Lys Met Val Ser Ala gp67 secretion signal sequence (underlined) signal peptide cleavage site XmaI (4255) SmaI (4255) BamHI (4251) XbaI (4266) ATT GTT TTA TAT GTG CTT TTG GCG GCG GCG GCG CAT TCT GCC TTT GCG GCG GAT CCC GGG TAC CTT Ile Val Leu Tyr Val Leu Leu Ala Ala Ala Ala His Ser Ala Phe Ala Ala Asp Pro Gly Tyr Leu gp67 secretion signal sequence (underlined) PstI (4287) NotI (4280) EcoRI (4270) EagI (4281) BglII (4291) PpuMI (4308) CTA GAA TTC CGG AGC GGC CGC TGC AGA TCT GAT CCT TTC CTG GGA CCC GGC AAG AAC CAA AAA... Leu Glu Phe Arg Ser Gly Arg Cys Arg Ser Asp Pro Phe Leu Gly Pro Gly Lys Asn Gln Lys pacgp67-b 9765 bp 4135 SpeI (4140) polyhedrin promoter ATG CTA CTA GTA AAT CAG TCA CAC CAA GGC TTC AAT AAG GAA CAC ACA AGC AAG ATG GTA AGC GCT Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr Ser Lys Met Val Ser Ala gp67 secretion signal sequence (underlined) signal peptide cleavage site BamHI (4258) XmaI (4262) SmaI (4262) ATT GTT TTA TAT GTG CTT TTG GCG GCG GCG GCG CAT TCT GCC TTT GCG GCG GAT CTT GGA TCC CGG Ile Val Leu Tyr Val Leu Leu Ala Ala Ala Ala His Ser Ala Phe Ala Ala Asp Leu Gly Ser Arg gp67 secretion signal sequence (underlined) NcoI (4268) EcoRI (4274) PstI (4291) NotI (4284) EagI (4285) BglII (4295) GCC ATG GGA ATT CCG GAG CGG CCG CTG CAG ATC TGA Ala Met Gly Ile Pro Glu Arg Pro Leu Gln Ile Stop pacgp67-c 9766 bp 4135 SpeI (4140) polyhedrin promoter ATG CTA CTA GTA AAT CAG TCA CAC CAA GGC TTC AAT AAG GAA CAC ACA AGC AAG ATG GTA AGC GCT Met Leu Leu Val Asn Gln Ser His Gln Gly Phe Asn Lys Glu His Thr Ser Lys Met Val Ser Ala gp67 secretion signal sequence (underlined) signal peptide cleavage site XmaI (4263) SmaI (4263) BamHI (4259) ATT GTT TTA TAT GTG CTT TTG GCG GCG GCG GCG CAT TCT GCC TTT GCG GCG GAT CTA TGG ATC CCG Ile Val Leu Tyr Val Leu Leu Ala Ala Ala Ala His Ser Ala Phe Ala Ala Asp Leu Trp Ile Pro gp67 secretion signal sequence (underlined) NcoI (4269) NotI (4285) PstI (4292) EcoRI (4275) EagI (4286) BglII (4296) PpuMI (4313) GGC CAT GGG AAT TCC GGA GCG GCC GCT GCA GAT CTG ATC CTT TCC TGG GAC CCG GCA AGA ACC... Gly His Gly Asn Ser Gly Ala Ala Ala Ala Asp Leu Ile Leu Ser Trp Asp Pro Als Arg Thr 91
100 BioColors Baculovirus Vectors PharMingen introduces two new vector sets containing BioColors Genes, from the jellyfish Aquorea victoria. Each vector generates a fusion protein, consisting of the cloned gene product and the BioColors protein, which can be used for monitoring gene expression and protein localization, in vivo and in vitro. The Baculovirus vector sets now available with the BioColors Genes are: BioColors BV Control and BioColors -His. The BioColors Genes are: BioGreen : Green Fluorescent Protein (GFP) absorbs UV light (max 395 nm, minor peak at 470 nm) and emits green light at 509 nm. 45 Because the chromophore in GFP is intrinsic to the primary structure of the protein, the GFP system does not require exogenously added substrates. Purified GFP has spectral properties similar to the protein expressed in vivo: it absorbs blue light and emits green light which is detectable using a fluorescence microscope, fluorescence activated cell sorting (FACS), or visually, by UV light box (Fig. 18A). 51 BioBlue : Blue Fluorescent Protein (BFP) absorbs UV light (max 382 nm) and emits blue light at 448 nm that can be detected using a fluorescence microscope, FACS, or visually, by UV light box. 46, 47 Like the GFP system, the BFP system does not require exogenously added substrates (Fig. 18B). BioYellow : Yellow Protein (YP) absorbs blue light (max 495 nm) and emits a green light, at 509 nm, which can be detected visually by daylight. 46,48 Since part of the emitted green light is reabsorbed by the protein due to overlapping absorbancy and emission spectra, the net light emitted is yellow (Fig. 18C). Like the GFP system, the YP system does not require exogenously added substrates. A B C BioGreen BioBlue BioYellow Figure 16. BioColors in Sf9 cells. Sf9 cells expressing BioGreen (A), BioBlue (B) and BioYellow (C) were viewed under UV excitation filter ( nm), a dichroic mirror (430 nm), and a barrier filter (450 nm). 92
101 BioColors genes are useful tools for monitoring protein expression without the use of antibodies. PharMingen s BioColors genes differ in their excitation and/or emission spectra, suggesting that they may be useful in studying the interaction of several proteins simultaneously using FACS (Fig. 19). A C Blue Fluorescence B R2 R Green Fluorescence D Figure 17. Separation of Baculovirus-expression GFP and BFP using fluorescenceactivated cell sorting. Sf9 cells expressing a mixed population of BioBlue and BioGreen protein were viewed under UV excitation filter ( nm), a dichroic mirror (430 nm), and a barrier filter (450 nm) (A), and as a histogram showing two distinguishable cell populations (B). 49 After FACS, Sf9 cells were evaluated again by fluorescence microscopy. The R3-gated population (BioGreen ) is shown in (C), and the R2-gated population (BioBlue ) is shown in (D). 93
102 BioColors Baculovirus Control Vector Set AlwNI (8503) SapI (7969) PvuI (9352) GsuI (9070) ScaI (9463) ColE ori R Amp BioGreen Control PacI (579) XcmI (739) BioBlue Control BioYellow Control bp unique sites underlined SacII (868) BstEII (923) ApaI (1395) XhoI (1901) SphI (2131) BclI (2232) BioColors ORF SnaBI (5547) EcoRI (4877) NotI (4889) EagI (4890) PstI (4896) BglII (4900) PpuMI (4917) polyhedrin promoter NcoI (4319) XcaI (4601) NaeI (3770) EcoRV (3998) BamHI (4129) SmaI (4134) Catalog No P Description: The BioGreen, BioBlue and BioYellow Baculovirus Control Vectors are derivatives of the pvl1393 plasmid. They are intended for use as a source for the BioColors gene or as a positive color control vector. A C-terminal BioColors fusion protein can be generated if the foreign gene is cloned, in-frame, into the BamHI site. The BioColors coding region is followed by a stop codon and does not allow for the expression of foreign inserts cloned 3 of the BioColors ORF. The BioColors gene is flanked by a number of unique restriction enzyme sites, which can be used for its removal. These vectors are recommended for use in conjunction with PharMingen s BaculoGold Baculovirus DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 94
103 BioColors -His Baculovirus Transfer Vector Set SphI (230) AlwNI (8057) SapI (8593) BclI (331) GsuI (7493) ColE ori BstXI (1248) ScaI (7100) EcoO109I (6602) DraIII (6182) NaeI (6079) Amp R BioGreen His BioBlue His BioYellow His polyhedrin promoter NaeI (1869) EcoRV (2099) 8831 bp GsuI (2248) unique sites underlined MscI (2391) BioColors ORF 6xHis Tag Protein Kinase A Thrombin Cleavage MCS SnaBI (3285) HindIII (3650) MscI (4875) HindIII (4696) AgeI (4135) Catalog No P Description: The BioGreen, BioBlue and BioYellow -His Baculovirus Vectors are derivatives of the pachlt-a plasmid. 50 They contain a BioColors region with C-terminal 6xHis tag downstream of the BioColors region and upstream of the MCS. Foreign genes may be expressed as BioColors -6xHis fusion proteins when cloned into one of the available restriction enzyme sites (EcoRI, StuI, SacI, NotI, PstI, KpnI, SmaI, or BglII). The presence of the BioColors coding sequence allows the visualization of protein expression (Fig. 18). The presence of a 6xHis tag substantially eases the purification of the recombinant proteins since 6xHis fusion proteins bind with high affinity to Ni-NTA Agarose (a metal chelating agent). Most host cell proteins do not bind to such a matrix. Therefore, a highly efficient single-step affinity purification can be done with 6xHis-tagged proteins. A protein kinase A site follows the 6xHis sequence in the plasmid. Purified recombinant proteins can be phosphorylated at a protein kinase A site which follows the 6xHis sequence. This phosphorylation should not alter the binding affinity of the recombinant protein to any of its ligands. If desired, the BioColors -6xHis tag can be removed by incubating the fusion protein in the presence of thrombin. All foreign inserts must be in frame with BioColors -6xHis ORF. These vectors are recommended for use in conjunction with PharMingen s BaculoGold Baculovirus DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 95
104 B. Multiple Promoter Transfer Vectors pacuw51 Baculovirus Transfer Vector PvuII (5656) SapI (5600) NaeI (538) GsuI (4500) ScaI (4107) AlwNI (5064) ColE ori R Amp pacuw bp unique sites underlined p10 promoter F1 ori polyhedrin promoter BsmI (817) XcmI (924) PvuII (1211) EcoRI (1217) BglII (1223) NsiI (1354) XbaI (1462) BclI (1486) BamHI (1582) AatII (1929) HindIII (2015) NaeI (3351) PvuII (3151) AgeI (2500) Catalog No P Description: The pacuw51 vector contains a copy of the AcNPV p10 promoter and SV40 transcription termination signal inserted in tandem, upstream of the AcNPV polyhedrin gene promoter, but in opposite orientation. One foreign gene coding region at the BamHI site is under the control of the polyhedrin promoter and a second one at a BglII or EcoRI site is under the control of the p10 gene promoter. Recombinant viruses will express two foreign proteins. pacuw51 contains the f1 origin of replication and can produce singlestranded DNA. These vectors are recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 96
105 pacdb3 Baculovirus Transfer Vector SapI (5747) AlwNI (5211) ScaI (4254) ColE ori pacdb bp p10 promoter polyhedrin promoter unique sites underlined R Amp p10 promoter F1 ori EcoRI (1217) BglII (1223) StuI (1473) XbaI (1478) SmaI(1724) BamHI (1729) SnaBI (1797) DraIII (3601) AgeI (2647) Catalog No P Description: The pacdb3 vector is a 6 kb AcNPV polyhedrin locus-based vector that contains a copy of the AcNPV polyhedrin promoter and two AcNPV p10 promoters. Downstream of the first p10 promoter are a SmaI and a BamHI cloning site, followed by polyhedrin locus-derived terminator sequences. Upstream of this, an inverted polyhedrin promoter has been inserted containing XbaI and StuI as single cloning sites, followed by a second p10 promoter, EcoRI and BglII insertion sites and an SV40 terminator. The two p10 promoters are in opposite orientations. This vector allows simultaneous expression of three foreign genes during the very late phase of the Baculovirus infection cycle. The transfer vector contains the F1 ori for production of single-stranded DNA. These vectors are recommended for use in conjunction with PharMingen s BaculoGold DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 97
106 pacab3 Baculovirus Transfer Vector GsuI (8762) ScaI (8369) NdeI (7678) EcoRI (7455) EagI (7227) HindIII (6439) EcoRI (10096) AgeI (450) SapI (9862) SacII (867) AlwNI (9326) BstEII (922) Amp R ori pacab bp unique sites underlined Promoters: polyhedrin p10 p10 StyI (1500) XhoI (1900) SphI (2130) BclI (2231) NaeI (3769) AgeI (5878) EspI (4439) HindIII (5393) EcoRI (4448) BglII (4454) SnaBI (5028) StuI (4704) BamHI (4960) SmaI (4955) XbaI (4709) Catalog No P Description: The pacab3 is a 10.0 kb AcNPV polyhedrin locus-based vector that contains a copy of the AcNPV polyhedrin promoter and two AcNPV p10 promoters. 51 Downstream of the first p10 promoter are a SmaI and a BamHI cloning site, followed by polyhedrin locus-derived terminator sequences. Upstream of this, an inverted polyhedrin promoter has been inserted containing an XbaI and a StuI cloning site, followed by a second p10 promoter, a BglII insertion site and an SV40 terminator. The two p10 promoters are in opposite orientations. Using pacab, three foreign genes can be simultaneously expressed during the very late phase of the Baculovirus infection cycle. This vector is recommended for use in conjunction with PharMingen s BaculoGold Baculovirus DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 98
107 pacab4 Baculovirus Transfer Vector NdeI (7812) EagI (7361) GsuI (8896) ScaI (8503) EcoRI (7589) EcoRI (10230) AgeI (450) SapI (9996) SacII (867) AlwNI (9460) BstEII (922) Amp R ori pacab bp unique sites underlined StyI (1500) XhoI (1900) SphI (2130) BclI (2231) Promoters: polyhedrin HindIII (6573) p10 polyhedrin p10 NaeI (3769) AgeI (6012) HindIII (5527) SnaBI (5162) BamHI (5094) EspI (4439) EcoRI (4448) BglII (4454) SmaI (4960) StuI (4704) XbaI (4709) Catalog No P Description: pacab4 is a 10.0 kb AcNPV polyhedrin locus-based vector that contains two copies of the AcNPV polyhedrin promoter and two AcNPV p10 promoters. 56 Downstream of the first p10 promoter are a SmaI and a BamHI cloning site, followed by polyhedrin locus-derived terminator sequences. Upstream of this, an inverted polyhedrin promoter has been inserted containing an XbaI and a StuI cloning site, followed by a second p10 promoter, a BglII insertion site and an SV40 terminator. There is an additional polyhedrin promoter in opposite orientation to the first copy, and is in juxtaposition to the first p10 promoter. The second polyhedrin promoter is followed by a BamHI cloning site. The two p10 promoters are in opposite orientations. Using pacab, four foreign genes can be simultaneously expressed during the very late phase of the Baculovirus infection cycle. This vector is recommended for use in conjunction with PharMingen s BaculoGold Baculovirus DNA (Cat. No D) to achieve virtually 100% recombination efficiencies. 99
108 II. p10 Locus-based Transfer Vectors A. Single Promoter Transfer Vectors pacuw1 Baculovirus Transfer Vector AlwNI (3783) SapI (4319) BsrBI (4266) BsrBI (4507) SalI (20) MscI (130) BstXI (258) EagI (356) SacII (400) PmlI (417) PflMI (461) EspI (619) BsaB1 (699) HpaI (735) BsaI (3237) GsuI (3219) BglI (3185) ColE ori Amp R pacuw bp unique sites underlined ScaI (2826) XmnI (2705) BsrBI (2465) AatII (2386) BclI (1332) PshAI (1436) p10 HindIII (1460) promoter BspE1 (1501) BglII (1541) PacI (1585) NsiI (1675) MluI (1753) XhoI (1778) SphI (1785) XcmI (1917) BglI (2067) NarI (2082) Catalog No P Description: pacuw1 is an AcNPV p10 locus-based vector that contains a copy of the AcNPV p10 promoter, but lacks part of the amino terminal p10 gene coding region. A BglII cloning site, for foreign gene insertion, is located downstream of the p10 promoter. pacuw1 is the plasmid of choice for the construction of a recombinant Baculovirus which can be fed to T.ni larva. Alternatively, this vector can be used for independent co-expression of two proteins, one under polyhedrin expression, and one under p10 expression, coded for by separate viruses. pacuw1 is a non-polyhedrin-based vector which must be used in conjunction with linearized AcUW1.lacZ Baculovirus DNA (Cat. No D). 100
109 B. Multiple Promoter Transfer Vectors pacuw42, pacuw43 Baculovirus Transfer Vector Set ScaI (5754) GsuI (5361) AlwNI (4794) R Amp ColE ori Sap I (4260) PvuII (4205) EcoRI (4027) SalI (4008) PvuII (7045) NarI (6974) NaeI (6775) HindIII (1) EcoRI (609) SalI (33) Spe I (465) EcoRI (699) EcoRI (801) EcoRV (853) EcoRI (908) EcoRI (981) EcoRI (1088) SalI (1222) SacI (1505) p10 promoter HpaI (3293) SacII (3628) NaeI (1519) EcoRI (1595) PvuII (1612) NdeI (1624) SphI (1721) XhoI (1728) NsiI (1831) MCS BsmI (2409) BclI (2465) BamHI (2562) BclI (2696) Unique sites NotI (1972) XbaI (1988) MCS BglII (1963) KpnI (1995) PstI (1967) SmaI (1999) pacuw42 p10 promoter F1 ori pacuw42/ bp unique sites underlined polyhedrin promoter AGATCTGCAGCGGCCGCTCCAGAATTCTAGAAGGTACCCGGGATCT TCTAGACGTCGCCGGCGAGGTCTTAAGATCTTCCATGGGCCCTAGA pacuw43 Unique sites p10 promoter KpnI (1971) SmaI (1967) XbaI (1978) NotI (1992) PstI (1999) BglII (2003) AGATCCCGGGTACCTTCTAGAATTCTGAGCGGCCGCTGCAGATCT TCTAGGGCCCATGGAAGATCTTAAGACTCGCCGGCGACGTCTAGA Catalog No P Description: pacuw42, pacuw43 are AcNPV, p10 locus-based vectors that are derivatives of the pacuw41 transfer vector. Each plasmid has a copy of the polyhedrin gene promoter inserted downstream and in tandem with the p10 gene promoter. Between the two promoters, a copy of the SV40 transcription termination sequences has been inserted to prevent read-through into the polyhedrin gene promoter. A MCS has been inserted downstream of the p10 promoter. The MCS reads: BglII, PstI, NotI, XbaI, KpnI, SmaI (from 5 to 3 for pacuw42 and 3 to 5 for pacuw43). The insert of choice must provide its own ATG start signal at the 5 end of the gene. The distance between the cloning site and the ATG start of the gene should not be longer than 100 nucleotides, otherwise protein expression may be poor. These vectors contain the f1 origin of replication and can produce, by helper phage mediation, single-strand DNA, useful in sequencing and mutagenesis. This set of transfer vectors must be used in conjunction with linearized AcUW1.lacZ, Baculovirus DNA (Cat. No D). 101
110 102
111 Index A AcNPV, Autographa californica nuclear polyhedrosis virus cycle of infection of in cell culture, 1, 2 in host, 1, 2 AcUW1-lacZ DNA, 7-8, transfer-vector, Amplification of viral stocks, 24, 29 Autographa californica nuclear polyhedrosis virus, 1, 2 B β-galactosidase, viii, 7 (see also X-gal) Baculoviruses AcNPV, 1, 2 amplification of, 24, 29 basic protein, 11-12, 81 budded virus, 2 DNA genome, 1 expression vectors, 7-9, gene expression, 14, 32 host-range, 1 isolation, 31 nucleocapsid, 1, 2 production of, 22 polyhedrin, 1 promoters, 2, 11, 12 replication in vitro, 2 replication in vivo, 2 titration of, 24, 25, 26 transfer vectors, 2, 10-12, (see also Transfer vectors) virus particle, 1-2 virus structure, 2 Bacterial transformation, 17 Baculovirus expression system advantages, 3-5 Baculovirus expression vector system (BEVS), 1 Basic protein gene promoter, 9, 11, 12 transfer vector, 80 BioColors,
112 BioBlue, BioGreen, BioYellow, Budded virus, 1-2 concentration and purification of, 30 DNA from, 31 infection using, 29, 30 storage of, 30 structure of, 1 C Calcium phosphate-mediated transfection, 22 Catechol, 22-23, 68, 72 Cell culture media, 65, 66 Cell lines, (see also Spodoptera frugiperda) Cell lysis buffer, 36, 67, 69, 71, 73 Cell scrapers, 20 Cloning virus isolates by end-point dilution, 24 by plaque purification, 26 Construction of recombinant transfer vectors, 2 (see also Transfer vectors) Co-transfection of insect cells as a means of inserting foreign genes, 23 calcium phosphate coprecipitation, 23 D Direct cloning vectors, DNA extraction of, 31 linearized, 7-9 purification of, 30 quality of, 22 replication of, 29 DTE, viii, 57 DTT, viii, 57 Dual-expression vectors, 12, E Early promoters, 12 Electron microscopy, AcMNPVinfected cells, 22 End-point dilution assay, Expressing recombinant protein,
113 F Factor X a, Fall army worm cells, 66 (see also Spodoptera frugiperda) Fetal Bovine Serum (FBS), viii, Fluorescence (see BioColors ) Freezing of cells, 22 G Glutathione agarose beads, 40, 47 Glutathione S-transferase tag, 5, 39 purification, 39, (see also GST) Glycosylation in insect cells, 3 gp64 gene (see gp67) gp67, Grace s medium (see TNM-FH media) Green Fluorescent Protein (GFP), 4, 92 (see also BioColors ) GST, 5, 39, 43-47, 58-59, 71-73, 82-83, (see also glutathione S-transferase) H 6xHis, 5, 9, 38-42, 46, 57-58, 67-69, Host gene expression in infection, 1 Histidine tag (see 6xHis) I Immediate early genes (AcNPV) promoters, 12 Infection of insect cells with AcMNPV, 22, Insect cell culture cell scrapers, 20 contamination, 19 freezing in, 22 monolayer cultures, 20 scale-up, 19 seeding densities for experimental work, 18 spinner cultures, 20 subculturing monolayer cultures, suspension cultures, 21 viability, 19 Insect cell culture media, 19-21, 66 Insect cell lines, Insect cell lysis buffer, 34, 69,
114 Isolating virus particles, 30 Isolating virus DNA, 31 L lacz gene, 5-8 Late promoters, 12, Ligations, 16 Linearized DNA, 1, 8-10, 65 M Mini-prep, DNA isolation method, 17 Monolayer cell cultures, Monolayer insect cell cultures infection with AcMNPV, 22-24, plaque-assay, 22 scale-up, (see also Insect cell culture) Multiplicity of infection (MOI), 25, 32 N Ni-NTA agarose, 5, 38-41, 61-62, 72, 82, 84 P Phenol-chloroform, 15, 49 Phosphorylation, 3, 34, 39 Plasmid (see Transfer vector) Plaque assay of virus isolates, 26 Plaque-assay determination of virus stock titer, Plaque-picking, Plaque purification of virus isolates, 28 Plaque-purification, 28 Plasmid DNA isolation, 17 Polyhedrin promoter, 9, 11, 12, 35, 47 Poly(A) (polyadenylation signal), 13 Polyhedrin-based transfer vectors, 7, 8, 12, p10-based transfer vectors, 9, 12, 91, Post-translational processing, 3, 32, 34 Promoters, choice of, 11,12 early, 11,12 late, 11,12 very late, 11,12 Protein-free media, 20, 21 Protein production, harvesting of, 33, 34 N-glycosylation of, 3, 32 phosphorylation of, 3, 34 Purification of recombinant proteins, Purification of virus particles, 30 Purification of virus DNA,
115 32 P-labeled proteins, 46, 47 R Radiolabelling proteins in virus-infected cells, 45 Recombinant viruses, amplification of, 24, 29 end-point dilution cloning of, 24 identification of, 22 phenotypes of, 22 plaque purification of, 28 screening of, 22 selection of, S Scale-up of insect cell cultures, 19 Scale-up of protein production in cell culture, Seed stock of virus, 29 Selection of recombinant transfer vectors, Selection of recombinant virus, polyhedrin-negative phenotype, 22 polyhedrin-positive phenotype, 22 Serial passaging, effect on virus of, 29 Serum-free media for cell culture (see Protein-free media) Serum-supplemented media for cell cultures (see TNM-FH media) Sf cells, 17-21, 66 (see also Spodoptera frugiperda cells) Spodoptera frugiperda (Sf) cells, 66 culture of, protein production in, 32 storage of, 21 Suspension cell cultures, 21, 33 T Thawing of cells, 22 Thrombin, cleavage, 38, 42, 45, 46-47, 59 consensus site, 46 powder, 67, 68, 71, 72 TNM-FH medium, 18-21, 66 Transfection, 22, 54 Transfer vectors, basic protein promoter, 11, 12, 80 BioColors BV Control (set), BioColors His (set), maps of,
116 multiple expression, 96-99, 101 p10 locus-based, polyhedrin locus-based, polyhedrin promoter, 11, 12 pvl1392/3 (set), 65-66, pacsg2, 79 pacmp2/3 (set), 11, 80 pacuw21, 81 pacghlt-a, -B, -C (set), 75, 76, pachlt-a, -B, -C (set), 67-68, pacg1, 86 pacg2t, 87 pacg3x, 88 pacgp67-a, -B, -C (set), pacsecg2t, 89 pacuw51, 96 pacab3, 98 pacab4, 99 pacdb3, 97 p10 locus-based, pacuw1, 100 pacuw42/43 (pair), 101 Troubleshooting guide, V vecuni Baculovirus DNA, 48-50, 75 Vectors, 2, 7-9 (see also Transfer vectors) vehuni Baculovirus DNA, 48-50, 75 Very-late genes, p10, 12 polyhedrin, 12 promoters, 12 Very-late promoters, 12 Viability of cells, Virus particle, 1 Virus DNA purification, 30 Virus purification, 31 Virus stocks, 29 Virus titration, X X-gal, viii, 6, 28 XylE, 22-25, 65, 67,
117 To place an order call: For Technical Assistance call: TALK-TEC ( ) Visit PharMingen on the Internet: F Torreyana Road San Diego, CA Tel: (619) Fax: (619)
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C
HIS-Select Nickel Affinity Gel Catalog Number P6611 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select Nickel Affinity Gel is an immobilized metalion affinity chromatography (IMAC)
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.
METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System
BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput
Insect Cell Culture- General Information
Insect Cell Culture- General Information 1 The utilization of insect cell culture for heterologous protein expression has steadily increased over the last several decades. It has become a common expression
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM
pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM PrOduct information content: - 20 mg of lyophilized pmod2-puro plasmid
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
Automation in Genomics High-throughput purification of nucleic acids from biological samples. Valentina Gualdi Operational Scientist PGP
Automation in Genomics High-throughput purification of nucleic acids from biological samples Valentina Gualdi Operational Scientist PGP OVERVIEW Nucleic acid purification technologies general aspects Genomic
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a
Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
Mouse ES Cell Nucleofector Kit
page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
MEF Nucleofector Kit 1 and 2
page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated
Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
STOP. Before using this product, please read the Limited Use License statement below:
STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-rgfap The purchase of the pdrive5lucia-rgfap vector conveys
Fast, easy and effective transfection reagent for mammalian cells
METAFECTENE EASY + Fast, easy and effective transfection reagent for mammalian cells For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE
One Shot TOP10 Competent Cells
USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.
UltraClean PCR Clean-Up Kit
UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
TransIT -2020 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent
ab185915 Protein Sumoylation Assay Ultra Kit
ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
TRI Reagent Solution. A. Product Description. RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml
TRI Reagent Solution RNA / DNA / Protein Isolation Reagent Part Number AM9738 100 ml A. Product Description TRI Reagent * solution is a complete and ready-to-use reagent for the isolation of total RNA
HBV Quantitative Real Time PCR Kit
Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore
THE His Tag Antibody, mab, Mouse
THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI
Rapid GST Inclusion Body Solubilization and Renaturation Kit
Product Manual Rapid GST Inclusion Body Solubilization and Renaturation Kit Catalog Number AKR-110 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Bacteria are widely used for His
2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line
i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent
Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
AxyPrep TM Mag PCR Clean-up Protocol
AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR
NIH Mammalian Gene Collection (MGC)
USER GUIDE NIH Mammalian Gene Collection (MGC) Catalog number FL1002 Revision date 28 November 2011 Publication Part number 25-0610 MAN0000351 For Research Use Only. Not for diagnostic procedures. ii Table
HiPer Ion Exchange Chromatography Teaching Kit
HiPer Ion Exchange Chromatography Teaching Kit Product Code: HTC001 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 5-6 hours Storage Instructions: The kit is stable for
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols
Recombinant DNA Unit Exam
Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the
pcmv6-neo Vector Application Guide Contents
pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...
PowerFecal DNA Isolation Kit
PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following
MLX BCG Buccal Cell Genomic DNA Extraction Kit. Performance Characteristics
MLX BCG Buccal Cell Genomic DNA Extraction Kit Performance Characteristics Monolythix, Inc. 4720 Calle Carga Camarillo, CA 93012 Tel: (805) 484-8478 monolythix.com Page 2 of 9 MLX BCG Buccal Cell Genomic
RealLine HCV PCR Qualitative - Uni-Format
Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
INSTRUCTION Probemaker
INSTRUCTION Probemaker Instructions for Duolink In Situ Probemaker PLUS (Art. no. 92009-0020) and Duolink In Situ Probemaker MINUS (Art. no. 92010-0020) Table of content 1. Introduction 4 2. Applications
DNA ligase. ATP (or NAD+)
DNA Ligase enzyme catalysing formation of phosphodiesteric bound between group 3 -OH of one end of DNA molecule and group 5 -phosphate of the second end of DNA DNA ligase ATP (or NAD+) Ligase cofactors
LAB 11 PLASMID DNA MINIPREP
LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Protein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
Pure-IP Western Blot Detection Kit
Product Manual Pure-IP Western Blot Detection Kit Catalog Number PRB-5002 20 blots FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction The technique of immunoprecipitation (IP) is used
LAB 7 DNA RESTRICTION for CLONING
BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
Dot Blot Analysis. Teacher s Guidebook. (Cat. # BE 502) think proteins! think G-Biosciences www.gbiosciences.com
PR110 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Dot Blot Analysis Teacher s Guidebook (Cat. # BE 502) think proteins! think G-Biosciences
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...
Molecular Cloning, Product Brochure
, Product Brochure Interest in any of the products, request or order them at Bio-Connect. Bio-Connect B.V. T NL +31 (0)26 326 44 50 T BE +32 (0)2 503 03 48 Begonialaan 3a F NL +31 (0)26 326 44 51 F BE
Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610
Kevin Bogart and Justen Andrews Extraction of Total RNA from Drosophila CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Bogart K and Andrews J. 2006. Extraction of Total RNA from Drosophila. CGB
BUFFERS and MEDIAS Coomassie Blue Staining Solution Coomassie blue Destaining Solution DMEM Normal Cell Culture Media
BUFFERS and MEDIAS Coomassie Blue Staining Solution 2 g Coomassie Blue 2 L Methanol or Ethanol * 1.6 L 400 ml Glacial acetic acid *If you will be microwaving the gel in staining solution for rapid staining
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
RealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Transformation of the bacterium E. coli. using a gene for Green Fluorescent Protein
Transformation of the bacterium E. coli using a gene for Green Fluorescent Protein Background In molecular biology, transformation refers to a form of genetic exchange in which the genetic material carried
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
