BIOLOGIA (PAKISTAN) 2014, 60 (2), 169-176 PK ISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Entomological Surveillance and Detection of Dengue Viruses in Vector Mosquitoes as an Early Warning Tool for the Control of Dengue in Pakistan NUSRAT JAHAN*, ADEELA TANVEER, SARA ZAFAR, & AFIA ZAHEER Department of Zoology, GC University, Katchery Road, Lahore, Pakistan ABSTRACT Dengue viruses spread through the bites of female Aedes mosquitoes to human mostly in urban areas of tropical/sub-tropical countries. Dengue is occurring as epidemic annually in Pakistan since 2006. Recently in 2011 a severe epidemic occurred in Punjab province along with >15000 positive cases and > 400 deaths, especially in the highly populated urban city of Lahore. With neither vaccine nor proper treatment for dengue, prevention of the disease depends upon the surveillance and early diagnosis/detection of dengue virus antigens from mosquito vectors which can serve as an early warning system for forecasting impending outbreaks. In current study 28 entomological surveys were carried out in various localities of Lahore from March-September, 2011 for the collection of Aedes mosquitoes. Two species Aedes aegypti and Aedes albopictus were found common during this period. However, Aedes aegypti were present throughout these months while Aedes albopictus appeared in the months of July-August, 2011. In addition various types of natural and artificial breeding containers were also observed for immature stages of Aedes mosquitos in all localities, visited during the above mentioned period. The most productive containers were automobiles used tyres for larval production with 94% positivity. Collected mosquitoes were screened for dengue viruses using dengue specific monoclonal antibodies (MAB) as antigen capture Enzyme Linked Immunosorbant Assays (ELISAs). Of the 114 pools of Aedes aegypti females (n=570) screened, 31 pools were found positive for dengue viruses indicating 27.19% infection rate (MIR). However, of the 04 pools of Aedes albopictus females (n=40) screened; only 1 pool was found positive with 25% infection rate (MIR). This is the first report of DENV detection from adult females of Ae. aegypti and Ae. albopictus collected from different localities of Lahore. Key words: Dengue viruses; Aedes mosquitoes; Pakistan; ELISA; DENV detection INTRODUCTION Mosquitoes transmit several diseases such as filariasis caused by Wauchereria bancrofti, malaria by Plasmodium (parasites of human), dengue, encephalitis, and yellow fever by Arboviruses. In Pakistan, mosquitoes belonging to 3 genera i.e., Aedes, Culex and Anopheles are in abundance. Lahore district of Punjab has high population densities of these genera (Mukhtar et al., 2003). Mosquitoes belonging to the genus Aedes have been found all over the tropical and subtropical regions of the world (Womack, 1993) and play an important role in the transmission of a number of viral diseases in man which include the West Nile fever, Dengue fever (DF), Dengue hemorrhagic fever (DHF) and Dengue shock syndrome (DSS). Pakistan is at high risk of infectious diseases, especially, vector borne diseases such as dengue which is one of the most rapidly spreading tropical diseases in South East Asian regions. Many factors are responsible for their spread such as poor supply of drinking water, population growth, climatic changes, improper sanitation, lack of the proper vector control activities and no vaccines (Gubler, 2002). Ae. aegypti and Ae. albopictus are two important species which are involved in transmission of dengue viruses. Dengue is a reemerging infectious disease caused by four antigenically different viruses (DEN 1-4) belonging to genus Flavivirus, and family Flaviviridae, which contain the ssrna genome of about 11 kb. DF affects humans in terms of morbidity and mortality. The disease is now endemic in over 100 countries with 2.5 billion people present in areas of high risk (WHO, 2009). However, South East Asian regions are the most affected areas of the world. Dengue became an epidemic from 2006 to date annually in Pakistan. More recently in 2011, more than 15000 positive cases were reported all over Punjab province along with 417 deaths. Urban city Lahore was on high risk along with many deaths. There is neither proper treatment nor vaccine for the control of DF/DHF throughout the world. Surveillance of cases and mosquito vectors along with early detection of dengue viruses are the only option to control the disease. Detection of viruses in human sera during an outbreak or in endemic areas will not be of much helpful to prevent any future outbreaks. Therefore, *Corresponding author: dr.nusratjahan@gcu.edu.pk
170 N. JAHAN ET AL BIOLOGIA (PAKISTAN) detection of dengue virus antigen in mosquitoes has provided a reliable tool to find the types of viruses circulating in nature and also help in designing effective vector control strategies. Entomological surveillance of mosquitoes infected with dengue viruses will help to monitor the infection rates within vector population and provides an early warning system to predict future epidemics. Many authors studied recently virus infection rates in vector mosquitoes for developing early warning tool (Tewari et al., 2004; Srissuphanunt et al., 2007). Dengue virus isolation in mosquitoes have been made in wild caught mosquitoes by many authors (Das et al., 2004; Samuel & Tyagi, 2006; Linthicum et al., 2009). There are many techniques available for virus isolation such as cell cultures and suckling mice inoculation but these are laborious, slow, expensive and time consuming techniques. Mosquito inoculation techniques have been reported for detection and replication of Flaviviruses. Although this technique is sensitive for routine virological confirmation of dengue fever, however, it needs large number of infected mosquitoes, special containment facilities, particular technical skill, and time consuming. Insect bioassays such as indirect immunofluorescent assays (IIFA) and Toxo-IFA on individual and pool of mosquitoes, and polymerase chain reaction (PCR) have been used to detect the dengue viral infection in wild caught Aedes mosquitoes (Chow et al., 1998; Romero et al., 1998). All these techniques require special facilities and are not suitable for large scale detection of samples in any epidemic. RT-PCR gives rapid result but is expensive and has danger of contamination. ELISA, enzyme linked immunosorbent assays has been shown to be rapid and sensitive alternative to all of the above mentioned techniques for monitoring arboviruses in wild caught mosquitoes. Therefore, ELISA offers a good potential tool for rapid screening of large number of samples up to the serotype level. Srisuphanunt et al., (2007) detected dengue viruses using indirect ELISA in adult Aedes aegypti and Aedes albopictus. The authors suggested that this method is less laborious than mosquito inoculation and a large number of vectors could be used for screening. Although, it depends on the accumulation of detectable level of antigen in wild caught mosquitoes. ELISA method required standardization with respect to mosquito pool size and interpretation of results based on OD values in each laboratory. The current study was designed with its specific objects as follows: 1. To detect dengue virus infection in adult mosquitoes collected from DF endemic different localities of highly populated urban city Lahore, by direct antigen capture enzyme linked immunosorbent assays (ELISAs). 2. To measure accurately the minimum infection rate (MIR) of Aedes aegypti and Aedes albopictus within the localities. 3. To locate potential, DF risk areas with vector infection and their relation with clinical incidence of dengue fever like cases reported from various localities in Lahore. Study Sites MATERIALS AND METHODS Lahore is capital of the Punjab and situated along the River Ravi. Lahore has latitude & longitude; 31 33'N and 74 20'E respectively. The total area of Lahore is 1,772 km 2, and the population of Lahore is 6,318,745 with density 3,566 persons/km 2. Localities of Lahore which are dengue sensitive areas were selected on the basis of a history of high incidence of Dengue fever mosquitoes (Aedes) and human population along with building structures. The selected areas were: Jallo Park, Mughalpura, Manawan, Railway Station, Wahdat Colony, Chuburji Quarters, Lahore Zoo, Officer s Colony, Model Town and GCU. In preliminary entomological surveys, different breeding sites of mosquitoes containing eggslarvae-pupae and adults were observed. The presence of adult mosquitoes near water bodies or damp/cool and shady places were found in many of the above selected localities. The most common breeding sites containing rain or fresh water were artificial/natural containers, automobile used tyres, plant pots, desert air coolers, tree holes, open aquarium (indoor), etc. Climate The average temperature of Lahore, Punjab, Pakistan is 23.9 C (75 F) in 2011. The range of average monthly temperature was 21 C. The warmest average high temperature was 41 C (106 F) in June. The coolest average low temperature was 5 C (41 F) in January & December, 2010. Lahore, receives on average 489 mm (19.3ʺ) of precipitation annually or 41 mm (1.6") each month of year 2011. Mean relative humidity for year was recorded as 37.9% and on a monthly basis it ranges from 20% in May to 58% in August. An average range of hours of sunshine in Lahore, Punjab was between 6.8 hours per day in January and 9.9 hours per day in May. Current study was carried out from March-September, 2011. The average temperature, rain fall and humidity of these months are presented in Fig., 1.
VOL. 60 (2) DETECTION OF DENGUE VIRUSES IN VECTOR MOSQUITOES 171 Entomological Surveillance Field Collection of Larvae On each survey about 50-60% of houses in each of localities were searched both inside and outside for breeding places of Aedes mosquitoes. Different type of containers indoor/outdoor were observed and recorded in each locality. Aedes larvae were collected from each container and brought to the Vector Biology Laboratory, GC University, Lahore. Each larva identified up to species level. A proportion of larvae were frozen at -20 C while the others were reared up to adults for detecting dengue viruses. Collection of Adult Mosquitoes from the Field Mosquitoes resting or flying indoor/outdoor (rooms/front and backyards) of houses were collected during mornings (8-11 am) and evenings (4-6 pm) for 15-20 minutes using CDC back pack aspirator (John W. Hock Company, USA) at weekly intervals from March-September, 2011 from each locality per survey. Four to six researchers spent about 2-3 hours for adult collection per survey. Adult mosquitoes collected from each locality were brought to Vector Biology laboratory, GCU on ice and identified using morphological keys up to species level. Aedes adult mosquitoes male and female of different species were stored in glass vials (10ml) at -20 o C for further detection of dengue viruses, within ten days of collection using antigen capture enzyme linked immunosorbent assays. Preparation of Adult Aedes Mosquito Homogenates Collected adult Aedes mosquitoes (alive/frozen) were homogenized using a 1ml glass tissue homogenizers (Iwaki). Head and thorax of each mosquito was removed from the rest of body using sterilized forceps and surgical blades under dissecting microscope (Kruss, Germany) and homogenized mechanically. Pool size was of fiveten females/ml of 0.01M PBS ph 7.4 / APS ph 7.0 / 20% acetone extracted human serum. Homogenates were centrifuged at 6000 rpm for 5 minutes at 4 C (Beckman coulter Allegra 64 Centrifuge) and were stored at -20 C until further processing. Homogenates of laboratory reared Aedes aegypti (colony established in GCU since 2006), and Anopheles stephensi (colony established by NIMRT Lahore) fed on non-infected blood of albino mice and were prepared in the same way as mentioned above, used as negative control for ELISAs. Antigen Capture Enzyme Linked Immunosorbent Assay (ELISA) The enzyme linked immunosorbent assay (ELISA) is the most widely used serological tests for antibody or antigen detection. This test involves the linking of the antigen and antibody on a micro titer polyethylene plate in U-shaped 96-well format which is commercially (Titertek) available for performing ELISA. This facilitates use of small volumes of buffers/antibody/antigen and gives ELISA the potential of handling and operating a number of samples rapidly. Since one of the reactants in the ELISA is attached to solid phase, thus the separation of bound and free reagents is easily made by simple washing procedures. The end result of ELISA is a coloured complex that can be read using specially designed multichannel spectrophotometer or ELISA plate reader (Trinity Biotech, Ireland). ELISA Procedure Optimal dilution of dengue specific monoclonal antibody or capture antibody (MAB D3-5C9-1 broadly reactive against all four serotypes, kindly provided by Centre for Disease Control and Prevention, Fort Collins, California) was made in coating buffer (carbonate buffer, ph 9.0 in ratio 1:1000). 100 µl of optimal dilution of MAB was used to coat each well of 96-well ELISA plate and incubated at 37 C for 2 h. The plates were then stored for overnight at 4 C. Plates were flicked in the sink and washed four-five times with 0.01M PBS (ph 7.4) in 0.05% Tween (PBS-TW). To block nonspecific protein binding 100 µl/well blocking buffer (3% BSA in PBS-TW) was added and plate was kept for 2 hours at 37C. Second flicking and washing of plate for four to five times with PBS-TW was followed. Test samples and control samples (mosquito homogenates in PBS) 100µl/well were added in triplicate wells and incubated for 2 hours at 37 C or overnight at 4 C. After washing four-five times with PBS-TW 100 µl of enzyme linked detector antibody MAB 6B6C-1 broadly reactive against Flavivirus (kindly provided by the CDC, Fort Collins, California) diluted in 1:1000 in 0.01 M PBS was added and incubated the plates at 37 C for 2 hours. Following the washing step Ortho phenyl diamine (OPD) 5mg was dissolved in 10ml of 0.1 M (freshly prepared) Citrate Phosphate Buffer. 70 µl/well of ortho phenyl diamine (OPD) was added and kept it for five minutes. Then added 30 µl of 3% hydrogen per oxide (H 2 O 2 ) to each well and left for 10-15 minutes in darkness. The reaction was stopped by addition of 50 µl of 4M sulphuric acid (H 2 SO 4 ) in each well and optical density was
172 N. JAHAN ET AL BIOLOGIA (PAKISTAN) recorded using ELISA plate reader (Trinity Biotech, Ireland) at 492 nm wavelength. Data Analysis A mosquito pool was considered denguepositive if its optical density (OD) value was greater than the mean ±3-4 standard deviation (SD) of the negative control (Thenmozhi, et al., 2005; Tewari et al., 2004; Srisuphanunt et al., 2007). Negative control consisted of homogenates of triturated mosquitos of the same species Aedes/Anopheles laboratory reared (fed on non-infected blood) with the same number in each pool. RESULTS Entomological surveys were conducted in different localities of Lahore from March to September, 2011. In total 28 surveys, 9704 mosquitoes were collected, among them two genera; Aedes and Culex were found. Total 1385 (14.2%) Ae. aegypti, 557 (4.72%) Ae. albopictus, while 7855 (80.9%) genus Culex were found (Table I). Two species of Aedes (Ae. aegypti and Ae. albopictus) and Culex quinquefasciatus with respect to male and female densities from different localities of Lahore indicated that overall Culex males (4904) and females (2951) were abundant, followed by Ae. aegypti males (634) and females (751) and then Ae. albopictus males (225) and females (239) (Fig., 2). Monthly distribution pattern of these mosquitoes in the month of March to September 2011 indicated that Ae. aegypti were present throughout these months in high density (176 males and 97 females were found in the month of August 2011). However, Ae. albopictus appeared in the month of July (175 males and 218 females) which afterwards decreased in density in the month of August (50 males and 21 females) onward. Ae aegypti in the last month of collection (September 2011) was in considerable density (84 males and 77 females), indicated high prevalence of this vector (Fig., 2). Various types of natural and artificial breeding containers were observed for immature stages for Aedes mosquitoes in all localities visited during the above mentioned period. Total ten breeding sites including desert coolers, ice cream cups, plastic cups, used automobile tires, gutter holes, tin containers, tree holes, discarded shoes, flower pots, water dishes/plates (Table II) were found outdoor / indoor. The most productive containers were used automobile tires for larval production indicated 94% positivity. Inside the houses desert water coolers were found to be the major breeding site (85%) followed by discarded plastic cups (73%), flower pots (60%) and ice-cream cups (52%). Over all Culex larvae were most abundant 5,886 (45.8 %) during this period, followed by Ae. aegypti 4681 (36.43%) and Ae. albopictus 2,280 (17.74%) (Fig., 3). Over a selected period of seven months (March-September, 2011), about 570 field collected Ae. aegypti female mosquitoes in 114 pools and 40 field collected Ae. albopictus females in 4 pools were screened for dengue viruses using antigen capture enzyme linked immunosorbent assays (ELISA). Among them, 31 pools of females Ae. aegypti and one pool of Ae. albopictus were found to be positive for dengue virus antigen respectively. The minimum infection rate (MIR) was 27.19% for Ae. aegypti and 25% for Ae. albopictus by ELISA (Table III). DISCUSSION Dengue virus infections are becoming a serious health problem with explosive outbreaks since 2006 in all over Pakistan particularly in highly populated urban cities like Lahore and Karachi. The number of reported cases are 22,000 from Lahore during 2011 which are highest among all outbreaks occurred in the last few years. Detection of natural mosquito infection with arboviruses forms a key element in any surveillance study and is valuable for incrimination and effective vector control measures. Dengue virus detection in field population of Ae. aegypti and Ae. albopictus serve as predictive model for forecasting impending outbreak (Lee et al., 2005). No previous research was reported regarding detection of dengue viruses from wild caught Aedes mosquitoes in Pakistan. This is the first report of DEN virus detection from adult females of Ae. aegypti and Ae. albopictus collected from different localities of Lahore, Pakistan using dengue virus specific monoclonal antibodies by antigen capture enzyme linked immunosorbent assays (ELISAs). The two species of Aedes were found in the highly populated urban localities of Lahore. However, Aedes aegypti was most prevalent and widely distributed in all localities. The same was reported by Kumari et al. (2011) in India. Aedes albopictus appeared in rainy wet season i.e., in July- August which indicated that it was more dependent on rainfall as compared to Aedes aegypti, its larval density sharply increased from August-September.
VOL. 60 (2) DETECTION OF DENGUE VIRUSES IN VECTOR MOSQUITOES 173 Both species coexisted in many localities of Lahore also reported in China and Malaysia (Jian-feng et al., 2007) Current study from March-September indicated that female Ae. aegypti were found with dengue viruses in 31 pools from 114 pools while Ae. albopictus indicated only in 1 pool positive out of total 4 pools screened for dengue viruses. These results indicated 27.71% (MIR) pools were positive for Ae. aegypti and 25% (MIR) pools for Ae. albopictus screened for these viruses. In another study conducted by Srisuphanunt et al., (2007) in Thailand, indicated an average of 18.3% (44 of 240) of Ae. aegypti tested individually, were found positive for dengue virus infection by ELISA during the period April-September 2000. The adult females of Ae. aegypti were collected from selected dengue sensitive area in Chonbung District, Bangkok. In current study the positive pools of collected Ae. aegypti mosquitoes were correlated with high risk of DF/DHF reported localities such as Mughalpura, Wahdat Colony, Chuburji, Officer s Colony, Jallo Park, Manawan and Lahore Zoo during the study period. Clinical data indicated approximately 50% dengue cases occurred in these areas. The observed patterns of dengue virus infection in mosquitoes detected by antigen capture ELISA coincides with clinical data and require more intensive investigation using improved diagnostic tools. Dengue virus detection using dengue specific monoclonal antibodies, broadly reactive against all four serotypes of dengue viruses as the capture antibody and detector MAB, broadly reactive against flaviviruses conjugated with horse reddish peroxidase indicated only positive pools which could be further screened by Toxo-IFA system for virus isolation using dengue virus serotypes specific MABs from DENV 1-4 and RT-PCR techniques can be employed for dengue virus amplification. Acknowledgement We are thankful to CDC Fort Collins, California USA for providing dengue specific Monoclonal antibodies (MAB D 3-5C9-1), detector antibody (MAB CB6-C) and dengue antigens 1-4 used to detect dengue viruses from mosquito homogenates. Table I: Species Composition of Mosquitoes in Different Localities of Lahore from March-September, 2011 Sr. No. Month Mosquito Aedes aegypti Aedes albopictus Culex quinquefasciatus 1 March 393 0 1399 2. April 307 0 2567 3. July 251 393 3551 4. August 273 71 118 5. September 161 0 220 Total 1385 464 7855 Percentage 14.2% 4.7% 80.9% Total mosquitoes = 9704
174 N. JAHAN ET AL BIOLOGIA (PAKISTAN) 160 140 120 C / mm / % 100 80 60 40 20 Temperature Rainfall Relative Humidity 0 March April July Months August September Fig., 1: Average Temperature, Rain Fall and Relative Humidity of Lahore from March -September, 2011 Fig., 2: Species Composition of Mosquitoes from March to September, 2011
VOL. 60 (2) DETECTION OF DENGUE VIRUSES IN VECTOR MOSQUITOES 175 Fig., 3: Number of larvae Collected from March to September, 2011 Table II: Various Breeding Habitats of Aedes Mosquitos from March to September, 2011 in Lahore Sr. No. Types of natural and artificial breeding containers Percentage positivity 1 Desert coolers 85 2 Ice cream cups 52 3 Plastic cups 73 4 Used automobile tyres 94 5 Gutter holes 1 6 Tin containers 10 7 Tree holes 2 8 Discarded shoes 5 9 Flower pots 60 10 Water dishes/plates 9 Species of Mosquito Table III: The numbers of field caught Ae. aegypti / Ae. albopictus positive for DEN viruses by ELISA No. tested Total No. of Pools No. of +ve Pools Percentage +ve Pools Ae. aegypti 470 114 *1 31 27.19 250* 3 25 01 04 Ae. albopictus 40 04 *2 01 25 *1 Each pool contains 05 mosquitoes; *2 Each pool contains 10 mosquitoes; *3 Larvae reared in laboratory indicating vertical transmission
176 N. JAHAN ET AL BIOLOGIA (PAKISTAN) REFERENCES Arunachalam, N., Tewari, S.C., Thenmozhi, V., Rajendran, R., Paramasivan, R., Manavalan, R., Ayanar, K. & Tyagi, B.K., 2008. Natural vertical transmission of dengue viruses by Aedes aegypti in Chennai, Tamil Nadu, India. Indian. J. Med. Res., 127: 395-397. Chow, V.T.K., Chan, Y.C., Yong, R., Lee, K., M., Chung, Y.K., Lam-Phua, S.G., & Tan, B.T., 1998. Monitoring of dengue viruses in field caught Aedes aegypti and Aedes albopictus mosquitoes by a type specific polymerase chain reaction and cycle sequencing. Am. J. Trop. Med. Hyg., 58(5): 578-586. Das, B.P., Kabila, I., Sharma, S.N., Lal, S., Regu, K. & Sexena, V.K., 2004. Detection of dengue virus in wild caught Aedes albopictus (Skuse) around Kozhikode airport, Malappuram district, Kerala, India. Dengue Bull., 28: 210-2. Gubler, D.J., 2002. Epidemic dengue/dengue haemorrhagic fever as a public health, social and economic in the 21 st century. Trends Microbiol., 10: 1-4. Jiang-feng, H., Hui-ming, L., Wenj-jia, L., Kui, Z., Min, K. & Li-ping, L., 2007. Epidemic situation of dengue fever in Guangdong province, China 1990-2005. Dengue Bull., 31: 1-9. Kumari, R., Kaushal, K. & Chauhan, L.S., 2011. First dengue virus detection in Aedes albopictus from Delhi, India: Its breeding ecology and role in dengue transmission. J. Trop. Med. Int., 16(8): 949-54. Lee, H.L. & Rohani, A., 2005. Transovarial transmission of dengue virus in Aedes aegypti and Aedes albopictus in relation to dengue outbreaks in an urban area in Malaysia. Dengue Bull., 29: 106-11. Linthicum, K.J., Sithiprasna, R., Strickman, D. & Innis, B.L., 2009. ELISA for detecting dengue and Japenese encephalitis viral antigen in mosquitoes. Ann. Trop. Med. Parasitol., 88: 397-404. Mukhtar, M., Herrel, N., Amerasinghe, F.P., Ensink, J., van der Hoek, W. & Konradsen, F., 2003. Role of wastewater irrigation in mosquito breeding in south Punjab Pakistan, Southeast Asian J. Trop. Med. Public Health, 34: 72-80. Romero-Vivas, C.M.E, Leake, C.J. & Falconar, A.K.I., 1998. Determination of dengue virus serotypes in individual Aedes aegypti mosquitoes in Colombia. Medical and Veterinary Entomology, 12: 284-288. Sithiprasasna, R., Strickman, D., Innis, B.L. & Linthicum, K.J., 1994. ELISA for detecting dengue and Japenese encephalitis viral antigen in mosquitoes. Am. Trop. Med. Parasitol., 88: 397-404. Smuel, P.P., & Tyagi, B.K., 2006. Diagnostic methods for detection and isolation of the dengue Viruses from vector mosquitoes. Indian J. Med. Res., 123: 615-628. Srisuphanunt, M., Sithiprasasna, R., Patpoparn, S., Attatippaholkun, W. & Wiwanitkit, V., 2007. ELISA as an alternative tool for epidemiological surveillance for dengue in mosquitoes: a report from Thailand. J. Vector Borne Dis., 44: 272-276. Tewari, S.C., Thenmozhi, V., Katholi, C.R., Manavalan, R., Munirathinam, A. & Gajanana, A. 2004. Dengue vector prevelance and virus infection in rural areas in South India. Trop. Med. Int. Health, 4: 499-507. Thenmozhi, V., Kabilan, L., Philip, S.P. & Dash, A.P., 2005. Detection of dengue virus antigens in desiccated mosquitoes: an improved surveillance system. Trop. Med. Int. Health, 10: 187-9. WHO., 2009. Dengue in the Western pacific region. World Health Organization. Available at www.wpro.who.int/health_tropics/dengue. Womack, M., 1993. The yellow fever mosquito, Aedes aegypti. Wings Beats, 5(4): 4.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 177-183 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Effect of L-Thyroxine on Some Blood Parameters in Broiler Chicks (Gallus gallus) of Different Ages *ZAHID HUSSAIN SIDDIQUI, MUHAMMAD ASGHAR CHAUDHRY & SADAQAT ALI Department of Zoology, Govt. College of Science, Wahdat Road, Lahore, Pakistan ABSTRACT The effect of intraperitoneal administration of a single dose (1µg/g) of thyroxine (T 4) after 24, 48 and 98 hours on plasma total proteins, albumin fraction, uric acid, glucose, triglycerides and cholesterol has been investigated in broiler (Hubbard) chicks of 15, 25 and 35 days of age. Thyroxine treatment resulted in a significant decrease of plasma proteins after 96 hours of the experiment in 25 days old chicks and after 48 hours in birds of 35 days of age. The plasma albumin was significantly lowered in all experimental animals of different age groups. Thyroidal treatment showed a decreasing trend of plasma uric acid levels in chicks of different age groups. However, there was an exceptional increase of uric acid values after 24 hours of the experiment in 15 days old chicks. Plasma glucose values exhibited a decreasing trend in 25 days and 35 days old experimental birds throughout the experimental period. The trend for plasma glucose values in 15 days old experimental birds was found to be opposite to those of relatively advance age. Thyroxine treatment resulted in a decrease in plasma triglycerides in broilers of all age groups. There was an increasing trend in plasma cholesterol levels in thyroxine administered birds of different age groups. The increase in cholesterol values was found to be significant at 24 hours and it persisted up to 48 hours of the experiment in 15 days old chicks. Key words: L-Thyroxine, Blood, Broiler chicks INTRODUCTION Thyroid hormones (TH) are universal regulator of growth, development and metabolism (Gnocchi et al., 2012). In development thyroid hormones stimulate cell proliferation (Gnocchi et al., 2012) and directly trigger cellular differentiation and maturation effect in a number of tissues and play indirect role in growth (McNabb, 1995). In birds and mammals thyroidectomy or hypothyroidism results in retardation of general body growth by decreasing the protein and RNA content of the skeletal muscle (Al-Kanhal et al., 1994). Whereas, thyroxine (T 4 ) administration resulted in an increase in protein synthesis in muscle (Matty et al., 1982). Various studies have demonstrated that thyroidal treatment of teleosts either by injection or by feeding hormone supplemented diets promote growth and also increase food conversion efficiency (Chaudhry & Lone, 1986). TH is essential in brain development (Zhang et al., 2010) and skeletal growth (Shaikh et al., 2013). It has been found that if chicks were injected with low dose (1.0 µg/g) and high dose (4.0 µg/g) of thyroxine, their plasma protein, glucose and triglycerides levels were decreased significantly. Thyroxine had biphasic effect on uric acid. Low dose of thyroxine decreased and high dose increased uric acid initially followed by decrease at 48 hours of the thyroxine injection (Chaudhry et al., 2009). It had also been found that if laboratory mice were injected with low dose (1.0 µg/g) and high dose (4.0 µg/g) of thyroxine, their plasma triglycerides, cholesterol and glucose levels were decreased significantly and albumin was increased significantly. Thyroxine had biphasic effect on protein. Low dose of thyroxine increases and high dose decreases protein. Uric acid decrease initially followed by increase at 24 hours of the thyroxine injection (Al-Kanhal et al., 1994). Treatment in rats with L-thyroxine sodium (75 mg/kg body mass for three weeks) produced an increase in serum triglycerides levels and decrease in cholesterol (Bhatt et al., 2007). There were some reports on biochemical and physiological consequences of thyroid treatment in mammals (Bhatt & Makwana, 2008). Role of thyroxine was studied previously in animals of different ages/weight. Thyroxine injections (1 µg/g) for five consecutive days caused a reduction in hepatic glucose-6-phosphatase activity and glycogen content in toads of immature, juvenile and adult stages. In contrast, Lata fish of different stages showed an enhancement of hepatic *Corresponding author: drzhsiddiqui@yahoo.com
178 Z. H. SIDDIQUI ET AL BIOLOGIA (PAKISTAN) glucose-6-phosphatase activity after thyroxine treatment (1 µg /g, 5 injections). The liver glycogen content in Lata fish of different age groups was found to be reduced after thyroxine injections, but not so much as in the toad (Paul & Medda, 1996). Thyroid hormones increased with increase in age of tilapia fry which is required to increase the weight gain and RNA and protein synthesis. For one week old tilapia, 10µg/100mL of thyroxine in the aquarium water was the maximum concentration, while for three weeks old tilapia this dose was 25 µg/100ml. The effect of thyroid hormone on the increase of protein and nucleic acids of liver and muscle was observed only in tilapia of up to 40 g. Fish of 230 g showed no response in this respect (Matty et al., 1982). Circulating blood is a constant source of supplying and collecting different metabolites from various body tissues and organs. A study of various metabolites in blood under the influence of thyroid hormone will contribute more to the understanding of its biochemical and physiological effects in the body and at the tissue level as well. The present communication deals with the effects of a single injection of thyroxine with time on plasma glucose, total proteins, cholesterol, triglycerides, albumin and uric acid in broiler chicks (Hubbard) of different age groups. The chicks were fasted for two hours before the start of experiment. Thyroxine (T 4 ) was purchased from Sigma chemicals, Germany. Its sodium salt was dissolved (mg/ml) in the alkaline 50 % propylene glycol. Each chick was weighed and T 4 was injected intraperitoneally at a dose of 1.0 µg/g body weight. Controls were injected with carrier only. Three broiler chicks were slaughtered from each experimental and control groups after 24, 48 and 96 hours of the single injection of T 4. Their blood samples were collected in test tubes containing EDTA to prevent blood clotting. Blood was centrifuged at 3000 rpm for 15 minutes to separate the plasma. One percent sodium azide (10 µl/ml of sample) was added to all samples to avoid any bacterial growth. Plasma total protein, albumin fraction, uric acid, glucose cholesterol and triglycerides were examined by chemistry analyzer, Dimension AR, DADE, USA. All assays were performed in duplicate. Experimental data were analyzed by student t-test and graphs were plotted on computer in Microsoft excel 2007. RESULTS The effect on total protein in broiler chicks of different ages administrated with T 4 is represented in Fig., 1. MATERIALS AND METHODS Broiler chicks (Hubbard) of 15, 25 and 35 days old were obtained from poultry farm situated in District Sheikhupura, Punjab. The animals of each age group were divided into two groups, each having nine chicks, one control and other experimental group. In the laboratory chicks were maintained at 24±2 C. The photoperiod was fixed at 12L: 12D. Humidity of the laboratory remained 50±10 % during conditioning the birds as well as the experimental period. After grouping chicks were acclimatized in the laboratory for seven days. After that allocation of groups to control and experimental were made on random basis. During the acclimatization and experimental periods the animals were fed on feed No. 4 of the National Company, Lahore. The animals were fed ad libitum twice a day. The water was also available ad libitum. Fig., 1: Effect of single injection of thyroxine on changes in total plasma protein levels of broiler chicks of different ages. Thyroxine treatment resulted in a significant decrease of plasma proteins after 96 hours and 48 hours in 25 and 35 days old chicks respectively. Whereas, in relatively younger chicks (15 days old), the values of plasma proteins remained comparable
VOL. 60 (2) EFFECT OF L-THYROXINE ON CHICKS 179 borh in control and experimental animals throughout the experimental period. The data regarding the effect of a single intraperitoneal injection of T 4 on plasma albumin fraction is presented in Fig., 2. The plasma albumin fraction was significantly lowered in all experimental animals belonging to different age groups. This decrease was visible after 48 hours and persisted till the termination of the experiment. Generally, plasma glucose values, after thyroxine treatment, exhibited a decreasing trend in 25 days and 35 days old experimental birds throughout the experimental period but the decrease was found to be significant after 96 hours (in 25 days old chicks) and 48 hours (in 35 days old chicks) of the experiment. The trend for plasma glucose values in 15 days old experimental birds was found to be opposite to those of relatively advance aged (Fig., 4). Fig., 2: Effect of single injection of thyroxine on changes in plasma albumin levels of broiler chicks of different ages. The values for plasma uric acid are shown in Fig., 3. Thyroidal treatment resulted in a general decreasing trend of plasma uric acid levels in chicks belonging to different age groups. However, there was an exceptional increase of uric acid values after 24 hours of the experiment in 15 days old chicks. Fig., 4: Effect of single injection of thyroxine on changes in plasma glucose levels of broiler chicks of different ages. Fig., 5: Effect of single injection of thyroxine on changes in plasma cholesterol levels of broiler chicks of different ages. Fig., 3: Effect of single injection of thyroxine on changes in plasma uric acid levels of broiler chicks of different ages. Fig., 5 reveals the effect of a single intraperitonial injection of T 4 on plasma cholesterol levels of chicks. There was a general increasing trend in plasma cholesterol levels in thyroxine administered birds of different age groups. The increase in cholesterol values was found to be
180 Z. H. SIDDIQUI ET AL BIOLOGIA (PAKISTAN) significant at 24 hours and it persisted up to 48 hours of the experiment in 15 days old chicks. The effect of T 4 on plasma triglycerides in chicks is shown in Fig., 6. Thyroxine treatment resulted in a decrease in plasma triglycerides in thyroxine treated broilers of all age groups. This decrease in triglycrides was significant after 24 hours (in 15 days old chicks) and 48 hours (in 25 and 35 days old chicks) of the experiment. Fig., 6: Effect of single injection of thyroxine on changes in plasma triglycerides levels of broiler chicks of different ages. DISCUSSION The present study indicated that thyroxine was capable of inducing changes in serum glucose, cholesterol, triglycerides, total proteins, albumin fraction and uric acid in broiler chicks of different age groups. In 15 days old chicks there was increase in plasma glucose value after 24 hours of the experiment and such non-significant increase was maintained till 48 hours. However, at 96 hours of the single injection of the thyroxine these values for experimental and control chicks were comparable. In comparatively older chicks (25 and 35 days old), the trend of plasma glucose was found to be opposite as observed in younger (15 days old) chicks. There was a significant decrease in plasma glucose at 96 and 48 hours (in 25 and 35 days old animals respectively) of the experiment and the same trend persisted till 96 hours of the experiment. As regards the decreasing trend in plasma of comparatively older animals was probably due to increase in level of insulin under the influence of thyroxine (Ahmad, 1997). The stimulatory effect of thyroxine on plasma insulin was greater in old than in young dwarf mice (Louis et al., 2010). Hypoglycemic conditions observed in experimental birds of advance age could have developed either due to increased insulin levels under the influence of expected hyperglycemia as a result of lipolysis or due to direct stimulation of endocrine pancreas by elevated thyroxine levels or both. The plasma insulin levels have been reported to be significantly elevated in hyperthyroid pigeons (John & Georage, 1985). Similarly, lypolytic effect under hyperthyroid conditions has also been established in broilers (Decuypere et at., 1987). The opposite trend in plasma glucose of chicks of younger age observed in present studies was difficult to explain keeping in view the available literature. It could be just possible that in younger chicks sufficient fat depots might not be available for lipolysis under the influence of thyroxine. But further detailed studies are required to establish it. The response of thyroxine to plasma protein values in birds of different age groups represents an interesting picture. In 15 days old chicks, these values remained comparable in control and experimental groups throughout the experimental period. However, in 25 and 35 days old experimental animals, the plasma proteins were found to be significantly lower after 96 and 48 hours respectively. The decrease in plasma proteins in thyroxine treated broilers observed during the present studies is also supported by the earlier reports about fish (Sahoo, 2003). On the other hand, there are many reports available in literature indicating that administration of low doses of thyroid hormones elevated both nucleic acids and total proteins in fish muscle (Matty et al., 1982; Chaudhry & Lone, 1986; Chaudhry et al., 1988) and in mammals (Al-Kanhal et al., 1994). Increase or decrease in protein level in both fish and mammals depended upon the dose of the hormone in fish (Matty et al., 1982; Chaudhry & Lone, 1986; Chaudhry et al., 1988) and in mammals (Al-kanhal et al., 1994). In moderate concentration thyroxine induced anabolic effect resulting in an increase in RNA and protein synthesis but at higher doses its effect was found to be catabolic for both RNA and proteins. In the present studies on broilers of various age groups administration of thyroxine
VOL. 60 (2) EFFECT OF L-THYROXINE ON CHICKS 181 resulted in a decrease in serum total proteins in older animals. Our findings are in line with previous reports in aves, where thyroxine administration in white Rock and Sussex hens resulted in lowering of total plasma proteins (Majewaska et al., 1979). The genetic background of the broiler being to develop more musculature, it is just possible that the decreased plasma proteins in experimental groups may perhaps be due to the channelization of these nitrogenous compounds to the muscle tissue under the influence of thyroid hormone. In comparatively young birds (15 days old) serum plasma protein remained unaltered under the influence of thyroxine. The age dependent response to thyroxine administration in broiler chicks is difficult to explain as such. It may be explained by considering the growth curve of the broiler breed. It has been reported that a fast growth in musculature of the broiler begins after attaining three weeks of age. It seems that thyroid hormones are only able to enhance the channelization of nitrogenous compounds from the blood to the muscle cells when there is active protein synthesis going on in the muscles. However, further detailed studies are required to establish the above hypothesis. The administration of thyroxine remained ineffective to induce any significant change in plasma cholesterol levels in comparatively older chicks (25 and 35 days old) but in younger birds the cholesterol level was significantly increased in the experimental groups at 24 and 48 hours of the experiment. The results obtained in the present study in comparatively advanced age chicks are contradictory to various reports in literature on birds (Abdel-Fattah et al., 2008) and mammals (Nanda et al., 2007). From the above reports it seems to be evident that hyperthyroidism in birds and mammals was accompanied by a decrease in plasma cholesterol level. Whereas, in present studies, comparatively older broilers revealed that administration of single injection (1µg/g) of thyroid hormone was ineffective to alter plasma cholesterol level. However, in younger birds the same dose of thyroxine resulted in a significant increase of plasma cholesterol values. The differences in responses of thyroxine administration to plasma cholesterol values reported in literature and the results of the present study in comparatively advance aged birds could be attributed to different physiological responses of mammals and birds to thyroid administration. It can also be explained on the basis of that a single dose of thyroxine (1.0 µg/g) may not have caused the required level of hyperthyroidism to affect plasma cholesterol. The increase in plasma cholesterol in younger birds under the influence of thyroxine administration observed in the present studies is difficult to explain and further extensive experimentation is required to resolve it. Age related effect of thyroid administration on plasma triglycerides in broilers seemed to be interesting. There was common decreasing trend in experimental animals of different age groups but the response was quick in younger birds as compared to those of advanced age. The decrease in plasma triglycerides in experimental chicks under the influence of thyroidal administration seemed to be in agreement with the earlier reports on both birds and mammals (Abdel-Fattah et al., 2008). As reported earlier that thyroxine treated birds revealed hypoglycemia in the present studies. Hypoglycemia was also accompanied by a significant decrease in plasma triglycerides and such response appeared earlier in younger birds during the course of experiment. These lipids are highly concentrated depots of metabolic energy (Stryer, 1981) and it seems that under the influence of thyroid hormone lipids and carbohydrates are being metabolized to meet the metabolic demands (Abdel-Fattah et al., 2008). The plasma albumin levels in experimental broilers of different age groups revealed identical decreasing trend in birds of all ages. However, in younger birds the decreasing trend of plasma albumin was found more intense (P < 0.01) as compared to advance aged birds. These agerelated differences seemed to be linked with the basal metabolic rate of the animals employed in the present studies (Randall et al., 2002). When birds of different age groups were administered a single dose of thyroxine (1.0 µg/g), there was a decrease in plasma uric acid levels in these animals as shown in the present studies. But in 15 days old chicks there was an initial increase (P < 0.05) of uric acid at 24 hours of the experiment followed by a normal decreasing trend. Uric acid is
182 Z. H. SIDDIQUI ET AL BIOLOGIA (PAKISTAN) the main end product of protein metabolism in aves (Randall et al., 2002; Sherwood et al., 2005). A decrease in plasma total protein and albumin fraction accompanied by a corresponding decrease in uric acid levels in birds of different age group, perhaps reflects a decreased rate of protein catabolism in these animals. Whereas, in younger experimental birds (15 days) an initial increase in plasma uric acid followed by a decrease was surprising and difficult to explain. The above referred biphasic effect observed in the present study of the same dose of the thyroxine in the same animal and the same tissue could be explained by assuming that the dose of hormone used might have resulted in increased protein catabolism at initial stages of the experiment (Goldberg et al., 1980). Moreover, it was also established that pharmacological hyperthyroidism was accompanied by a corresponding increase in lysosomal enzyme cathepsin-d, which degrades the proteins in different tissues (Sherwood et al., 2005). REFERENCES Abdel-Fattah, S.A., Elsanhoury, M.H., Elmenday, N.M. & Abdel-Azeem, F., 2008. Thyroid activity, some blood constituents, organs morphology and performance of broiler chicks fed supplemental organic acids. Intern. J. Poult. Sci., 7(3): 215-222. Ahmad, M., 1997. Essentials of Medical Biochemistry. Merit publishers, Faisalabad, pp: 208-210. Al-Kanhal, M.N.A., Chaudhry, M.A. & Zubair, M.U., 1994. Effect of L-thyroxine on some blood parameters of laboratory mice. J. King. Saud. Univ., 6(2): 197-206. Bhatt, P.A. & Makwana, D., 2008. Comparative influence of propranolol and verapamil on glycemic control and histamine sensitivity associated with L-thyroxine induced hyperthyroidism. Fundam. Clin. Pharmacol., 22(1): 53-59. Bhatt, P.A., Makwana, D., SantaniI, D. & Goyal, R., 2007. Comparative effectiveness of carevdiol and propranolol on glycemic control and insulin resistance associated with L- thyroxine induced hyperthyroidism. Can. J. Physiol. Pharmacol., 85(5): 514-520. Chaudhry, M. A., Siddiqui, Z. H., Imran, M. & Ahsan, M., 2009. Effect of L-thyroxine on plasma biochemistry in broiler chicks (Gallus gallus). Sci. Int. (Lahore), 21(4): 255-266. Chaudhry, M.A. & Lone, K.P., 1986. Thyroid and fish physiology. Biologia, Special supplement, pp: 89-119. Chaudhry, M.A., Al-Kahem, H.F., Al-Khel, A.S., Ahmad, Z. & Shamsi, M.J.K., 1988. Thyroxine and blood chemistry of Cyprinus carpino. Angewwando. Zoologic., 75: 345-353. Decuypere, E., Buyse, J., Scanes, C.G., Huybrechts, L. & Kuhn, E.R., 1987. Effects of hyper or hypothyroid status on growth, adiposity and levels of growth hormone, somatostatin C and thyroid metabolism in broiler chickens. Reprod. Nutr. Dev., 27: 555-565. Gnocchi, D., Leoni, S., Incerpi, S. & Bruscalupi, G., 2012. 3,5,3'-triiodothyronine (T 3 ) stimulates cell proliferation through the activation of the PI3K/Akt pathway and reactive oxygen species (ROS) production in chick embryo hepatocytes. Steroids, 77(6): 589-95. doi: 10.1016/j.steroids.2012.01.022. Goldberg, A.L., Tischler, M., Demartino, G. & Griffen G., 1980. Hormonal regulation of protein degradation of synthesis in skeletal muscle. Fed. Proc., 39: 31-36. John, T.M. & George, J.C., 1985. Effects of histamine and histamine releaser on body temperature and blood levels of metabolites and thyroid hormones in pigeons. Arch. Int. Pharmacodyl. Ther., 275: 160-176. Louis, A., Bartke, A. & Masternak, M.M., 2010. Effects of growth hormone and thyroxine replacement therapy on insulin signaling in Ames dwarf mice. J. Gerontol. A. Biol. Sci. Med. Sci., 65(4): 344-52. doi: 10.1093/gerona/glq018. Majewska, H., Konecka, A.M. & Witowski, A., 1979. Responses upon multiple administration of L-thyroxine in hens. TAG Theo. App. Gen., 54: 121-128. Matty, A.J., Chaudhry, M.A. & Lone, K., 1982. The effect of thyroid hormone and temperature on protein and nucleic acid contents in liver and muscle of saretherodon massambicus. Gen. Com. Endocrinol., 47: 497-507. McNabb, F.N.A., 1995. Thyroid hormones, their activation, degradation and effects on metabolism. J. Nutr., 125: 1773S-1776S. Nanda, N., Bobby, Z., Hamide, A., Korner, B.C. & Sridhar, M.G., 2007. Association between oxidative stress and coronary lipid risk
VOL. 60 (2) EFFECT OF L-THYROXINE ON CHICKS 183 factors in hypothyroid women is independent out body mass index. Metabol., 56: 1350-1355. Paul, A.K. & Medda, A.K., 1996. Effect of thyroxine on hepatic glucose-6-phosphate activity and glycogen content of toad and Lata fish. J. Endocrinol., 55: 120-126. Randall, D., Burggon, W. & French, K., 2002. Eckert Animal physiology, Mechanism and Adaptation. Freeman and company, New York, pp: 310-339. Sahoo, P.K., 2003. Immunostimulating effect of triiodothyronine in rohu (Labeo rohita) enhances immunity and resistance Aeromonas hydrophila infection. J. Appli. Ichthyol., 19: 118-122. Shaikh, M.A., Naeem, Z., Alshahat, A.A., Shaikh, F.A. & Arif, S., 2013. Growth plate changes associated with Hypothyroidism amongst the pre and postnatal rats. Int. J. Health Sci. (Qassim), 7(1): 31-43. Sherwood, L., Kladorf, H. & Yadcey, P.H., 2005. Animal physiology: From genes to organisms. Thomson, Singopore, pp: 277-281. Stryer, L., 1981. Biochemistry. 2 nd edition. Freeman and company, San Francisco. Zhang, L., Cooper-Kuhn, C.M., Nannmark, U., Blomgren, K. & Kuhn, H.G., 2010. Stimulatory effects of thyroid hormone on brain angiogenesis in vivo and in vitro. J. Cereb. Blood Flow Metab., 30(2): 323-35. doi: 10.1038/jcbfm.2009.216.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 185-191 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Incidence of E. coli O157: H7 in Fresh Fruit Juices of Street Vendors from Different Areas of Lahore City, Pakistan * MEHWISH IQTEDAR 1 & AYESHA YASIN 1 Department of Biotechnology, Lahore College for Women University, Lahore, Pakistan ABSTRACT Pakistan is among one of the countries where food and water borne illnesses due to Escherichia coli O157:H7 contamination are frequent. Present study was undertaken for detection of the possible sources of E.coli O157:H7 in street vended fresh fruit juices sold in streets and along the road sides of Lahore city. About 162 fresh juice samples of sugar cane, plum, tamarind, peach, lemonade and slush that were taken from different localities of Lahore and analyzed for the presence of E.coli O157:H7. Sugar cane juice samples from Wahdat colony and Ichrah were found 13% more contaminated with E.coli O157:H7 than the samples of other areas. While for tamarind, Railway station and Gulshan Ravi and for plum juices Railway station and Moon market had 41% more contamination of E.coli O157:H7 as compared to others. In case of peach Ichrah samples had shown highest counts (53%). For slush, Railway station samples revealed countless contamination. Whereas for lemonade juices about 50% of all the areas studied had 13% more contamination as compared to others. Our studies suggest that ignorance of hygienic practicing, unpasteurized fruit juices and use of fecal contaminated water in juice making is the potential candidate for E.coli O157:H7 contamination. Efforts should be taken to develop awareness and to improve the handling practices along with maintaining hygienic conditions to avoid food borne illnesses. These preventive measures can reduce the degree of harmful pathogen contamination to fresh juices sold at roadside outlets and hence helps in preventing outbreaks of infective diseases as well as improve the general health conditions of people. Key words: Fruit Juices, Street vendors, Contamination, E. coli O157:H7, microbes INTRODUCTION Escherichia coli O157:H7 is an enterohemorrhagic strain of the bacterium Escherichia coli and a causative agent of Hemorrhagic colitis an acute food borne disease (CDC,1996; CDC, 1997;Karch et al., 2005; Carney et al,. 2006). Escherichia coli O157:H7 serotype was first reported in USA in 1975 from a foodborne outbreak (Riley et al., 1983; Wachsmuth et al., 1991). Ever since it has become the most important serotype in foodborne illnesses (Karmali, 1989) and is associated with many disease outbreaks throughout the UK, USA, Canada, Japan, Sweden and many more (Michino et al., 1999; Willshaw et al., 2001; Woodward et al., 2002; Cagney et al., 2004; Carroll et al., 2005; Sartz et al., 2008; Uhlich et al., 2008). Cattle are asymptomatic carriers of the organism as a result carcasses may become contaminated with the pathogen following slaughter (Chapman et al., 2001). Outbreaks have also been reported to be associated with water supplies contaminated with bovine faeces. Person-to-person transmission has also been reported at nurseries (Al-Jader et al., 1999). Undercooked or raw hamburger (ground beef) has been implicated in many of the documented outbreaks, however E. coli O157:H7 outbreaks have implicated alfalfa sprouts, unpasteurized fruit juices such as apple juice, cider, dry-cured salami, lettuce, game meat, and cheese curds (Zhao et al., 1993; Cody et al., 1999; Hilborn et al., 1999, 2000; Michino et al., 1999). Fruit juices and nectars in colloquial terms are food products of great nutritional value, rich in vitamins, mineral salts, simple sugars and phytochemicals which are easily assimilated by humans. In many countries around the world especially developing one s there is a trend of unpasteurized fresh fruit juice consumption that are sold along road side shops and by street vendors that has been related to many food and water borne illnesses due to E.coli O157:H7 presence (Swerdlow et al., 1992; Luna-Gierke et al., 2014: Sodha et al., 2014 ). This infectious agent has become common, distressing and sometimes lifethreatening problem for millions of people around the world (Mosupye & Holy, 2000; Muinde & Kuria, 2005; Lewis et al., 2006; Chumber et al., 2007; Ghosh et al., 2007). Countries having hot summers where temperature reaches upto 50 F, people in order to gain respite from the rising mercury tend to *Corresponding author: miqtedar@gmail.com
186 M. IQTEDAR & A. YASIN BIOLOGIA (PAKISTAN) consume fresh juices. To fulfill their thirst, several roadside stalls spring up to cater the emergent demand. In view of the unsatisfactory sanitary and hygienic conditions that prevail in the vicinity of these stalls there is an increase in outbreaks of infective diseases (Abraham et al., 1997; Bhaskar et al., 2004; Subbannayya et al., 2007). Fruits are constantly contaminated by airborne microorganisms both externally and internally during growth and harvesting (Laidler et al., 2013; Wright et al., 2013; Ahmeda et al., 2014). However main sources of contamination in fresh fruit juices are unwashed instruments and utensils, germ-infested water used for dilution purpose prolonged preservation without low temperature maintenance, polluted surroundings often with swarming houseflies and fruit flies and airborne dust. Such unpasteurized fresh juices have shown to be potential sources of bacterial pathogens notably E. coli O157:H7, species of Salmonella, Shigella and Staphylococcus aureus (Lewis et al., 2006). Improperly prepared fresh fruits and vegetable juices are recognized as an incipient cause of food borne illness (Mudgil et al., 2004). E. coli O157:H7 has the ability to survive in food, soil, water and manure (Lynn et al., 1998; Hancock et al., 1998, 1998a). It also forms bio-films and therefore is protected from the effect of biocides and shows their persistence in water distributary system (Daly et al., 1998). Numerous outbreaks of E.coli O157:H7 infection due to consumption of unpasteurized fresh fruit juices have been reported (Besser et al., 1993; Griffin et al., 1994; Cody et al., 1999; Hilborn et al., 2000). In 1997, unpasteurized fresh apple cider was responsible for an E.coli O157:H7 outbreak in Connecticut and New York, USA (CDC, 1996-1997). E. coli O157:H7 survival in variety of juices is because of its ability to survive at low ph (Miller et al., 1994; Artz & Killham 2002; Vojdani et al., 2008). Street vendors serve a great part in fulfilling this demand as the fruit juices they supply are quite economical. Unhygienic practices offered in making these fruit juices and hence their microbial quality are questionable. Their unawareness towards concept of contamination is borne to food borne illnesses. In view of all these circumstances incidence of E. coli O157:H7 in different street vended fresh juices was undertaken. MATERIALS AND METHODS Sampling: Total 162 samples of variety of fresh fruit juices (Sugar cane, Plum, Tamarind, Peach, Lemonade and fruit Slushes) were taken from different localities of Lahore city. Samples were kept at 4 C before being processed and within shortest time period microbial quality regarding E. coli O157:H7 was analyzed in Health Microbiology Lab of Lahore College for Women University Lahore (LCWU), Pakistan. Enrichment Media for E. coli O157:H7: Enrichment media used for the isolation of E.coli O157:H7 was Tryptone Soya broth (Lab M) supplemented with vancomycin, cefixime, cefsulodin according to manufacturer s details. Juice sample was added into broth which was incubated at 37 Ċ for 24 hours. Selective Media for Isolation of E. coli O157:H7: Sorbitol MacConkey agar (Lab M) was used as a selective media for the isolation of E. coli O157:H7 from fresh fruit juice samples (Sugar cane, Plum, Tamarind, Peach, Lemonade and Slush) according to manufacturer s details. The inoculated plates were incubated at 37 C for 24 hours. Colony forming units (CFU/ml) of E. coli O157:H7 was calculated. All samples were preceded in triplicates. Statistical Analysis: For statistical analysis, Duncan Multiple range test was applied using SPSS version 13.0 at significance level 0.005. All experiments were performed in triplicates. RESULTS AND DISCUSSION Street vended fruit juices are well appreciated by the consumers because of their taste, low price, and ease in availability (Ohiokpehai, 2003). In spite of potential benefits offered by the fruit juices, concerns over their safety and quality have been raised; as freshly prepared juices have not been processed through standard steps to eliminate or minimize the microbial content (Mahale et al., 2008). In the present study, incidence of E. coli O157:H7 contamination in different fresh fruit juice samples of Sugar cane, Plum, Tamarind, Peach, Lemonade and Slush were taken from most popular market places of Lahore city, i.e., Ichhra, Railway
VOL. 60 (2) E. COLI O157: H7 FROM FRESH FRUIT JUICES 187 Station, Shadman, Garhi Shahu, Wahdat Colony, Neelam Block, Gulshan Ravi and Faisal Town. In case of sugar cane, E.coli O157:H7 count ranged from 6.87 10 3 ±0.94 10 3 CFU/ml to uncountable. Among these countless values were recorded for Ichhra, Wahdat Colony, Railway Station, Neelam Block, Garhi Shahu, Moon Market, Gulshan Ravi and Faisal Town while countable value was recorded for Shadman (Fig., 1, Table I). Plum juice samples were analyzed, the contamination of E.coli O157:H7 ranged from 3.17 10 3 ± 0.49 10 3 (CFU/ml) from Ichhra to uncountable from Railway station and Moon market, respectively. Overall Railway Station and Moon Market each had the highest count among all the areas studied (Fig., 1, Table I). Fig., 1: Colony forming unit per ml of E.coli O157: H7 from fresh fruit juices of street venders from different localities of Lahore city. Pattern fill bars shows uncountable colonies For tamarind juice, count ranged from 9.0 10 3 ± 0.35 10 3 (CFU/ml) from Wahdat colony to uncountable from Railway Station and Gulshan Ravi, respectively (Fig., 1; Table 1). Peach fruit juice samples had E.coli O157:H7 count that ranged from 13.67 10 3 ±0.57 10 3 (CFU/ml) from Faisal town to uncountable from Ichhra (Fig.,1, Table I). E.coli O157:H7 count for Lemonade was enumerated that ranged from 12.2 10 3 ± 0.8685 10 3 (CFU/ml) from Garhi shahu to countless from all the other areas (Ichhra, Wahdat Colony, Railway Station, Neelam Block, Shadman, Moon Market, Gulshan Ravi and Faisal Town) as shown in Fig., 1 and Table I. Counts for E.coli O157:H7 for slushes was recorded from 2.77 10 3 ±0.54 10 3 (CFU/ml) from Garhi Shahu to 75.0 10 3 ±0.96 10 3 (CFU/ml) from Railway Station. Railway station, Neelam Block, Moon Market and Gulshan Ravi showed significantly high counts (Fig., 1; Table I). Regarding lemonade, Railway Station had significantly more count as compared to other areas (Fig.,1; Table 1). Global tropical fruit consumption per capita has increased 33% over the last 20 years. Food borne illnesses because of the consumption of the fruit juices are reported in India and other places (Mosupye & Holy, 2000; Muinde & Kuria, 2005; Lewis et al., 2006; Chumber et al., 2007; Ghosh et al., 2007). In the present study, 162 juice samples of sugarcane, plum, tamarind, peach, lemonade and slush were analyzed for E. coli O157: H7 contamination. It was observed that more contamination was seen in lemonade juice for E. coli O157:H7 that could be due to addition of contaminated water for dilution purpose and pathogen tolerance towards acidity of juice (Miller, 1994; Zhao et al., 1993 ; Conner & Katrola, 1995). Thus water plays a major role in the contamination of lemonade. E. coli O157:H7 persist in drinking
188 M. IQTEDAR & A. YASIN BIOLOGIA (PAKISTAN) troughs and manure heaps for months or years thus facilitating prolong contamination of the locality and re-infection of animals (Bolton et al., 1999; Lejeune et al., 2001a-b; Guan & Holley, 2003). Overall, it is concluded that among all the areas studied Railway Station showed significantly highest contamination in all the juice samples analyzed. The main reason behind this might be due to poor quality of water used for dilution, prevailing unhygienic conditions and practices related to washing of hands, utensils, maintenance of the premises and site of juice stall location by waste disposal system and overcrowding (Barro, 2006; Tambekar et al., 2008, 2009 and 2011). The occurrence of pathogenic bacteria in fruit juices is alarming enough for an immediate action by the responsible agency. It is suggested that regular monitoring of the quality of fruit juices for human consumption must be introduced to avoid any future pathogen out breaks. Therefore, microbial analysis of commercially sold fruit juices should be done and regulation in the issuance of permit to produce and sell these products should be under strict quality control to reduce and mitigate exposure to harmful microbes deleterious to consumers health. Table I: Colony forming unit per ml of E. coli O157: H7 from fresh fruit juices of street venders from different localities of Lahore city. Study area Ichhra Wahdat colony Railway station Neelam block Shadman Garhi shahu Moon market Gulshan ravi Faisal town Sugar cane juice Uncountable Uncountable E.coli O157:H7 (CFU/ml) Plum juice Tamarind juice Peach juice 3 ± Lemonade juice 3.17 10 3 ± 46.33 10 Uncountable Uncountable 0.49 10 3(2) 1.54 10 3 (2,4,6,9) 3 ± 13.1 10 3 ± 9.0 10 41.13 10 Uncountable 0.55 10 3(3,6) 0.35 10 3 (6) 0.19 10 3 (7,8,9) Uncountable Uncountable Uncountable Uncountable 3 ± 3 ± 93.67 10 3 ± 2.70 10 3 (2,4-9) Uncountable 36.63 10 3 ± 35.6 10 79.27 10 Uncountable 1.71 10 3*(1,2,5,6,8) 1.07 10 3 (2,6) 4.84 10 3 (2,6-9) 3 ± 6.87 10 3 ± 15.53 10 60.0 10 78.97 10 0.94 10 3 1.77 10 3*(1,6) 3.63 10 3 (1,2,4-7,9) Uncountable Uncountable Uncountable Uncountable 3 ± 3 ± 3 ± 3 ± 8.09 10 3 (2,6-9) Uncountable 22.47 10 3 ± 14.33 10 44.8 10 12.2 10 1.43 10 3*(1,2,5) 0.19 10 3(2) 1.13 10 3 (7,8,9) Uncountable 45.67 10 3 ± 0.43 10 3 (1,2,4,5,6) Uncountable 3 ± 3 ± 0.8685 10 3 14.32 10 3 ± 66.1 10 Uncountable 0.40 10 3 (2,4) 1.75 10 3 3 ± 28.97 10 3 ± 85.43 10 3 ± 51.83 10 13.67 10 0.87 10 3 (1,2,4,5,6,8) 1.45 10 3 (1,2,4,5,6) 3 ± 0.74 10 3 (9) Uncountable 3 ± 0.57 10 3 Uncountable Values shown are Mean ± S.E.M. Superscripts in parenthesis represent statistical difference (p 0.005) between values that represent differences among different places at each fresh juice.
VOL. 60 (2) E. COLI O157: H7 FROM FRESH FRUIT JUICES 189 REFERENCES Abraham, M., Pai, M., Kang, G., Asokan, G.V., Magesh, S.R., Bhattacharji, S., & Rama, K.B.S., 1997. An outbreak of food poisoning in Tamil Nadu associated with Yersinia enterocolitica. Indian J. Med. Res., 106: 465-46. Ahmeda, A.M. & Shimamoto, T., 2014. Isolation and molecular characterization of Salmonella enterica, Escherichia coli O157:H7 and Shigella spp. from meat and dairy products in Egypt. Int. J. Microbiol., 168 169:57 62 Al-Jader, L., Salmon, R.L., Walker, A.M., Williams, H.M., Willshaw, G.A., & Cheasty, T. 1999. Outbreak of Escherichia coli O157:H7 in a nursery: lessons for prevention. Arch. Dis. Child., 81: 60 63. Artz, R.R.E., & Killham, K., 2002. Survival of Escherichia coli O157:H7 in private drinking water wells: Influences of protozoan grazing and elevated copper concentrations. FEMS Microbiol. Lett., 216:117-122. Barro, N., Bello, A.R., Aly, S., Ouattara, C.A.T., Ilboudo, A., Jules & Troré, A. S., 2006. Hygenic status and assessment of dish washing waters, hands and pieces of money from streed food processing site in Ouagadougou (Burkina Faso). Afri. J. of Biotec., 5: 1107-1112. Besser, R.E., Lett, S.M. & Weber, J.T., 1993. An outbreak of diarrhea and hemolytic uremic syndrome from Escherischia coli O157:H7 in fresh-pressed apple cider. JAMA., 269: 2217-20. Bolton, D.J., Byrne, C.M., Sheridan, J.J., McDowell, D.A. & Blair, I.S., 1999. The survival characteristics of a non-toxigenic strain of Escherichia coli O157:H7. J. Appl. Microbiol., 86: 407 11. Cagney, C., Crowley, H., Duffy, G., Sheridan, J.J., O'Brien, S. & Carney, E., 2004. Prevalence and numbers of Escherichia coli O157:H7 in minced beef and beef burgers from butcher shops and supermarkets in the Republic of Ireland. Food Microbiol., 21: 203 212 Carroll, A.M., Gibson, A. & Mcnamara, E.B., 2005. Laboratory-based surveillance of human vero cytotoxigenic Escherichia coli infection in the Republic of Ireland, 2002 2004. J. Med. Microbiol., 54: 1163 1169. Carney, E., O'Brien, S.B., Sheridan, J.J., McDowell, D.A., Blair, I.S. & Duffy, G., 2006. Prevalence and level of Escherichia coli O157:H7 on beef trimmings, carcasses and boned head meat at a beef slaughter plant. Food Microbiol., 23: 52 59. CDC, 1996. Outbreak of Escherichia coli O157:H7 infections associated with drinking unpasteurized commercial apple juice, British Columbia, California, Colorado, and Washington, October 1996. MMWR., 45: 975. CDC, 1997. Outbreaks of Escherichia coli O157:H7 Infection and Cryptosporidiosis Associated with Drinking Unpasteurized Apple Cider, Connecticut and New York, October 1996. MMWR., 46: 4-8 Chapman, P.A., Cerdan Malo, A.T., Ellin, M., & Ashton, R., 2001. Escherichia coli O157:H7 in cattle and sheep at slaughter, on beef and lamb carcasses and in raw beef and lamb products in South Yorkshire, UK. Int. J. Food. Microbiol., 64: 139 150. Chumber, S.K, Kaushik, K. & Savy, S., 2007. Bacteriological analysis of street foods in Pune. Indian J. Public Health, 51:114-6. Cody, S.H., Glynn, M.K., Farrar, J.A., Cairns, K.L., Griffin, P.M., Kobayashi. J., Fyfe, M., Hoffman, R., King, A.S., Lewis, J.H., Swaminathan, B., Bryant, R.G.& Vugia, D.J., 1999. An outbreak of Escherichia coli O157:H7 infection from unpasteurized commercial apple juice. California Department of Health Services, Berkeley 94704, USA. Ann Intern Med., 130: 202-9. Conner, D.E., & Kotrola, J.S., 1995. Growth and survival of Escherichia coli O157:H7 under acidic conditions. Appl. Environ. Microbiol., 61: 382-385. Daly, B., Betts, W.B., Brown, A.P. & O'Neill, J.G., 1998. Bacterial loss from biofilms exposed to free chlorine. Microbios., 96:7-21. Ghosh, M., Wahi, S., Kumar, M. & Ganguli, A. 2007. Prevalence of enterotoxigenic Staphylococcus aureus and Shigella spp. in some raw street vended Indian foods. Int. J. Environ. Health Res., 17:151-6. Griffin, P.M., Bell, B.P. & Cieslak, P.R., 1994. Large outbreak of Escherichia coli O157:H7 infections in the western United States: the big picture. In: Recent advances in verocytotoxin-producing Escherichia coli infections. Amsterdam: Elsevier Science B.V., 7-12. Guan, T.Y. & Holley, R.A., 2003. Pathogen survival in swine manure environments and
190 M. IQTEDAR & A. YASIN BIOLOGIA (PAKISTAN) transmission of human enteric illness. J. Environ. Qual., 32:383-92. Hancock, D.D., Besser, T.E. & Rice, D.H., 1998. Ecology of Eschericia coli O157:H7 in cattle and impact of management practices In: Escherichia coli and other shiga toxin producing E. coli strains. Washington D.C., ASM Press. pp. 85-91. Hancock, D.D., Besser, T.E., Rice, D.H., Ebel, E.D., Herriott, D.E. & Carpenter, L.V., 1998a. Mulipule sources of E.coli O157: H7 in feedlots and dairy farms in the northwestern USA. Prev. Vet. Med., 35: 11 19. Hilborn, E.D., Mshar, P.A., Fiorentino, T.R., Dembek, Z.F., Barrett, T.J., Howard, R.T. & Cartter, M.L., 2000. An outbreak of Escherichia coli O157:H7 infections and haemolytic uraemic syndrome associated with consumption of unpasteurized apple cider. Epidemiol. Infect., 124: 31-6. Hilborn, E.D., Mermin, J.H., Mshar, P.A., Hadler, J.L., Voetsch, A. & Wojtkunski, C., 1999. A multistate outbreak of Escherichia coli O157:H7 infections associated with consumption of mesclun lettuce. Arch. Intern. Med., 159: 1758 1764. Karch, H., Tarr, P. & Bielaszewska, M., 2005. Enterohaemorrhagic Escherichia coli in human medicine. Int. J. Med. Microbiol., 295: 405 18. Karmali, M.A., 1989. Infection by verocytotoxinproducing Escherichia coli. Clin. Microbiol. Rev., 2: 15 38 Laidler, M.L., Tourdjman, M., Genevieve, L., Hostetler, T.B., Repp, K.K., Leman, R., Samadpour, M. & Keene, W.E., 2013. Escherichia coli O157:H7 infections associated with consumption of locally grown strawberries. Clin. Infect. Dis., 57: 1129-1134. LeJeune, J.T., Besser, T.E., & Hancock, D.D., 2001a. Cattle water troughs as reservoirs of Escherichia coli O157. Appl. Environ. Microbiol., 67: 3053 3057. LeJeune, J.T., Besser, T.E., Merrill, N.L., Rice, D.H., & Hancock, D.D., 2001b. Livestock drinking water microbiology and the factors influencing the quality of drinking water offered to cattle. J. Dairy. Sci., 84: 1856 62. Lewis, J.E., Thompson, P., Rao, B.V.V.B.N., Kalavati, C. & Rajanna, B., 2006. Human bacteria in street vended fruit juices: A case study of Visakhapatnam City, India. Internet. J. Food Safety., 8:35-38. Lynn, T.V., Hancock, D.D., Besser, T.E., Harrison, J.H., Rice D.H., Stewart N.T., & Rowan, L.L., 1998. The occurrence and replication of Escherichia coli in cattle feeds. J. Dairy Sci., 81:1102-1108. Luna-Gierke, R.E., Griffin, P.M., Gould, L.H., Herman, K., Bopp, C. A, Strockbine, N. & Mody, R.K., 2014. Outbreaks of non-o157 Shiga toxin-producing Escherichia coli infection: USA. Epidemiol. Infect., 7:1-11. Mahale, D.P., Khade, R.G. & Vaidya, V.K., 2008. Microbiologial analysis of street vended fruit juices from Mumbai City, India. Internet J. Food Safety, 10: 31-34. Michino, H., Araki, K., MinamiI, S., Takaya, S., Sakai, N. & MiyazakiI, M., 1999. Massive outbreak of Escherichia coli O157: H7 infection in schoolchildren in Sakai City, Japan, associated with consumption of white radish sprouts. Am. J. Epidemiol., 150: 787 796. Miller, L.G. & Kaspar, C.W. 1994. Escherichia coli O157:H7 acid tolerance and survival in apple cider. J.Food Prot., 57:460-4. Mosupye, F.M. & Van-Holy, A., 2000. Microbiologial hazard identification and exposure assessment of street food vending in Johannesburg, South Africa. Int. J. Food Microbiol., 61: 137-145. Mudgil, S., Aggarwal, D. & Ganguli, A., 2004. Microbiological analysis of street vended fresh squeezed carrot and Kinnow mandarin juices in Patiala City, India. Internet J. Food Safety. 3: 1-3. Muinde, O.K. & Kuria, E., 2005. Hygienic and sanitary practices of venders of street foods in Nairobi, Kenya. AJFAND., 5: 1-13. Ohiokpehai, O., 2003. Nutritional aspect of street foods in Botswana. Pakistan J. Nutr., 2: 76-81. Riley, L.W., Remis, R.S., Helgerson, S.D., Mcgee, H.B., Wells, J.G. & Davis, B.R., 1983. Hemorrhagic colitis associated with a rare Escherichia coli serotype. N. Engl. J. Med., 308: 681 685. Sartz, L., De Jong, B., Hjertqvist, M., Plym-Forshell, L., Alsterlund, R. & Lofdahl, S., 2008. An outbreak of Escherichia coli O157:H7 infection in southern Sweden associated with consumption of fermented sausage; aspects of sausage production that increase
VOL. 60 (2) E. COLI O157: H7 FROM FRESH FRUIT JUICES 191 the risk of contamination. Epidemiol. Infect., 136: 370 380. Subbannayya, K., Bhat, G.K., Shetty, S. & Junu, V.G., 2007. How safe is sugarcane juice? Indian J. Med. Microbiol., 25:73 4. Swerdlow, D.L., Woodruff, B.A., Robert, C. Brady, R.C., Griffin, P.M., Tippen, S; Donnell, D. H., Geldreich, E., Payne, B.J., Meyer, A., Wells, J.G., Greene, K.D., Mahree Bright, M., Bean, N.H. & Blake, P. A., 1992. A waterborne outbreak in Missouri of Escherichia coli O157:H7 associated with bloody diarrhea and death. Ann. Intern. Med., 117:812-819 Sodha, S.V., Heiman, K., Gould, K.L., Bishop, R.., Iwamoto, M., Swerdlow, D. L. & Griffin, P.M., 2014. National patterns of Escherichia coli O157 infections, USA, 1996 2011. Epidemiol. Infect., 14:1-7. Tambekar, D.H., Gulhane, S.R., Jaisingkar, R.S., Wangikar, M.S., Banginwar, Y.S. & Mogarekar, M.R., 2008. House hold water management: A systematic study of bacteriological contamination between source and point of use. American-Eurasian J.Agric. Environ. Sci., 3: 241-246. Tambekar, D.H., Jaiswal, V.J., Dhanorkar, D.V., Gulhane, P.B. & Dudhane, M.N., 2009. Microbial quality of food safety of street vended fruit juices: a case study of Amravati city. Internet J. Food Safety, 10: 72-76. Tambekar, D.H., Kulkarni, R.V., Shirsat, S.D. & Bhadang, D.G., 2011. Bacteriological quality of street vended food pani puri: A case study of Amravati city (MS) India. Bioscience discovery, 2: 350-354. Vojdani J.D., Beuchat, L.R. & Tauxe, R.V., 2008. Juice associated outbreaks of human illness in the United States 1995 through 2005. J. Food. Prot., 71: 356-364. Wachsmuth, I.K., Griffin, P.M., & Wells, J.G., 1991. Escherichia coli O157:H7, a cause of hemorrhagic colitis and hemolytic uremic syndrome. Acta. Paediatr. Jpn., 33: 603 612. Willshaw, G.A., Cheasty, T., Smith, H.R., O'Brien, S.J., & Adak, G.K., 2001. Verocytotoxinproducing Escherichia coli (VTEC) O157:H7 and other VTEC from human infections in England and Wales: 1995 1998. J. Med. Microbiol., 50: 135 142. Woodward, D.L., Clark, C.G., Caldeira, R.A., Ahmed, R., & Rodgers, F.G., 2002. Verotoxigenic Escherichia coli (VTEC): a major public health threat in Canada. Can. J. Inf. Dis., 13: 321 330. Wright, K.M., Chapman, S., McGeachy, K., Humphris, S., Campbell, E., Toth, I.K. & Holden, N.J., 2013. The Endophytic Lifestyle of Escherichia coli O157:H7: Quantification and Internal Localization in Roots. Phyto., 103: 333-340. Uhlich, G.A., Sinclair, J.R., Warren, N.G., Chmielecki, W.A., & Fratamico, P., 2008. Characterization of shiga toxin-producing Escherichia coli isolates associated with two multistate food-borne outbreaks that occurred in 2006. Appl. Environ. Microbiol., 74: 1268 1272. Zhao, T., Doyle, M.P. & Besser, R.E., 1993. Fate of enterohemorrhagic Escherichia coli O157:H7 in apple cider with and without preservatives. Appl. Environ. Microbiol., 59: 2526-30.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 193-198 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Investigation of Skin Irritancy of Crude Extracts of Ricinus communis L. *MADIHA NAZIR, ZAHEER-UD-DIN KHAN & MUHAMMAD AJAIB Department of Botany, GC University Lahore, Pakistan ABSTRACT The present work was carried out to investigate the skin irritation effects of the crude extracts of leaves, roots, stem and seeds of Ricinus communis L. of family Euphorbiaceae on mammalian skin using albino Rabbit s ear. The maximum percentage yield of crude extracts of leaves in n-hexane was found 10.56, while the lowest yield of 0.045 was found in crude chloroform extract of stem. The crude extracts of other plant parts yielded different percentage values. Skin irritation was caused by all of the extracts. All crude extracts of the seed exhibited reaction within 30 minutes and reached a maximum by 4 hours, but became doubtful after 24 hours and disappeared after 48 hours. The latex of Euphorbia splendens L., used as standard showed 100% positive allergic response, as compared to the crude extracts of R. communis L. Key words: Skin irritancy, Ricinus communis L., Euphorbiaceae, Allergic response, Dermatitis INTRODUCTION Plants contain alkaloids or glycosides that have medicinal properties if used in small dose but substance like volatile oils, resins, saponins and sapogenins etc. can cause skin irritation effects (Irwin, 1992). Many chemical substances are present in large amount throughout the plant body, although amount and pattern vary from species to species (Trease & Evans, 1989). Plants naturally produce phytochemical compounds which affect the human and animal skin. In other words, plants may possess most common biological activity that produces Dermatitis or skin irritation effect (Moor et al., 1991).Contact Dermatitis is type of skin irritation effect caused by contact with vegetation such as garden flowers, weeds, sawdust. Plants and plant products may cause skin irritation of the following types, as categorized by Stoner et al. (1983): 1) Phototoxic contact dermatitis, also called sun poisoning, is a reaction of skin to UV rays of sun (Pathak et al., 1962). 2) Acute toxic contact dermatitis is caused due to contact with strong skin substances (Evans & Schmidt, 1980). 3) Allergic contact dermatitis involves inflammatory reaction (Benazra et al., 1985; Singala et al., 1985). 4) Irritant contact dermatitis or nonimmunological inflammation of skin is caused by direct contact with external factors (Fischer, 1986; Fregret, 1981). According to Pankhurst (1965), skin irritant plants include among others, spurges, poinsetias, pencil cactus, daffodils, hyacinths, buttercups, and trumpet creeper. Faisal (1995) reported the skin irritant effects of 2 species of ferns, like Adiantum venustum and Polystichum piceo-plaeaceum. The ethanol and chloroform extracts of their spores and fronds were found to be irritants; giving distinct allergic reactions. Ahmad (1995) reported the skin irritancy of Adiantum capillus-veneris. The chloroform and ethanol extracts of spores and fronds showed mild to lasting allergic response. The spores, fronds and rhizome of this fern were suspected to contain compounds like tannins, phenols, terpens and flavonoids. Povh et al. (2001) investigated the acute dermal toxicity effect of Chamomilla recutita (matricaria) flower oil on 6 rabbits, the following skin reactions were observed after dosing 5g/kg: slight redness (2 rabbits), moderate redness (4 rabbits), slight edema (2 rabbit), and moderate edema (4 rabbits). Family Euphorbiaceae is sub-cosmopolitan in its distribution, the sixth largest family amongst the Anthophyta, with 300 genera and 5000 species. Cassava, rubber plant and ornamental poinsettias are important member of this family (Singagla et al., 1985). Ricinus Communis, commonly called Castor oil, Arund or Hernoli (Ajaib et al., 2010) and is a very common plant, found growing as a weed in agriculture land as well as on waste lands. In Punjab Pakistan the stem and fruit of the plant is used in rheumatic swelling and arthritis where as seeds are used for curing scorpion sting (Zareen et al., 2013). According to local farmers, the cattle coming in contact with this plant may suffer the problem of skin contact dermatitis. Therefore, the present study will help to find out the possible effects of the plant on mammalian skin. The plant is an erect, tall shrub with large leaves and shiny surface seeds covered with thick layer of cutin (Landsteiner & Chase 1942). *Corresponding author: madihanazir444@gmail.com
194 M. NAZIR ET AL BIOLOGIA (PAKISTAN) The present work was carried out to meet the following aims and objectives: 1. The study will lead to verify the traditional knowledge about Ricinus communis L. especially on its ability to cause skin irritation in mammals. 2. The data thus obtained may be useful to the dermatologists, ethnobotanists, scientists of livestock and dairy development, agriculture, etc. Plant Material MATERIALS AND METHODS a) The leaves, stem, roots and seeds of R. communis L. were collected from botanical garden, GCU, Lahore and authenticated with the help of Flora of Pakistan. b) The milky latex of Euphorbia splendens was collected from GC University Main Campus to be for standard irritant agent. Test Organism Albino rabbits were used as test organism.750g to 1000 g Albino rabbits were purchased from the local market and were placed in animal house of GC University, Lahore. Standard green food and water was available ad libitum. Method The collected plant material was identified and deposited in Dr. Sultan Ahmad Herbarium GCU, Lahore as reference material. A voucher specimen No. GC. Herb. Bot. 872 was obtained from the Herbarium of the same University. The different parts of the plant were separated and dried under shade in the laboratory until they become dehydrated and easy to grind. Each part was ground into fine powder and passed through sieve no. 100 and preserved into amber coloured bottles. Maceration method was used to acquire crude extracts of powdered plant material, in polar and nonpolar solvents: chloroform, ethanol, n-hexane and distilled water. The percentage yield of each extract was recorded. 10 ml acetone was added in each extract to make skin application material ready and 1ml was taken into Drummond s capillary and applied on inner part of external ear of rabbit. The latex of Euphrobia splendens was used as standard. The response of irritancy on rabbit s ear was observed and was categorized following Evans & Schmidt (1980): - = No reaction ± = Doubtful reaction ++ = Slight reddening of the main vessel +++ = Intense reddening of the entire ear ++++ = Microscopically visible hyperplasia RESULTS AND DISCUSSION Root extract showed highest percentage yield in n-hexane, i.e.10.56. While stem extract showed lowest percentage yield in chloroform, i.e. 0.045. All other crude extract showed intermediate value (Table I). All the extracts showed skin irritancy, although in different pattern (Tables II-V). Table I: Percentage yield of various parts of R. communis L. Solvent Leaves Roots Stem Seeds n-hexane 0.605 10.56 0.325 0.34 Chloroform 0.619 0.4 0.045 0.91 Alcohol 1.7 0.77 0.1 0.32 Distilled water 2.3 2.25 0.51 0.89
VOL. 60 (2) SKIN IRRITANCY OF CRUDE EXTRACTS OF RICINUS COMMUNIS 195 Table II: Skin irritation effect of crude extract of leaves Extract Response after short time Long time 30min 1h 1/1/2h 2h 2/1/2h 3h 3/1/2h 4h 24h 48h n-hexane + + ++ ++ + ± Chloroform + + ++ ++ ± ± Alcohol ± + + ++ ± _ Distilled water ± ± + ++ ± _ Table III: Skin irritation effect of crude extract of roots Extract Response after short time Long time 30min 1h 1/1/2h 2h 2/1/2h 3h 3/1/2h 4h 24h 48h n-hexane + ++ ++ ++ ++ ± ± _ Chloroform + ++ ++ ++ ++ ± Alcohol + ++ ++ ++ ++ ± ± _ Distilled water + ++ ++ ++ ++ ± Table IV: Skin irritation effect of crude extract of stem Extract Response after short time Long time 30min 1h 1/1/2h 2h 2/1/2h 3h 3/1/2h 4h 24h 48h n-hexane ± ± ± + + + + + Chloroform ± ± ± + + + + + Alcohol _ ± ± ± + + + + Distilled water _ ± ± ± + + + +
196 M. NAZIR ET AL BIOLOGIA (PAKISTAN) Table V: Skin irritation effect of crude extract of seeds of R. communis L. Extract Response after short time Long time 30min 1h 1/1/2h 2h 2/1/2h 3h 3/1/2h 4h 24h 48h n-hexane + ++ ++ ++ ++ ++ ++ ++ + _ Chloroform + ++ ++ ++ ++ ++ ++ ++ + _ Alcohol + ++ ++ ++ ++ ++ ++ ++ + _ Distilled water + ++ ++ ++ ++ ++ ++ ++ + _ As n-hexane is a non-polar solvent hence, non-polar compounds such as essential oils, simple fatty acids, terpenoids, waxes and related compounds, steroidal compounds and saturated hydrocarbons of plant material were present in the extract. Chloroform, having an intermediate polarity, and hence, compounds of plant material extracted with intermediate polarity, such as simple terpenes with side chain, simple alkaloids, simple tannins, simple resinous compounds, etc. Ethanol and water being polar solvents and the plant material extracted are mainly compounds of highly polar nature, possibly the complex alkaloids, complex resins, complex terpenoids, flavonoids, tannins and poly phenols, etc. (Tiwari et al., 2011). Leaves and Roots extracts in n-hexane and chloroform showed positive alergic response and resulted in marked reddening of the ear. It can be concluded that leaves and roots of this plant may have non polar compounds, such as essential oils, simple fatty acids, terpenoids, waxes, steroidal compounds and saturated hydrocarbons. These compounds being non-polar can cause skin irritation as believed by Irwin (1992). Stem showed very mild response in chloroform and n-hexane solvent. Its mean that stem of R. communis may have small quantity of irritant compounds or the compounds thus isolated may show mild skin irritation. A comparison with negative control and skin irritation produced by stem is given in Fig., 1 & 2. Fig. 1. Negative control Fig., 2: Skin irritancy response of stem of R. communis L. Seeds were found to be the most irritant part of R. communis, as it s all extracts showed skin irritation effect. The seeds may have the polar, nonpolar or compounds with intermediate polarity which may have caused skin irritation with reddening of the whole ear. According to the present investigation, R. communis causes skin irritation effect due to
VOL. 60 (2) SKIN IRRITANCY OF CRUDE EXTRACTS OF RICINUS COMMUNIS 197 presence of secondary metabolites, a finding which is comparable with the results of Rook et al., (1979), who found out that many plant species produce secondary metabolites which cause skin irritation effect. Thomson & Wilkinson (2000) investigated dermatotoxicity effect of ethanol extract of the root part of Plumbago zeylanica in animals. In the present work, ethanol extract of all the four parts of R. communis showed skin irritancy on rabbit skin, a finding in accordance with the Thomson & Wilkinson (2000) study. REFERENCES Ahmed, W., 1995. Morpho-palynological studies of certain ferns of Murree. M.Sc. unpublished Thesis. Punjab University, Lahore. Ajaib, M., Khan, Z., Khan, N. & Wahab, M., 2010. Ethnobotanical Studies on useful Shrubs of District Kotli, Azad Jammu & Kashmir, Pakistan. Pak. J. Bot., 42(3): 1407-1415. Benazra, C., Sigman, C.C., Perry, L.R., Helmes, C.T. & Maibach, H. I., 1985. A systematic search for structure activity relationship of skin sensitizers methodology. J. Invest. Dermatol., 85: 351-356. Evans, F.J. & Schmidt, R.J., 1980. Plants and plant products that induce contact dermatitis. A Review. Planta Medica, 38: 289-316. Faisal, A., 1995. Morpho-palynological studies of some ferns of Dunga Gali and its adjoining areas. M. Sc. Unpublished thesis, Punjab Univ., Lahore. Fisher, A.A., 1986. Contact Dermatitis. 3 rd ed. Lea and Fibiger, Philadelpha USA. Fregret, S., 1981. Manual of Contact Dermatitis, 2 nd ed, Year book Medical Publisher, Chicago, USA. Irwin, R., 1992. Toxicity studies of Castor Oil. U. S. Department of Health and Human Services. Public Health Service. National Institute of Health. U.S. Landsteiner, K. & Chase, M.W., 1942. Experiment on transfer of cutaneous sensitivity to simple compounds. Proc. Soc. Exp. Biol. Med., 49:688-699. Moor, P.O., Webb, J.A. & Collinson, M.E., 1991. Pollen Analysis. 2 nd ed. Blackwell Scientific Publication, 1-9 pp. Pankhurst, R., 1965. An historical examination of traditional Ethiopia medicine and surgery.ethiop. Med. J., 3: 157-172. Pathak, M.A., Daniels, F. & Fitzpatrick, T.B., 1962. The presently known distribution of furocoumarians (psoralens) in plants. J. Investigative Dermatol., 39 : 321-328. Povh, N.P., Garcia, C.A., Marques, M.O. & Meireles, M.A., 2001. Extraction of essential oil and oleoresin from chamomile (Chamomila recutita) by steam distillation and extraction with organic solvents: a process design approach. Braz. J. Med. Biol. Res., 4(1):1-8. Rook, B., Wilkinson, D.S & Ebling, F.G.M. 1979. Text book of Dermatplogy. Edition. Black Well Scientific Publication, Oxford, Lagore, PP: 47-52. Singagla, F., Scheideger, D., Garotta, G., Scheper, R., Pletscher, M. & Lanzavecchia, A., 1985. Isolation and characterization of M- specific T- cell clones from patients with Ni-contact dermatitis. J. Immunol., 135: 3929-42. Stoner, J.G., Rasmussen, J.E. & Arbor, A.M.J., 1983. Plant Dermatitis. J. Am. Acad. Dermatol., 9: 1-5. Thomson, K.F. & Wilkinson, S.M., 2000. Allergic contact dermatitis to plant extracts in patients with cosmetic dermatitis. Br. J. Derm., 142:84-88. Tiwari, P., Kumar, B. Kaur, G & Kaur, H., 2011. Phytochemical screening and Extraction: As review. Int, Pharm. Sci., 1(1): 98-106. Trease, G.E. & Evans, W.E., 1989. Pharmacagnosy, 13 th ed. Ballier Tinder, London, U.K. PP: 1-4. Zareen, A., Khan, Z. & Ajaib, M., 2013. Ethnobotanical evaluation of the shrubs of Central Punjab, Pakistan. Biologia (Pakistan), 59(1): 139-147.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 199-203 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Fruit Extract of Syzygium cumini Cures Toxic Effects of Fluoride on Erythrocytes and Femur Bone in Male Mice * KHAWAJA RAEES AHMAD 1, SHAMSA JABEEN 1, KAUSAR RAEES 2, SHAZIA NOOR 1, TOOBA NAUROZE 1, TAHIR ABBAS 3 & MUHAMMAD ALI KANWAL 1 1 Department of Biological Sciences, University of Sargodha, Sargodha, Pakistan 2 Government College for Women, Farooq Colony, Sargodha, Pakistan 3 Department of Biology, Government College, Kot-Moman, Sargodha, Pakistan ABSTRACT Rescuing potentials of jambul (Syzygium cumini; old name: Eugenia jambolana) fruit pulp extract (JFPE) on erythrocytes count and various morphometric parameters of femur bone against sodium fluoride (NaF) exposure were investigated. Forty Swiss Webster albino male mice (Mus musculus) were distributed equally in 4 groups: control; NaF; Jambul and NaF+jambul. Control and jambul groups were given F (fluoride) free water (15 days). F-ions (50ppm) from NaF in drinking water were given to NaF and NaF+jambul groups for 10 days and F free water for next 5 days. Animals in jambul and NaF+jambul groups also received 0.25mL JFPE (twice daily) on days 11-15. Anatomically considerable fluorosis of the femur on F exposure was noted. Moreover significantly (P<0.05) higher femur density (mg/ml) was noted in NaF (259.4±0.025) than control (174.53±0.01), jambul (199.48±0.013) and NaF+jambul (179.3±0.014) groups. The other parameters (i.e. Femur weight before and after de-mineralization, shaft length and diameters of femur shaft and head) showed significant (p<0.05) decrease in NaF than that of the control group. Moreover a significant (p<0.05) decline in erythrocyte count (EC) (Millions/mm 3 ) in NaF (4.072±0.094) than control (5.358±0.08), jambul (5.428±0.084) and NaF+jambul (4.794±0.16) groups was noted. The findings show that post treatment with jambul pulp extract for 5 days have shown retrieval capacities upon the debilitating effects of F exposure in bone parameters and EC. Based upon these results it can be concluded that JFPE possesses superb curative potentials for toxic effects of F on EC and bone parameters of adult male mice. Key words: Erythrocyte count, Femur, Fluoride, Syzygium cumini (jambul) INTRODUCTION Despite its potential benefits in bone development in terms of increased mineralization and simultaneously decreased resorption, F exposure has been held responsible for various toxicological manifestations (Grynpas & Cheng, 1988; Palmer & Wolfe, 2005). These include hematological damage, endochondral ossification causing mineralization of cartilage, osteomalacia and diminished bone strength in-spite-of increased bone density (Søgaard et al., 1995; Turner et al., 1996; Inoue et al., 2006; Agalakova & Gusev, 2011; Ahmad et al., 2012; Nabavi et al., 2013). Jambul fruit has been found to contain high levels of anthocyanins, flavonoids, phenolics, carotenoids and vitamins that help in free radical scavenging activity thereby diminishing degenerative changes and macromolecular oxidation (Kubola et al., 2011; Chaudhary & Mukhopadhyay, 2012). Jambul fruit pulp has been found to significantly improve the hemoglobin contents and erythrocyte count as compared to the control animals (Lohar et al., 2009). Moreover, jambul extract has also been shown to cause significant reduction of abnormal sperm production (Tripathi et al., 2013). Additionally, some preclinical trials have also indicated the chemopreventive and radioprotective properties of jambul (Swami et al., 2012). In present study, we are reporting the F exposure effects upon the osteo-hematological parameters in relation to the corrective potentials of JFPE. Chemicals MATERIALS AND METHODS All chemicals used in the animal treatment (NaF), and laboratory preparations (ethanol, EDTA, glacial acetic acid, formaldehyde, wax and Canada balsam) and the stains (hematoxylin and eosin) used in this study were of the analytical (lab) grade. Jambul (Syzygium cumini) Fruit-pulp Extract Fully ripen jambul berries were used to get pulp extract. The washed dried fruits were thoroughly shaken to soften up the pulp and separation of seeds in wide mouthed lidded glass jar. Fresh pulp (100g) thus obtained was thoroughly mixed in 100 ml of drinking water for 5 min in chopper blender. The thick juicy mass obtained was centrifuged at 500 rpm for 10-15 minutes for *Corresponding author: kraees@uos.edu.pk
200 K. R. AHMAD ET AL BIOLOGIA (PAKISTAN) separation of dark violet supernatant from the insoluble fibrous material. The supernatant was stored at 30ºC in sterilized 1.5mL eppendorf tubes for animal consumption during experiments. Animals Forty (3 4 months old) male (Swiss Webster) mice weighing 30±2g, were used in this study. The ambient housing conditions were maintained at 12 hrs dark-light cycles, 50% humidity and 23±2ºC temperature. Standard laboratory mouse feed and Fluoride free water were provided ad libitum. The animals were distributed equally in four groups as follows: Control: The animals in this group were maintained on F free water (Kush Aab a certified product of University of Sargodha) for all 15 days of the study. NaF: Animals in this group were given 50 ppm F- ions in drinking water for first 10 days and F free water for last 5 days. Jambul: The animals in this group were fed on F free water for all 15 days however 0.25ml of JFPE was given to them by gavage after every 12-hr intervals, for the last 5 days. NaF-jambul: These animals were provided 50ppm F-ions in drinking water for first 10 days followed by F-free water and JFPE in last 5 days as mentioned in jambul group above. Animals from all groups were euthanized through cervical dislocation to obtain femur bones and ventricular blood for erythrocyte count Femur, Treatment and Measurements Femurs were obtained intact (without any scraping or damage) from euthanized animal after removing skin and muscles. The bones were placed in a solution containing 70% ethanol and 0.5% KOH for 45 days to remove any remaining soft tissues (fleshy, tendonous and ligamentous materials). These were then immersed in acetone for 10 days to remove marrowfats. For decalcification each bone was placed separately in 5% aqueous EDTA solution in a 25ml air tight glass vial until the morphology of bone was completely lost and what remained behind was an aggregation of soft fibrous material. Both femurs from each animal were subjected to the measurements of volume, length and diameters (prior to decalcification) and dry weights (prior and after decalcification). The mean value of both femurs of each animal, for the above parameters, was considered as unit data value. Appropriate instruments like 0.001g precision digital balance (Sartorius-TE214S), Varnier calipers (1/20mm precision) and screw gauge were used for the measurement of femur weight, length and diameter respectively. Liquid displacement method was used for volumetric measurements for this purpose, an instrument consisting of 1/100ml graduated glass pipette designed in our lab was used. Total Erythrocyte Count For erythrocytes count, blood from each animal was obtained directly from the right ventricle just after cervical dislocation in 3ml heparin treated plastic syringe. Following standard laboratory procedure, the erythrocytes were counted from the digital photomicrographs of the Neubauer haemocytometer containing blood samples. Statistical Analysis All data obtained were subjected to obtain group mean values ± Standard Error of the Means. For various parameters the data obtained were also analyzed with standard statistical methods of (one way) ANOVA and the Duncan s multiple range test to obtain the significance of variations among the groups using SPSS software. Erythrocyte Count RESULTS Statistical analysis (ANOVA) had shown highly significant variation among the groups (p<0.001). While the post hoc analysis revealed significant (p<0.05) variation between NaF and NaF+jambul groups moreover these two groups also differed significantly with control and jambul groups (Table 1).
VOL. 60 (2) JAMBUL FRUIT CURES ERYTHROCYTE AND BONE TOXICITY OF FLUORIDE 201 Table I: Erythrocyte count and various morphometric parameters of the femur bone in control; NaF; Jambul and Naf+Jambul groups Parameter Groups: Means±SEM Control NaF Jambul NaF+Jambul Erythrocyte Count (Million/mm 3 ) 5.358±0.08 4.072±0.094 * 5.428±0.084 4.794±0.16 Weight (mg) of Femur (before decalcification) weight (mg) of Femur (after decalcification) 46.1±0.0017 * 39.49±0.0035 50.33±0.0031 * 11.39±0.0002 * 8.56±0.0008 13.61±0.0015 * 38.46±0.002 4 10.04±0.0012 Femur density (mg/ml) 174.53±0.01 259.4±0.025 * 199.48±0.013 179.3±0.014 Total length of femur (mm) 14.86±0.127 * 14.13±0.317 14.96±0.243 * 14.54±0.179 * Femur shaft diameter (mm) 2.78±0.111 2.47±0.074 * 2.86±0.102 2.68±0.052 Width of the femur head (mm) 1.44±0.0239 1.31±0.0539 * 1.48±0.0703 1.53±0.0436 * Any two groups not sharing a common symbol from this set differ significantly (p 0.05) from each other Femur Anatomy Perfect anatomical features of the femur were observed in control group animals; that include length, width and whitish color (indicating good ossification). The size and position of the third trochanter were also ideal. Similar features were observed in jambul group mice. The yellow coloration seen in the lower half of the femurs in NaF and NaF+jambul groups indicate fluorosis. However, the highest degree of fluorosis was seen in NaF group animals (Fig., 1). analysis also revealed significant difference (p<0.05) of control and jambul groups to that of the NaF and NaF+jambul groups (Table I). Weight of Femur (after decalcification) Statistical analysis had shown significant variation among the groups (p<0.05). Post hoc analysis revealed significant (p<0.05) variation between NaF and jambul groups while NaF and jambul groups also showed significant variation respectively with control and NaF+jambul groups (Table I). Femur Density Overall significant variations were found in the data pertaining femur density (p<0.05). Also post hoc analysis revealed significant difference (p<0.05) of the NaF to that of the control jambul and NaF+jambul groups (Table I). Fig., 1: General anatomy of femur bones in various groups A: Control; B: NaF; C: Jambul; D: NaF+ jambul groups - a: Head of femur; b: third trochanter; d1: ideal ossification; d2: brown yellow coloration indicate fluorosis Weight of Femur (before decalcification) Statistical analysis had shown significant variation among the groups (P<0.05). Post-hoc Total Length of Femur Statistical analysis had shown no significant variation among the groups. On the other hand post hoc analysis indicated significant (p<0.05) difference of NaF to that of jambul and control groups while NaF+jambul did not differ significantly from any other group (Table I). Femur Shaft Diameter Overall significant variations were found in the data pertaining femur shaft diameter (p<0.05). Also post hoc analysis revealed significant difference (p< 0.05) of the NaF to that of control, jambul and NaF+jambul groups (Table I).
202 K. R. AHMAD ET AL BIOLOGIA (PAKISTAN) Diameter of the Femur Head Overall significant variations were found in the data pertaining diameter of head of the femur (p<0.05). Also post hoc analysis revealed significant difference (p< 0.05) of the NaF to that of control, jambul and NaF+jambul groups (Table I). DISCUSSION Fluoride has long been related with bone health and fluorosis (Palmer & Wolfe, 2005; Turner et al., 1996; Søgaard et al., 1995; Waddington & Langley, 1998; Mousny et al., 2008; Shim et al., 2011). The results obtained in this research work show significant alterations in various parameters of the femur bone. As reported earlier, our finding of significant increase in bone density clearly indicated a general rise in compactness of bone on F exposure (Inoue et al., 2006; Søgaard et al., 1995; Shim et al., 2011). On the other hand, the simultaneous decline in femur weight indicates an F exposure related net significant loss of hydroxyapatite. Moreover, the significant decline in the non-mineral dry mass component of femur on F exposure indicate a decrease in the organic architecture that mainly consists of glycosaminoglycan chains and cellular components (Waddington & Langley, 1998). It is well documented that F affects the structural integrity of bone through its gradual incorporation in the mineralized part transforming hydroxyapatite crystals into hydroxyfluorapatite (Palmer & Wolfe, 2005; Inoue et al., 2006). Furthermore, NaF exposure has been linked with the production of reactive oxygen species causing apoptosis in mouse embryonic stem cells (Nguyen et al., 2012). Thus, increase in ROS production on F absorption in femurs must have caused the loss of organic components. As necrosis is always linked with the release of hydrolytic enzymes, this consequential F related death of osteocytes seem to be responsible for the loss of mineralized bone component (Zhang et al., 2013). In the same context, significantly decreased lowered mean femur length and diameter recorded in NaF than control group provide supplementary indications to our understanding that F exposure has caused a general loss in femur bone components. The significant decrease in femur head diameter on F treatment may be a partial outcome of the rapid loss of head cartilage and its simultaneous gradual mineralization (Inoue et al., 2006). Our finding of significant decline in erythrocytes count on F exposure seems to be justifiable based upon the recent claims where F has been found to induce death of rat erythrocytes in vitro (Agalakova & Gusev, 2011). Moreover, in a recent in vivo study, exposure to NaF (600ppm) in drinking water for 7 day was found to cause significant increase in lipid peroxidation and highly significant depletion of reduced glutathione with many folds depressed activity of antioxidant enzymes (superoxide dismutase and catalase) in erythrocytes (Nabavi et al., 2013). Thus, it is proposed that the increased simultaneous oxidative stress and lipid peroxidation must have caused apoptosis leading to a significant decline in erythrocyte count. While erythrocyte count has shown significant improvement, all the injurious effects of F exposure were found reclaimed except the mineralized weight of the femur on JFPE post treatment indicating its reclamation potential for osteological and hematological losses of F. Conclusion Our findings indicate that F exposure at 50ppm or more for 10 days can cause a significant decline in erythrocyte count in male mice. Furthermore, with a simultaneous increase in density, this exposure leads to a significant decrease in the organic matrix and mineralized components of the major weight bearing bone (the femur). However, these deleterious inflictions of F exposure were convincingly cured on post treatment of JFPE- indicating its medicinal potential. REFERENCES Agalakova, N.I. & Gusev, G.P., 2011. Fluorideinduced death of rat erythrocytes in vitro. Toxicol. In Vitro, 25: 1609-18. Ahmad, K.R., Nauroze, T., Raees, K., Abbas, T., Kanwal, M. A., Noor, S. & Jabeen, S., 2012. Protective role of jambul (Syzygium cumini) fruit-pulp extract against fluoride-induced toxicity in mice testis: a histopathological study. Fluoride, 45: 281-289. Chaudhary, B. & Mukhopadhyay, K., 2012. Syzygium cumini (L.) Skeels: a potential source of nutraceuticals. Int. J. Pharm. Biol. Sci., 2: 46-53. Grynpas, M.D. & Cheng P.T. 1988. Fluoride reduces the rate of dissolution of bone. Bone Miner., 5: 1-9. Inoue, M., Legeros, R.Z., Inoue, M., Rivera, R.S., Sathi, G.A., Tsujigiwa, H., Nagatsuka H., Akita, M. & Setsu, K., 2006. Fluoride supplement affects bone mineralization in young rats. J. Hard Tissue Biol., 15: 61-4.
VOL. 60 (2) JAMBUL FRUIT CURES ERYTHROCYTE AND BONE TOXICITY OF FLUORIDE 203 Kubola, J., Siriamornpun, S. & Meeso, N., 2011. Phytochemicals, vitamin C and sugar content of Thai wild fruits. Food Chem.,126: 972-81. Lohar, P.S., Lohar, M.S. & Roychoudhury, S., 2009. Erythropoitic effects of some medicinal plants of india on experimental rat model. Slovak J. Anim. Sci., 42(2): 95 98 Mousny, M., Omelon, S., Wise, L., Everett, E.T., Dumitriu, M., Holmyard, D. P., Banse, X., Devogelaer, J.P. & Grynpas, M.D., 2008. Fluoride effects on bone formation and mineralization are influenced by genetics. Bone, 43: 1067-74. Nabavi, S.M., Habtemariam, S., Nabavi, S.F., Moghaddam, A.H. & Latifi, A.M., 2013. Prophylactic effects of methyl-3-o-methyl gallate against sodium fluoride-induced oxidative stress in erythrocytes in vivo. J. Pharm. Pharmacol., 65: 868-73. Nguyen-Ngoc, T.D., Son, Y.O., Lim, S.S., Shi, X., Kim, J.G., Heo, J.S., Choe, Y., Jeon, Y.M. & Lee, J.C., 2012. Sodium fluoride induces apoptosis in mouse embryonic stem cells through ROS-dependent and caspase- and JNK-mediated pathways. Toxicol. Appl. Pharmacol., 259: 329-37. Palmer, C. & Wolfe, S.H., 2005. Position of the American Dietetic Association: impact of fluoride on health. J. Am. Diet. Assoc., 105: 1620-8. Shim, M.Y., Parr, C. & Pesti, G.M., 2011. The effects of dietary fluoride on growth and bone mineralization in broiler chicks. Poult. Sci., 90: 1967-74. Søgaard, C.H., Mosekilde, L., Schwartz, W., Leidig, G., Minne, H.M. & Ziegler R., 1995. Effects of fluoride on rat vertebral body biomechanical competence and bone mass. Bone, 16: 163-9. Swami, S.B., Thakor, N.S.J., Patil, M.M. & Haldankar, P.M., 2012. Jamun (Syzygium cumini (L.)): a review of its food and medicinal uses. Food. Nutr. Sci., 3: 1100-17. Tripathi, P., Patel, R.K., Tripathi, R. & Kanzariya, N. R., 2013. Investigation of antigenotoxic potential of Syzygium cumini extract (SCE) on cyclophosphamide-induced genotoxicity and oxidative stress in mice. Drug Chem. Toxicol., 36: 396-402. Turner, C.H., Owan, I., Brizendine, E.J., Zhang, W., Wilson, M.E. & Dunipace A.J., 1996. High fluoride intakes cause osteomalacia and diminished bone strength in rats with renal deficiency. Bone, 19: 595-601. Waddington, R.J. & Langley, M.S., 1998. Structural analysis of proteoglycans synthesized by mineralizing bone cells in vitro in the presence of fluoride. Matrix Biol., 17: 255-68. Zhang, J.K., Yang, L., Meng, G.L., Yuan, Z., Fan, J., Li, D., Chen, J.J.Z., Shi, T.Y., Hu H.M., Wei, B-Y., Luo, Z.J. & Liu J., 2013. Protection by salidroside against bone loss via inhibition of oxidative stress and boneresorbing mediators. PLoS ONE, 8: e57251.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 205-209 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Salt Stress Alleviation with Salicylic Acid on the Yield of Maize (Zea mays L. cultivar NMH-909) * SYED TARIQ RIZWAN 1, MADEHA MAZHAR 1, MUHAMMAD UMAR HAYYAT 2, TANZEEM AKBAR CHEEMA 1 & RASHID MAHMOOD 2 1 Department of Botany, GC University, Lahore, Pakistan 2 Sustainable Development Study Centre, GC University, Lahore, Pakistan ABSTRACT The present study was conducted to determine the effects of salicylic acid on the yield of salt stressed Zea mays L. cultivar NMH-909 plants. The application of salicylic acid was done as foliar spray, 40 days after sowing at the vegetative stage of maize plants. The effect of salicylic acid was observed at four different levels of salinity viz. control, 4dSm -1, 8dSm -1 and 12dSm -1.The application of salicylic acid was found effective in the amelioration of detrimental effects of salt stress on maize plants. The plants with applied salicylic acid showed much better yield in comparison to those plants which were not treated with salicylic acid. Under non-saline conditions, salicylic acid application in 150 ppm concentration was the most effective. In saline conditions, the improvement increased with the increase in the salicylic acid concentration and 150ppm salicylic acid gave best results, proving to be the most effective concentration in mitigating the harmful effects of salinity on maize plants. The use of salicylic acid can considerably improve the yield parameters of Zea mays L. cultivar NMH-909, and hence it can be implicated to alleviate adverse effects of salinity on maize plants. From the present study, it is inferred that the exogenous application of 150ppm salicylic acid is very useful to control detrimental effects of salinity. Key words: exogenous, corn, cob, grains, salicylic acid, salinity. INTRODUCTION Soil salinity is a serious problem of agriculture, especially in those countries located in semi-arid to arid zones (Croughan & Rains, 1982). In Pakistan, the saline area is 6.67 M ha out of the total 20 M ha land under cultivation (Khan et al., 2006). Salt stress is one of the most devastating conditions for crop growth and productivity (Ashraf et al., 2008). The processes that are affected by high salt concentrations include toxicity of ions, osmotic stress, minerals and nutrient deficiency and above all oxidative stress (Flower, 2004). Many studies conducted in this field have shown that the height (Rui et al., 2009), leaf area (Zhao et al., 2007) and index of growth (Bandeh-Hagh et al., 2008) are harmfully effected with increasing levels of salt. Salinity stress may also lead to other secondary stresses, such as oxidative stress that is caused from the build up of reactive oxygen species (ROS) (Molassiotis et al., 2006, Panda & Upadhyay, 2004). Plants under stress conditions also evolve different responses to abate the detrimental effects of ROS. Plants have to adapt an explicit protective mechanism, such as production of non-enzymatic (salicylic acid, ascorbic acid, carotenoids, α- tocopherol, etc.) and/or enzymatic (peroxidase, superoxide dismutase and catalase) antioxidants to minimize the damage set off by ROS (Ashraf, 2009). Salicylic acid performs role as an antioxidant and a growth regulator in modulating various physiological processes including photosynthetic rate (Singh & Usha, 2003). Maize (Zea mays L.) occupies third position as themost important cereal crop after wheat and rice. In many countries around the world, it is used as staple food (Frova et al., 1999). It is cultivated twice a year in both spring and autumn seasons. Among different types of cereal crops, maize has a key position because of its importance for consumption by humans and animals. It serves as a chief source of income to the farmers of developing countries (Tagne et al., 2008). In Pakistan, owing to its growing importance, various strategies for the improvement of agronomic characters of maize are receiving significant attention (Mehdi & Ahsan, 2000). The present study was intended to determine the effect of different levels of salinity on the yield of Zea mays L. and to evaluate the mitigating effect of different treatments of salicylic acid on the yield of Zea mays L. *Corresponding author: tariq_rizwan2002@yahoo.com
206 S. T. RIZWAN ET AL BIOLOGIA (PAKISTAN) MATERIALS AND METHODS The experiment for determining the effects of salicylic acid on Zea mays L. grown under different concentrations of salinity was conducted in the Botanic Garden, Government College University, Lahore. This experiment was performed in a wire netting enclosure in which biotic factors were controlled. Certified seeds of Zea mays L. cultivar NMH-909 were collected from the Federal Seed Certification Department, Lahore. The healthy seeds were selected on the basis of evenness of size. The pots having a diameter of 35cm were used in the experimental set-up. The pots were thoroughly cleaned. For closing the holes at the bottom of the pots, pebbles were used and lining of the pots was done with polythene bags for preventing excessive water loss through drainage. Filling of pots was done with 10 kg soil taken from GCUBotanic Garden. Treatment and replicate number were labelled on each pot. In this experiment, the salinity levels 4dSm -1,8dSm -1 and 12dSm -1 were used with control and these levels of salinity were made by adding the required NaCl amount in the soil. The different treatments of salicylic acid were 0ppm (0.1% Tween-20), 50ppm, 100ppm and 150ppm (Table 1). Salicylic acid solutions of different concentrations were applied to the plants in the form of foliar spray when they were at their vegetative stage. In order to ensure salicylic acid penetration into the leaf tissues, solution of 0.1% Tween-20 was used that acted as a surfactant. A manual sprayed was used for spraying 5ml volume of solution per plant. Table 1: Preparation of different concentrations of salinity and salicylic acid (SA) for use in the experiment Salinity (T) Salicylic Acid (SA) Control 4dSm -1 8dSm -1 12dSm -1 Control T 0 T 1 T 2 T 3 SA 0 Tween-20 (0.1%) T 0 SA 0 T 1 SA 0 T 2 SA 0 T 3 SA 0 SA 1 (50ppm) T 0 SA 1 T 1 SA 1 T 2 SA 1 T 3 SA 1 SA 2 (100ppm) T 0 SA 2 T 1 SA 2 T 2 SA 2 T 3 SA 2 SA 3 (150ppm) T 0 SA 3 T 1 SA 3 T 2 SA 3 T 3 SA 3 On complete maturation of plants, harvest was carried out. The harvested plants were placed in labelled plastic bags. For conducting further studies, these plants were taken to the Physiology Laboratory and the parameters studied were: cob length (cm); seeds number per plant; seeds weight per plant (g) and 1000 seeds weight (g). Statistical analysis was carried out by using software co-stat version 3.03 (Steel & Torrie, 1980). RESULTS AND DISCUSSION The harvest was carried out when life cycle of maize plants was completed for the evaluation of their yield. Length of Cob Figure 1 illustrated the effects of salinity and salicylic acid on the length of cob. Salicylic acid treatments proved beneficial to the length of cob in all salinity levels. Length of cob in control without salinity was 26.55cm and with salicylic acid treatment, the cob length was 29.40cm which showed 10.73% increase with 150ppm salicylic acid. Reduction in length of cob was gradual with the increase in salinity. The reduction in length was 9.23% at 4dSm -1 and 12.42% at 8dSm -1. 23.54% reduction was observed at 12dSm -1. Application of 150ppm salicylic acid increased length of cob to 12.24% and 14.84% at 4dSm -1 and 8dSm -1
VOL. 60 (2) SALT STRESS ALLEVIATION WITH SALICYLIC ACID ON MAIZE 207 respectively. 150ppm salicylic acid was also very effective in plants under 12dSm -1 salinity conditions. and best results were obtained with the use of 150ppm salicylic acid. Similar observations were noted by Khan et al. (2010) that decline in the number of seeds was induced by salinity in mungbean and this decrease was overcome by the use of salicylic acid. Arfan et al. (2007) observed similar result that the yield of wheat was increased with the foliar application of salicylic acid. Fig., 1: Effect of different concentrations of salinity and salicylic acid on cob length in Zea mays L. plants Number of Grains per Plant The combined effects of salinity and salicylic acid on grain number per plant are represented in Figure 2. Plants from non-saline conditions had maximum number of grains. Maximum increase in grain number was shown by plants which were treated with 150ppm salicylic acid. Fig., 3: Effect of different concentrations of salinity and salicylic acid on grains weight per plant in Zea mays L. Weight of Grains per Plant Figure 3 illustrates the effects of salinity and salicylic acid on grains weight per plant that signify the yield potential of plants and their success. Under control conditions with no salinity, weight of the grains recorded was exceptional and it was increased with the foliar application of salicylic acid. Fig., 2: Effect of different concentrations of salinity and salicylic acid on grains number per plant in Zea mays L. Salt stress caused substantial decrease in number of grains per plant in comparison with the control. The reduction in number of grains was 27.84%, 42.75% and 52.94% at 4dSm -1, 8dSm -1 and 12dSm -1 salinity respectively. Application of salicylic acid resulted in the increase in number of grains Fig., 4: Effect of different concentrations of salinity and salicylic acid on 1000 grains weight in Zea mays L. plants Salinity greatly caused reduction in the weight of maize grains per plant but salicylic acid
208 S. T. RIZWAN ET AL BIOLOGIA (PAKISTAN) thwarted this decrease to some extent. Weight reduction of grains was 29.43%, 51.77% and 59.35% at 4dSm -1, 8dSm -1 and 12dSm -1 salinity respectively. Adverse effects of salt stress were vanquished by foliar application of salicylic acid to some level. At all levels of salinity, 150ppm salicylic acid application showed to be the best in the alleviation of detrimental effects of salinity stress and caused improvement in the grains weight per plant. Weight of 1000 Grains The interactive effect of different levels of salts and salicylic acid on 1000 grains weight is shown in Figure 4. Exogenous application of salicylic acid significantly caused improvement in this parameter in both saline and non-saline conditions. 150ppm salicylic acid showed maximum improvement in weight of 1000 grains at all the salinity treatments. In non-saline condition, the increase in 1000 grains weight with 150ppm salicylic acid was 22.15% followed by 15.23% and 6.99% increase with 100ppm and 50ppm salicylic acid respectively. Salt stress conditions decreased the 1000 grains weight which was counteracted by the application of salicylic acid exogenously. The reduction in weight of 1000 grains was up to 6.19%, 12.77% and 13.63% at 4dSm -1, 8dSm -1 and 12dSm -1 salinity respectively. The application of 150ppm salicylic acid exhibited the best results. 150ppm salicylic acid improved weight up to 23.90% at 8dSm -1. Same concentration of salicylic acid increased weight up to 22.45% at 12dSm -1. These results relate with the findings of Sahu et al. (1993) in which application of ascorbic acid improved yield of maize grains to 26.30%. Yield of plants is actually final manifestation of photosynthetic process and growth. Khan et al. (2010) also reported increase in yield of mungbean plants that was negatively affected by salt stress. Salicylic acid had positive impact on these plants because of its effects on ion content, nutrients, glutathione content and antioxidant enzyme activities. Salicylic acid induced increase in growth promotes yield of crops since salinity stress conditions limit growth of plants by negatively affecting different biochemical and physiological processes which include photosynthetic process, balance of ions and antioxidant capacity (Ashraf, 2004). It was reported by El-Tayeb (2005) that the increase in growth of plants induced by salicylic acid could be due to increased antioxidant activity that provides protection to plants from damage by ROS. Therefore, salicylic acid might cause enhancement of photosynthetic process which is the main control factor in growth and productivity of crops (Natr & Lawlor, 2005). Gunes et al. (2007) and Arfan et al. (2007) reported similar results in their experiments about the alleviating effects of salinity by using salicylic acid in maize and wheat plants respectively. However, Maqsood et al. (2008) observed that salinity substantially affected weight of 1000 grains in maize. The highest yield had been observed in the treatments of T 0 SA 3, T 1 SA 3, T 2 SA 3 andt 3 SA 3 as compared to other treatments in the respective group. Conclusion The present study revealed that salt stress conditions badly affected the yield of Zea mays L. cv. NMH-909. However, the exogenous application of salicylic acid promoted all the yield attributes to a considerable extent. Cob length, number and weight of grains were increased as a result of salicylic acid application. At all levels of salinity improvement was observed by treatment of salicylic acid. Moreover, effectiveness increased with the increasing the concentration of salicylic acid. Hence, it can be inferred that exogenous application of salicylic acid can serve as a useful approach for increasing salt tolerance and improving the productivity of maize. REFERENCES Arfan, M., Athar, H.R. & Ashraf, M., 2007. Does exogenous application of salicylic acid through the rooting medium modulate growth and photosynthetic capacity in two differently adapted spring wheat cultivars under salt stress. J. Plant Physiol., 6(4): 685-694. Ashraf, M., 2004. Some important physiological selection criteria for salt-tolerance in plants. Flora, 199: 361-376. Ashraf, M., Athar, H.R., Harris, P.J.C. & Kwon, T.R. 2008. Some prospective strategies for
VOL. 60 (2) SALT STRESS ALLEVIATION WITH SALICYLIC ACID ON MAIZE 209 improving crop salt tolerance. Adv. Agron., 97: 45-110. Ashraf, M., 2009. Biotechnological approach of improving plant salt tolerance using antioxidants as markers. Biotechnol. Adv., 27: 84-93. Bandeh-Hagh, A., Toorchi, M., Mohammadi, A., Chaparzadeh, N., Salekdeh, G.H. & Kazemnia, H., 2008. Growth and osmotic adjustment of canola genotypes in response to salinity. J. Food Agric. Environ., 6(2): 201-208. Croughan, T.P. & Rains, D.W., 1982. In: Mitsui, A. and C. C. Black (Eds.), Handbook of Biosolar Resources. CRC Press, Boca Raton, Florida., pp. 245-255. El-Tayeb, M.A., 2005. Response of barley grains to the interactive effect of salinity and salicylic acid. Plant Growth Regul.,45(3): 215-224. Flower, T.J., 2004. Improving crop salt tolerance.j. Exp. Bot., 55: 307-319. Frova, C., Krajewski, P., Fonzo, N.D., Villa, M. & Sari-Gorla, M., 1999. Genetic analysis of drought tolerance in maize by molecular markers. Theor. Appl. Genet., 99: 280 288. Gunes, A., Inal, A., Alpaslan, M., Eraslan, F., BagciE. G. & Cicek, N., 2007. Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize (Zea mays L.) grown under salinity. J. Plant Physiol., 164: 728-736. Khan, A., Ahmad, M. S. A., Athar, H. & Asghar, M., 2006. Interactive effect of foliarly applied ascorbic acid and salt stress on wheat (Triticumaestivum L.). Pak. J. Bot., 38(5): 1407-1414. Khan, N. A., Syeed, S., Masood, A., Nazar, R. & Iqbal, N., 2010. Application of salicylic acid increases contents of nutrients and antioxidative metabolism in mungbean and alleviates adverse effects of salinity stress. Int. J. Plant Biol., 1: 1-12. Maqsood, T., Akhtar, J., Farooq, M. R., Haq, M. A. & Saqib, Z. A., 2008. Biochemical attributes of salt tolerant and salt sensitive maize cultivars to salinity and potassium nutrition. Pak. J. Agr. Sci., 45: 1-5. Mehdi, S.S. & Ahsan, M., 2000. Coefficient of variation, inter-relationships and heritability: Estimated for some seedling trails in maize in recurrent selection cycle. Pak. J. Biol. Sci., 3: 181-182. Molassiotis, A.N., Sotiropoulos, T., Tanou,G., Kofidis, G., Diamantidis, G. & Therios, I., 2006. Antioxidant and anatomical responses in shoot culture of the apple rootstock MM 106 treated with NaCl, KCl, Mannitol or Sorbitol. Biol. Plant., 50: 61-68. Natr, L. & Lawlor, D. W., 2005. Photosynthetic plant productivity. In: Pessarakli, M. (Ed.), Hand Book of Photosynthesis. C.R.C. Press, New York, USA, pp. 501-524. Panda, S.K. & Upadhyay, R.K., 2004. Salt stress induces oxidative alterations and antioxidative defense in the roots of Lemna minor. Biol. Plant., 48(2): 249-253. Rui, L., Wei, S., Mu-Xiang, C., Cheng-Jun, J., Min, W. & Bo-Ping, Y., 2009. Leaf anatomical changes of Burguiera gymnorrhiza seedlings under salt stress. J. Trop. Subtrop. Bot., 17(2): 169-175. Sahu, M.P., Solanki, N.S. & Dashora, L.N., 1993. Effects of thiourea, thiamine and ascorbic acid on growth and yield of maize (Zea mays L.). J. Agron. Crop Sci., 171: 65-69. Singh, B. & Usha, K., 2003. Salicylic acid induced physiological and biochemical changes in wheat seedlings under water stress. Plant Growth Regul.,39: 137-141. Steel, R. G. D. & Torrie, J. H., 1980. Principles and Procedures of Statistics. A Biometrical Approach. McGraw Hill Inter. Book Co. Tokyo, Japan. 633 pp. Tagne, A., FeujioT. P. & Sonna,C., 2008. Essential oil and plant extracts as potential substitutes to synthetic fungicides in the control of fungi. In: Proc. Internat.Con. Diversifying Crop Protec. 12-15 October La Grande-Motte, France. Zhao, G. Q., Ma, B. L. & Ren, C. Z., 2007. Growth, gas exchange, chlorophyll fluorescence and ion content of naked oat in response to salinity. Crop Sci., 47(1): 123-131.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 211-218 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Prevalence of Endoparasites in African Lion Panthera leo *ABDUL QAYYUM KHAN SULEHRIA 1, GULNAZ MOQEEM 1, YASSER SALEEM MUSTAFA 2, ZAHID SHARIF MIRZA 3 & SUMERA MUSHTAQ 1 1 Department of Zoology, GC University, Lahore, Pakistan 2 Provincial Diagnostic Laboratory, Cooper Road, Lahore, Pakistan 3 Fisheries Research & Training Institute, Manawan, Batapur, Lahore, Pakistan ABSTRACT The incidence of endoparasites in African lion, Panthera leo, present in Lahore Zoo and Lahore Safari Park has been investigated. The study was conducted from January, 2012 to July, 2012 during which 147 fecal samples were collected from 21 African lions, including male, female and cubs, divided into three groups on the basis of age. The prevalence of cestodes was 33.3% in females while prevalence of nematodes was 33.3% and 66.7% in males and females, respectively. Trematodes were not found in any lion. It was recorded that prevalence of endoparasites was greater in female lions (38.9%) as compared to male lions (28.5%). Key words: Lion, Endoparasite, Cestode, Nematode, Trematode INTRODUCTION Zoological gardens exhibit wild animals for aesthetic, educational, recreational and conservation purposes (Varadharajan & Pythal, 1999). The African lion (Panthera leo) is a big cat that belongs to genus Panthera (Nowak, 1999). Wild lions are found in Sub-Saharan Africa and in Asia while endangered species of lions are present in Gir Forest National park in India. Captive animals are more likely to contract diseases because animals live in close proximity to each other. When animals are housed together from different geographical areas or there are plans to reintroduce animals into wild environment, they have more opportunities to transfer parasites (Viggers et al., 1993). Wild animals carry a variety of parasites in their free living stage but they do not cause disease unless under stress (Gaur et al., 1979). Parasites with direct lifecycle and host range are the greatest threat for the animals (Fowler & Miller, 1999). Diseases that are caused by parasites comprise one of the major problems resulting in even morbidity and mortality in these animals while in captivity (Rao & Acharjyo, 1984) the effects range from sub-clinical to death. Collectively, helminths are the most prevalent and taxonomically diverse group of parasites in both wild and captive animals (Pedersen et al., 2005). The major groups of these metazoan parasites include the Platyhelminthes, Nematoda and Acanthocephala. Life cycles of helminth parasites are extremely complicated with different hosts for different developmental stages or simple with only a single host (Schneider & Tenter, 2006). Zoo animals under captivity are prone to almost all types of diseases. So these parasitic diseases, especially helminthic infection, are major problem of zoo animals (Varadharajan & Kandasamy, 2000). Zoo animals harbour a large number of parasites. These parasites affect animal health and cause mortality, morbidity or both (Deshmukh et al., 2009). Under captivity the health status of zoo animals varies with different factors e.g., management, feeding, environment, sanitation and close association of animals and seasonal variation affect the health of animals (Kashid et al., 2003). This project was designed to study the incidence of endoparasites in the African lion in the Lahore Zoo, Lahore and Lahore Safari Park. MATERIALS AND METHODS Experimental Animals and Study Area The present study was conducted on the African lion (Panthera leo) during January, 2012 to July, 2012. The samples were collected from 21 lions including male, female and cubs kept under captivity at Lahore Zoo located at 90-Shahra-e- *Corresponding author: khansulehria@hotmail.com
212 A. Q. K. SULEHRIA ET AL BIOLOGIA (PAKISTAN) Quaid-e-Azam and Lahore Safari Park at Raiwind Road, Lahore. In the Lahore Zoo, lions in captivity were kept in indoor enclosures with wired fence. While in Lahore Safari Park, lions were provided with semi-natural environment such as man-made hills, hideouts and dens. They were kept in outdoor vicinity with dense vegetation consisting of trees, bushes and grass. The age of the African lion was determined by studying eruption sequence of deciduous and permanent teeth of both jaws and the wear of permanent teeth (Smuts et al., 1978). Lions were divided into 3 groups depending upon their age e.g., Group A ( 1 Year), Group B (1-9 years) and Group C (10-20 years) (Table I). Table I: Age-wise population of Lion (Panthera leo) at Lahore Zoo and Lahore Safari Park Sr. Number of lions Age groups of lions No. Group A Group B Group C 1 Year 1-9 Years 10-20 Years (23.8%) (47.6%) (28.5%) 1. n 1 =7 - - 3 2. n 2 =14 3 M F M F M F (21.4%) 3. N =21 3 (14.3%) 2 (14.2%) 2 (9.5%) (42.9%) 4 (28.5%) 7 (33.4%) n 1 = Total number of lions present in Lahore Zoo, Lahore. 0 1 3 (21.5%) 3 (14.2%) n 2 = Total number of lions present in Lahore Safari Park, Lahore (14.2%) 1 (7.14%) 2 (9.5%) N = Total number of lions present in Lahore Zoo and Lahore Safari Park, Lahore. M = Male; F = Female The total number of lions present in Lahore Zoo and Lahore Safari Park were 21 out of which 7 (33.3%) lions were present in Lahore Zoo and 14 (66.7%) lions were present in Lahore Safari Park. There were 4 (57.1%) male lions and 3 (42.9%) female lions in Lahore Zoo but no cub was observed. In Lahore Safari Park 5(35.8%) male lions, 4(28.9%) female lions, 3(21.4%) male cubs and 2(14.2%) female cubs were present. Sample Collection In total, 147 faecal samples were collected. The scats were collected by using standardized collection protocol. Each sample was sealed in plastic zip lock bags. The bags were labelled with 3 (42.9%) 1 (7.14%) 4 (19.1) name of lion, sex, age, date, time of collection and locality. The samples were carried in ice box. Sample Processing in Laboratory The samples were taken to the Provincial Diagnostic Laboratory, Livestock and Dairy Development, 16-Cooper Road, Lahore. The processing of samples and detection of parasites were done there. In order to preserve, faecal samples were transferred to sterile vials containing 30ml of 10% formalin. The detection and quantification of parasites were done by using Sedimentation-Floatation Concentration (Zinc Sulphate) method described by Ezenwa, 2003 and Sedimentation Technique by Monson-Bhar & Bell (1982).
VOL. 60 (2) PREVALENCE OF ENDOPARASITES IN AFRICAN LION PANTHERA LEO 213 RESULTS Identification of Parasites Parasites were identified by studying the morphology and size of the eggs (Fig., 1) as described by Soulsby (1982) and Sloss et al. (1994). Fig., 1: Ova of Taenia sp., and Toxocara sp. Statistical Analysis The data collected was analyzed by applying Percentage (Steel & Torrie, 1997). The present study revealed that cestodes and nematodes were the most prevalent helminths found in lions. In Lahore Zoo, no lion was found positive for cestode, in Group A and B, however, 1 (33.3%) female lion was found positive for cestode infection in Group C. It was recorded that in Group B, the prevalence of nematodes among male lions of Lahore Zoo was 33.3% as 1 out of 3 lions was infected with nematode. While no female lion, present in this group, was found positive for nematode. In Group C, out of three 2(66.7%) female lions were found positive for nematode infection. No male lion was found having nematode infection in this group. No lion, in any group, was found positive for trematodes in Lahore Zoo. In Lahore Zoo, only 1(33.3%) female lion in Group C was carrying mixed infection while lions present in all other groups were found negative for mixed infection (cestode+nematode) (Table II). Sr. No. Age Groups and Number of lions Table II: Prevalence of endoparasites in Lions of Lahore Zoo Prevalence of Cestodes (Taenia sp.) Prevalence of Nematodes (Toxocara sp.) Prevalence of Trematodes Prevalence of Mixed infection (Cestode+Nematode) M F M F M F M F 1. Group A ( 1 year) - - - - - - - - M=0; F=0 2. Group B (1-9 years) M=3; F=0-1 (33.3%) 1 (33.3%) - - - - - 3. Group C (10-20 years) M=1; F=3 - - - 2 (66.7%) - - - 1 (33.3%) M = Male; F = Female In Lahore Safari Park, no lion was found infected with cestode in Group A. In Group B only 1(25%) male lion was found positive while all females were negative for cestodes. In Group C
214 A. Q. K. SULEHRIA ET AL BIOLOGIA (PAKISTAN) 1(100%) female lion was found positive for cestode infection. Prevalence of nematodes among the lions of Lahore Safari Park was high. In Group A only 1(50%) female lion was found positive for nematode. In Group B, 1(25%) male lion was found positive for nematodes while no female was found having nematodes. In Group C, 1(100%) male and 1(100%) female were found positive for nematodes. All lions present in Lahore Safari Park were found negative for trematodes. In Lahore Safari Park, all lions present in Group A were found negative for mixed infection (cestode+nematode). In Group B, 1(25%) male lions were found positive for mixed infection while in Group C only 1(100%) female lion was found having mixed infection (cestode+nematode) (Table III). Table III: Prevalence of endoparasites in Lions of Lahore Safari Park Sr. No. Age Groups and Number of lions Prevalence of Cestodes (Taenia sp.) Prevalence of Nematodes (Toxocara sp.) Prevalence of Trematodes Prevalence of Mixed infection (Cestode+Nematode) M F M F M F M F 1. Group A ( 1 year) M=3; F=2 - - - 1 (50%) - - - - 2. Group B (1-9 years) M=4; F=3 1 (25%) - 1 (25%) - - - 1 (25%) - 3. Group C (10-20 years) M=1; F=1-1 (100%) 1 (100%) 1 (100%) - - - 1 (100%) M = Male; F = Female Table IV: Prevalence of endoparasites in Lions in Lahore Zoo and Lahore Safari Park Sr No. Locality Total No. of Lions Prevalence of Cestodes (Taenia sp.) Prevalence of Nematodes (Toxocara sp.) Prevalence of Trematodes Prevalence of Mixed infection Total prevalence of endoparasites 1. Lahore Zoo 7 1 (14.28%) 3 (42.8%) - 1 (14.28%) 5 (71.4%) 2. Lahore Safari Park 14 2 (14.28%) 4 (28.5%) - 2 (14.2%) 8 (57.1%) 3. Total 21 3 7-3 13 (14.28%) (33.3%) (14.28%) (61.9%) Among cestodes only Taenia sp., was observed. Similarly, among nematode only Toxocara sp., was found. It was recorded that prevalence of cestodes (Taenia sp.) was 1(14.28%), prevalence of nematodes (Toxocara sp.) was
VOL. 60 (2) PREVALENCE OF ENDOPARASITES IN AFRICAN LION PANTHERA LEO 215 3(42.8%) and prevalence of mixed infection was 1(14.28%) among the lions of Lahore Zoo. In Lahore Safari Park prevalence of cestodes (Taenia sp.) was recorded as 2(14.2%), prevalence of nematodes (Toxocara sp.) was 4(21.5%) and prevalence of mixed infection was 2(14.28%). Overall prevelance was: cestodes (Taenia sp.) 14.28%, nematodes (Toxocara sp.) 33.3% and mixed infection 14.28% prevalent (Table IV). It was recorded that prevalence of endoparasites was greater in female lions (38.9%) as compared to male lions (28.5%) (Table V). Sr. No. Locality Table V: Comparison of prevalence of endoparasites in male and female lions in Lahore Zoo and Lahore Safari Park Total No. of Lions Prevalence of endoparasites in male lions 1. Lahore Zoo 7 1 2. Lahore Safari Park (14.28%) 14 4 (28.5%) Prevalence of endoparasites in female lions 4 (57.1%) 4 (28.5%) Total prevalence of endoparasites 5 (71.4%) 8 (57.1%) 3. Total 21 5 DISCUSSION (23.8%) In Pakistan more than 100 African lions are present in the captivity. They are in Zoological gardens, in the wildlife sanctuaries and in the personal zoos but no wild lion have been reported in Pakistan. A group exercise led by WCS and the IUCN SSC Cat Specialist Group estimated that 42% of major Lion populations were declining (Bauer, 2008). The rate of decline is most unlikely to have been as high as 90%, as reported in a series of news reports in 2003 (Kirby 2003, Frank & Parker 2003). The present study was conducted to assess the prevalence of helminths (endoparasites) among lions. In general, endoparasites (i.e., parasitic species usually reproduce by transmitting free living infective stages that pass from one host to another host) aggregate across their host population. Most individuals harbour low number of parasites but a few individuals become victim to high parasitic infection (Shaw & Dobson, 1995). Such heterogeneity is developed due to the variation between the individuals in their exposure to infective stages and difference in their susceptibility (Wilson et al., 2002). 8 (38.09%) 13 (61.9%) Prevalence of endoparasites in female lions (38.9%) was found to be greater as compared to male lions (23.8%) which contradicted the findings of Ravindran et al. (2006) who stated that male and female lions equally suffered from the endoparasite infection but agreed with the study of Smith & KOK (2006) who reported highest number of parasites in female lions. Lions present in Lahore Zoo showed high prevalence of endoparasites as compared to Lahore Safari Park because in Lahore Safari Park, lions were kept in an environment closer to their natural habitat and thus may have developed resistance against endoparasites. The similar result was published by Atanaskova et al. (2011) which showed that prevalence of endoparasites in Skopje Zoological Gardens was fairly high during 2007-2009 that was 21.4%, 32.1% and 28.6% in the years 2007, 2008, 2009 respectively. In captivity, lions are less resistant to endoparasites than in their natural habitats because they are provided with less varied food (Goossens et al., 2005). Furthermore, lions were caged in close proximity to each other which increased the prevalence of endoparasites in Lahore Zoo.
216 A. Q. K. SULEHRIA ET AL BIOLOGIA (PAKISTAN) All of the helminth parasites are found to be transmitted through environment, transplacemental transmission or through the feed given to the animals. In Lahore Zoo and Lahore Safari Park, lions are fed beef which can be intermediate host for many helminthic infections. The similar findings were made by Smith & KOK (2006) who described that helminths have the herbivore as intermediate host that may play important role in the transmission of parasites to lion. Likewise, Chakraborty & Goswami (2001) also concluded that high incidence of helminths in wild animals was due to the close association of these animals in captivity. Cubs present in Lahore Safari Park had less parasitic infection. Only 20% cubs were found positive for nematodes which might be due to the fact that more care and attention are given to cubs for better livability and growth which indirectly helps to prevent the invasion of infected stages of parasites. Modi et al. (1997) and Varadharajan & Subramanian (2003) reported similar findings. The old aged lions, both in the Lahore Zoo and Lahore Safari Park, had more parasitic burden. Smith & KOK (2006) opined that older male lions were infested with endoparasites because of their feeding habit. In the present study, it was found that both; in Lahore Zoo and Lahore Safari Park, only very few young lions (1-9 years) were carrying endoparasites. Smith & KOK (2006) reported similar findings in their study that the younger male lions had least number of eggs and parasitic infection. The resistance in young lions against endoparasites could be as a result of their heavy feeding, as observed by Smith & KOK (2006) that a younger male lion consumed the largest amount of feed that was 50 Kg. He kept eating for 4 hrs and 22 min, so he had physiological resources to resist against endoparasites. In captive lions prevalence of nematodes was (33.3%) that was quite high as compared to cestode infection. Among nematodes only Toxocara sp., was found in the faecal samples of lions at Lahore Zoo & Lahore Safari Park. Deshmukh et al., (2009) reported that prevalence of Toxocara sp., was 13.3% in wild animals in captivity. Varadharajan & Kandasamy (2000) reported that out of 3 lions 2 were found having Toxocara sp. The result is in accordance with Ravindran et al., (2006) who mentioned that out of 17 lions 12 were carrying Toxocara sp., as an endoparasite. Hase et al., (2007) reported toxocara infection in an 18 years old lion belonging to Siddharth Municipal Council Zoological Garden which was suffering from dullness, depressed appetite, epiphora and loose faeces. In Safari Park a cub was found having loose faeces in which Toxocara sp., was observed and this cub died later on. Vincent & Francis (2007) reported a very high number of lions suffering from Toxocara canis and Toxocara cati. They described that 66.6% lions were infected from Toxocara sp. at animal orphanage in Kenya, Boomker et al., (1997) reported Toxocara cati and T. canis as most prevalent endoparasites of lions. Bjork et al. (2000) reported absence of Toxocara sp., from free ranging wild lions. Muller-Graf (1995) reported that the prevalence of Toxocara sp. in wild animals was very low (4.5%). He found that only 5 individuals out of 112 were carrying Toxocara sp. It was calculated that the total prevalence of cestode parasite in Lahore Zoo and Lahore Safari Park was 14.28% e.g., 3 out of 21 lions were positive for cestodes. Among cestodes only Taenia sp. was found. Cestodes are more prevalent endoparasites of wild animals but some reports have been found from captivity. Ogungbade & Ogunrinade (1984) reported taeniid (Taenia hydatigena) in Panthera leo in captivity. A large variety of Taenia sp., is highly prevalent among carnivores. All the Taenia sp., use ruminants as an intermediate host. When these ruminants are eaten by lions, this parasite is transmitted to lion (Boomker et al., 1997). Kashid et al. (2003) reported Taenia taeniaeformis in wild captive animals. Bjork et al. (2000) reported eggs of Taenia sp. from free ranging wild lions of Northern Tanzania and observed that Taenia infection was most prevalent among lions. In the coprological survey of African wild lions Muller-Graf (1995) reported that taeniid eggs had the second highest prevalence among lions. No trematode was found in lion of any age group in the present work. It is found only in freeranging wild lions (Muller-Graf et al., 1999; Bjork et al., 2000).
VOL. 60 (2) PREVALENCE OF ENDOPARASITES IN AFRICAN LION PANTHERA LEO 217 According to International Union Conservation of Nature and Natural Resources (IUCN) African lion (Panthera leo) is an endangered species so its health management and monitoring are necessary. The present work will provide baseline data for safeguarding and management plans of endangered African lions. REFERENCES Atanaskova, E., Kochevski, Z., Stefanovska, J. & Nikolovski, G. 2011. Endoparasites in wild animals at the zoological garden in Skopje, Macedonia. J. threatened taxa., 3(7):1955-1958. Bauer, H., 2008. Synthesis of threats, distribution and status of the lion from the two lion conservation strategies. In: B. Croes, R. Buij, H. de Iongh and H. Bauer (eds), Management and conservation of large carnivores in west and central Africa. Institute of Environmental Sciences (CML), Leiden University, Leiden. pp: 13-28. Bjork, E.K., Averbeek, G.A. & Stromberg, B.A. 2000. Parasites and parasites stages of freeranging wild lions (Panthera leo) of Northern Tanzania. J. Zoo Wildlife Med., 31(2):56-61. Boomker, J., Penzhorn, B.L. & Horak, I.G. 1997. Parasires of Lions (Panthera leo) and leopards (Panthera pardus): A Documentation. Proceeding of a symposium on lions and leopards as game ranch animals. Onderstepoort. Pretoria. pp: 131-142. Chakraborty, A. & Goswami, P.K., 2001. Parasites of nonhuman primates of Assam State Zoo. J. Vet. Parasitol., 15(2):121-124. Deshmukh, S.S., Rewatkar S.G., Agarwal, A.M., Maske, D.K., Bhangale, G.N. & Shrikhande, G.B. 2009. Enoparasitism in wild animals in captivity. Zoos Print J., 25(8): 262. Ezenwa, V.O. 2003. Host social behaviour and parasitic infection: A multifactorial approach. Behav. Ecol., 15(3): 446-454. Fowler, M.E. & Miller, R.E. 1999. Zoo and Wild Animal Medicine. 2 nd edition. W. B. Saunder. Philadelphia. pp: 28-29. Frank, L. & Packer, C., 2003. Letter to the editor. New Scientist. October 23. Gaur, S. N. S., Sethi, M. S.., Tiwari, A.C. & Prakash, O. 1979. Prevalence of helminthic parasitesin wild and zoo animals in Utter Pardesh. Indian J. Anim. Sci., 49: 159-161. Goossens, E., Dorny, P., Boomker, J., Vercammen, F. & Vercruysse, J., 2005. A 12- month survey of the gastro-intestinal helminths of antelopes, gazelles and giraffids kept at two zoos in Belgium. Vet. Parasitol., 127: 303 312. Hase, P. B., Digraskar, S. U., Gangane, G. R., Narladakar, B.W. & Razawi, S.V. 2007. Balantidium and Toxocara infection in lion (Panthera leo) - A case report. Zoos Print J., 22(5): 2674. Kashid, K.P., Shrikhande, G.B. & Bhojne, G.R. (2003). Incidence of gastrointestinal helminths in captive wild animals at different locations. Zoos Print J., 18 (3): 1053-1054. Kirby, A., 2003. Africa's shocking lion loss. http://news.bbc.co.uk/1/hi/sci/tech/3171380. stm. Modi, G.S., Parsad, B.N. & Singh, A.H., 1997. Parasitic infections in carnivorous zoo animals of Bihar. Indian Vet. Med. J., 21(6):112-116. Monson-Bhar, P.E.C. & Bell, D.R., 1982. Mansons Tropical Diseases. English language book society. Bailliere. Tindall, London. 1557 pp. Muller-Graf, C.D., 1995. A coprological survey of intestinal parasites of wild lions (Panthera leo) in the Serengeti and the Ngorongoro Crater in Tanzania, East Africa. J. Parasitol., 81(5): 812-814. Muller-Graf, C.D., Woolhouse, M.E. & Packer, C., 1999. Epidemiology of an intestinal parasite (Spirometra spp.) in two populations of African Lions (Panthera leo). Parasitology., 118(4): 407-415. Nowak, R.M., 1999. Walker s Mammals of the World. 6 th Ed. The Johns Hopkins University Press, Baltimore, Maryland. 2015 pp. Ogungbade, S.G. & Ogunrinade A.F., 1984. Tapeworm infection (Taenia hydatigena) in lion (Panthera leo) in captivity. A case report. Rev. Elev. Med. Vet. Pays Trop., 37(1):30-31.
218 A. Q. K. SULEHRIA ET AL BIOLOGIA (PAKISTAN) Pedersen, A.B., Altizer, S., Poss, M., Cunningham, A.A. & Nunn C.L., 2005. Patterns of host specificity and transmission among parasites of wild primates. Int. J. Parasitol., 35:647 657. Rao, A.T. & Acharjyo, L.N., 1984. Diagnosis and classification of common diseases of captive animals at Nandankanan zoo in Orissa (India). Indian J. Anim. H., 23(2): 148-152. Ravindran, R., Lakshman, B., Anoop, S., Rajeev, T. S. & Dinesh, C.N., 2006. Parasitic infection in captive lions (Panthera leo). Zoos Print J., 21(4): 2230. Schnieder, T. & Tenter, A. 2006. Erreger von Parasitosen: Taxonomie, Systematik und allgemeine Merkmale. in: T. Schnieder (ed.) Veterinärmedizinische Parasitologie. 6. edn., Stuttgart, pp: 26-73. Shaw, D.J. & Dobson, A.P., 1995. Pattern of macroparasite abundance and aggregation in wildlife population: a quantitative review. Parasitology., 11:111-113. Sloss, M.W., Kemp. R.L., & Zajac, A.M., 1994. Veterinary Clinical Parasitology, 6 th Ed. Iowa State University Press. Ames, Iowa. 208 pp. Smith, Y. & Kok, O.B., 2006. Faecal helminth egg and oocyst counts of a small population of African lions (Panthera leo) in the Southwestern Kalahari, Namibia. Onderstepoort. J. Vet. Res., 73(1):71-75. Smuts, G.L., Anderson, J.L. & Austin, J.E., 1978. Age determination of the African lion (Panthera leo). 1. Zool. Land. 185:115-146. Soulsby, E.J.L.,1982. Helminths, Arthropods and Protozoa of Domesticated Animals. 7 th Ed. Baillere and Tindall. London. East Sussex, UK. 809 pp. Steel, R.G.D., Torrie, J.H. & Dickey, D. A., 1997. Principles and Procedures of Statistics: A Biometrical Approach. 3 rd Ed. McGraw Hill. NewYork. USA. 666 pp. Varadharajan, A. & Kandasamy, A., 2000. A survey of gastro-intestinal parasites of wild animals in captivity in the V.O.C. Park and Mini Zoo, Coimbatore. Zoos Print J., 15(5):257-258. Varadharajan, A. & Pythal, C., 1999. Parasites of Wildlife I. A preliminary investigation on parasites of wild animals at the Zoological Garden, Thiruvananthapuram, Kerala. Zoos Print J., 1-14(3-12):159-164. Varadharajan, A. & Subramanian, H., 2003. Influence of age on the prevalence of parasitic infections among wild mammals in Thrissur Zoo, Thrissur, Kerala. Zoos Print J., 18(4):1065-1066. Viggers, K., Lindenmayer, D. & Spratt, D., 1993. The importance of disease in reintroduction programmes. Wildlife Res., 22(5):687-698. Vincent, O. & Francis, G., 2007. Parasites in Captive Carnivores at animal orphanage in Kenya. The Kenya Veterinarian, 31(2): 59-63. Wilson, K., Bjornstad, O.N., Dobson, A.P., Merler, S., Poglayen, G., Randolph, S.E., Read, A.F. & Skorping, A., 2002. Heterogeneities in macro-parasite infections: patterns and processes, pp: 6-44. In: Hudson, P.J., A. Rizzoli, B.T. Grenfell, H. Heesterbeek & A.P. Dobson (eds.). The Ecology of Wildlife Diseases. Oxford University Press, New York, United States, xii+197pp.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 219-224 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Investigating the Potential of Petiole and Leaf blade for Callus Formation in Solanum tuberosum L. MUTHIRA ZANIB KAZMI, HAJRA RAMZAN, AISHA AHMAD, ATIYA ANWAR & ATHAR HUSSAN SHAH Department of Botany, GC University, Lahore, Pakistan ABSTRACT Different plant growth regulators (such as NAA, BAP, Kin, and 2,4-D) were used to investigate the petiole and leaf blade potential for callus formation. Best results were recorded in both NAA and 2,4-D at 1.5 mg/l. Whereas Kin gave best result at 2 mg/l for both the explants studied. In combination BAP+NAA gave better result at 2 mg/l BAP+ 0.5 mg/l NAA while in Kin+2,4-D better result were observed in leaf blade at 1.5 mg/l Kin +0.5 mg/l 2,4-D and in petiole at 1.5 mg/l Kin +0.5 mg/l 2,4-D. Key words: Callogenesis, leaf blade, petiole, auxins, cytokinins, Solanum tuberosum L. INTRODUCTION Potato (Solanum tuberosum L.) ranks fourth in the most important food crops after maize, wheat and rice. Due to its wide adaptability potato is grown in both tropical and temperate environments up to 4000 metres (Poehlman & David, 2003). Potato grows around 18.3 million hectares with a production of 295 million tonnes. Its world's average yield is 50.5 kg/year (Prasad, 2006). Potato consumption is increasing year after year and it doubles every 10 to 15 years (CIP, 1984). In future, it will be an important food crop in the food basket of developing countries (CIP, 2005). Potato can be grown in all types of soil, except saline and alkaline soils. However, loamy soil, sandy loamy soil and organic matter enriched soil are most appropriate for the cultivation of potato crop. Moreover, it is a crop of temperate climate and is moderately tolerant to frost. Potato is one of the most economically important annual vegetable crops of family Solanaceae in Pakistan. The important potato varieties grown in Pakistan are of two types, i.e. red skin and white skin. Red skin included Desiree, Cardinal, Ultimus, Lala Faisal and Raja Symphonia while white skin included Diamant, Ajax, Patrones, Multa and Sante. White potato, also called Irish potato, is an annual crop from the genus Solanum family Solanaceae (Khurana et al., 2003). Solanum tuberosum is a hybrid between the diploid species S. stentotomum and the diploid weed S. sparsipilum with subsequent chromosome doubling, however, over 230 wild potato species are known. The potato has a series of ploidy levels based on a haploid number of 12, ranging from diploid (2n=24) to hexaploid (6n=72), and including triploids, tetraploids, and pentaploids (Dodds & Roberts, 1995). However, the cultivated potatoes are autotetraploid (4n = 48). The tissue culture technique is now a timetested alternative means of plant propagation. The potato is highly responsive to many tissue culture techniques, which have been extensively applied in all aspects of production and improvement. The most significant advantage offered by micropropagation over conventional methods is that in a relatively short period of time and space a large number of plants can be produced from a single individual independently of the seasons (Smith & Drew, 1990). Micropropagation is very important for heterozygous species, such as potato, for producing uniform plants. A single explant can be multiplied into several thousands of plants in less than one year. The present study was carried out to evaluate the callogenic potential of leaf blade and petiole of Solanum tuberosum L. Two auxins and two cytokinins were used in solo and in combination to explore their impact on callogenic response. MATERIALS AND METHODS Healthy plant shoots were selected from potato fields and brought to the laboratory. They were washed with tap water to remove the soil particles, then the shoots were surface sterilized with Mercuric Chloride (0.1% w/v) for 15 minutes. *Corresponding author: athar45@hotmail.com
220 M. Z. KAZMI ET AL BIOLOGIA (PAKISTAN) After three washings with autoclaved distilled water, the shoots were placed in laminar air flow cabinet for excision of leaf blade and petiole. The size taken from explants was 1cm for leaf blade and 0.5cm for petiole. Explants were inoculated in the culture vessel with the help of forceps. MS medium (Murashige & Skoog, 1962) supplemented with different plant growth regulators was used. The stock solutions of MS medium were prepared by mixing the inorganic and organic components. In PGR two auxins, i.e. 2,4-D (2,4- dichlorophenoxy acetic acid), and NAA (Naphthalene acetic acid) and two cytokinins, i.e. BAP (6-Benzylaminopurine), and kinetin were used in solo as well as in combination. Sucrose was added at the rate of 3.0% (w/v), ph of the medium was adjusted at 5.8 using 0.1N KOH or HCl. The medium was jelled using 0.6% agar (Bio Life). The cooked hot medium was dispensed in appropriate volumes into the culture vessels and sterilize in autoclave at 121 o C, temperature 15lb/inch 2 pressure for 15 minutes. The laminar air flow cabinet was used for inoculation of explants. After inoculation, the vessels containing explants were placed in 25±2 C at 85% relative humidity under fluorescent tube light for callus induction. The results were analysed statistically in which one way ANOVA (analysis of variance) and Post Hoc test was applied. RESULTS AND DISCUSSION The callogenic potential of leaf blade and petiole of potato (Solanum tuberosum L.) was investigated using two auxins and two cytokinins in solo and in combination. The parameters studied included callus size, number of days for callus initiation, callus colour, texture and callusing response. Solo Effect of Auxins For both the explants, 0.5, 1.0, 1.5, 2.0 mg/l NAA and 2,4-D concentrations were used for callus induction. Callusing was induced at all concentrations, however, the best callus growth was observed at 1.5 mg/l NAA and 2,4-D. Petiole explant produced black-brown granular callus of 2±0.058 cm 3 in NAA and 2.06 ±0.070 cm 3 callus in 2,4-D (Plate 1) after 18 days, however, compact, granular, light-yellow callus with 87.5% response in both was observed. Leaf blade explant in 1.5 mg/l NAA and 2,4-D produced dark-brown, granular callus of 2.5±0.231 cm 3 after 16 days of inoculation in NAA (Plate 2) with 81.25% response while in 2,4- D induced 2.5±0.289 yellow-brown, granular callus with 87.5% response. Dokhaniyeh et al. (2011) using the same concentration for callus induction reported production of copious callus in potato. The optimum value of leaf blade for callus size is more significant as compare to petiole, having nearly significant value at p 0.05. Solo Effect of Cytokinins For both the explants 0.5, 1.0, 1.5, 2.0 mg/l BAP and Kin concentrations were used for callus induction. Callusing was observed at all concentrations, however, the best callus growth was observed for petiole at 1.5 mg/l Kin and 2 mg/l BAP. Petiole explant induced callus of 1.9±0.058 cm 3 in BAP, having light-yellow, granular appearance and 2.25± 0.029 cm 3 callus in Kin (Plate 3) was produced after 18 days. It was granular, light-yellow in colour with 62.5% response. However, Sunpui & Kanchanapoom (2002) reported that by using petiole explants no callus was induced from Kin at solo form. However, in the present study leaf blade produced copious callus at 2 mg/l BAP, producing 2.21± 0.020 cm 3, brown, granular callus and 3.5±0.231cm 3 in Kin (Plate 4) which turns yellow-brown and granular after 16 days of inoculation with 87.5% response. Yasmin et al. (2003), using the same concentration of BAP, observed that maximum callus was induced at 5.0 mg/l and 4.0 mg/l in potato and concluded that below this concentration induction of callus is not possible. In the present study, the optimum value of petiole and leaf blade for callus size was noted significant at p 0.05. Combined Effect of BAP & NAA In combination, BAP and NAA were used at the strengths of 0.5, 1.0, 1.5 and 2.0 mg/l, keeping BAP constant with variable concentration of NAA. When BAP were kept constant (Figure 1-4) best result in callus production from petiole explant was observed at 1 mg/l BAP+2 mg/l NAA, having lightyellow, granular callus of 1.79±0.023 cm 3 (Plate 5) induced after 20 days of inoculation with 68.75% response. Leaf blade gave best result at 1 mg/l BAP+1.5 mg/l NAA, producing a dark-brown,
VOL. 60 (2) POTENTIAL OF PETIOLE AND LEAF BLADE FOR CALLUS 221 granular callus of 2.0±0.115 cm 3 (Plate 6) induced after 18 days of inoculation with 50% response. Yasmin et al. (2003) studied 1 mg/l BAP+1.25 mg/l NAA showed better callus induction which is quite similar with the concentrations used in the present study. Ganzalez et al. (1999) observed that at 1 mg/l BAP+1 mg/l NAA concentrations successfully induced sufficient amount of callus for both the explants. When NAA was kept constant for both the explants, the best result in petiole explant was obtained at 2 mg/l BAP+0.5 mg/l NAA, producing a yellow, friable callus of 1.9±0.058 cm 3 with 68.75% response after 15 days of inoculation. In leaf blade 2 mg/l BAP+ 0.5 mg/l NAA produced yellow, granular callus of 2.3±0.173cm 3 with 75% response after 18 days of inoculation. Lima et al. (2006) also reported that BAP and NAA at these concentrations were able to induce sufficient amount of callus from the explants. Combined Effect of Kin & 2,4-D In combinations, Kin and 2,4-D were used at the strengths of 0.5, 1.0, 1.5 and 2.0 mg/l, keeping Kin constant with variable concentration of 2,4-D. When Kin was kept constant for both the explants (Fig. 5-8), best results were obtained at 0.5 mg/l Kin+1.5 mg/l 2,4-D in petiole with granular, light-yellow callus of 2.6± 0.115 cm 3 (Plate 7) after 18 days of inoculation with 87.5% response. Leaf blade gave significant results at 2 mg/l Kin+1 mg/l 2,4-D and light-yellow granular callus of 2.8±0.173 cm 3 (Plate 8) induced after 15 days of inoculation with 87.5% response. Haque et al. (2009) used 0.25 mg/l Kin with 1.0, and 2.0 mg/l 2,4-D, and found it to be suitable for induction of callus. Sexene et al. (1997) observed the rapid callus growth for both explants at 0.5 mg/l Kin+2mg/L 2,4-D, and concluded that at these concentrations calli proliferated very fast and it was soft and gelatinous in texture. When 2,4-D was kept constant for both the explants, best results were obtained in petiole at 1.5 mg/l Kin+0.5 mg/l 2,4-D,with callus size of 2.2±0.115 cm 3, granular, dark-yellow in colour with 87.5% response after 18 days of inoculation. In leaf blade best results were observed at 1.5 mg/l Kin+0.5 mg/l 2,4-D, producing yellow-white, granular callus of 3.5±0.289 cm 3 after 16 days of inoculation with 93.75% response. Haque et al. (2009) observed that leaf explant appeared to be best for callus size and weight when 1.0 mg/l 2,4- D+0.25 mg/l Kin concentration was used. Moreover, Kuehnle et al. (1992) obtained sufficient amount of callus induction at 2 mg/l 2,4-D +1 mg/l Kin. All results were statistically analysed in one way ANOVA (analysis of variance) and Post Hoc test was applied. The optimum value of Duncan was significant for leaf blade at 0.5 mg/l 2,4-D with 0.5, 1.0, 1.5 and 2.0 mg/l Kin and 2 mg/l 2,4-D with 0.5, 1.0, 1.5 and 2.0 mg/l Kin. The results of ANOVA were significant for all concentrations in leaf blade except 1.5 mg/l BAP with different concentrations of NAA, 1mg/L Kin with different concentrations of 2,4-D, and 2,4-D with different concentrations of Kin. The results of ANOVA were significant for all concentrations of petiole except 1mg/L Kin with different concentrations of 2,4-D. Fig.,1: Effect of 0.5 mg/l BAP with different concentrations of NAA on leaf blade and petiole of potato Fig.,2: Effect of 1mg/L BAP with different concentrations of NAA on leaf blade and petiole of potato
222 M. Z. KAZMI ET AL BIOLOGIA (PAKISTAN) Fig.,3: Effect of 1.5mg/L BAP with different concentrations of NAA on leaf blade and petiole of potato Fig.,6: Effect of 1mg/L Kin with different concentrations of 2,4-D on leaf blade and petiole of potato Fig.,4: Effect of 2 mg/l BAP with different concentrations of NAA on leaf blade and petiole of potato Fig.,7: Effect of 1.5mg/L Kin with different concentrations of 2,4-D on leaf blade and petiole of potato Fig.,5: Effect of 0.5 mg/l Kin with different concentrations of 2,4-D on leaf blade and petiole of potato Fig.,8: Effect of 2mg/L Kin with different concentrations of 2,4-D on leaf blade and petiole of potato
VOL. 60 (2) POTENTIAL OF PETIOLE AND LEAF BLADE FOR CALLUS 223 Plate 1: Response of petiole at 1.5 mg/l 2,4-D (Lateral view) Plate 5: Response of petiole at (1mg/LBAP + 2 mg/l mg/l NAA) (Lateral view1x) Plate 2: Response of leaf blade at 1.5 mg/l 2,4-D (Aerial view) Plate 6: Response of leaf blade at (1mg/L BAP + 1.5 NAA) (Lateral view 2x) Plate 3: Response of Petiole at 1.5mg/L Kin (Lateral view) Plate 7: Response of petiole at (0.5 mg/l Kin+ 1.5 mg/l 2,4-D) (Lateral view 1x) Plate 4: Response of Leaf blade at 2 mg/l Kin (Lateral view) Plate 8: Response of leaf blade at (2 mg/l Kin+ 1mg/L 2,4-D) (Lateral view 1x)
224 M. Z. KAZMI ET AL BIOLOGIA (PAKISTAN) REFERENCES CIP., 1984. International Potato Centre, Centro International de la Papa. Potatoes for the Developing World. Lima, Peru. pp:148. CIP., 2005. International Potato Centre, Centro International de la Papa, Lima, Peru, Website at http//www.cipotato.org/potato/potato.htm. Dodds, J.H. & Roberts, L.W., 1995. Experiments in plant tissue culture (3 rd Ed.) Cambridge University Press, pp: 1-65. Dokhaniyeh, A.Y., Kohnehrouz, B.B., Mousavi, A., Gholizadeh, A. & Khalighi, A., 2011. Rapid and high efficiency regeneration from potato (Solanum tuberosum). J. Food, Agriculture & Environment 9 (3&4): 613-617. Ganzalez, R.G., Sanchez, D.S., Campos, J.M., Errazquez, E.P., Guerra, Z.Z., Quesada, A. L., Valdivia, R.M. & Gonzalez, M.G., 1999. Plant regeneration from leaf and stem explants from two sweet potato (Ipomoea batatas L.) cultivars. Biotechnologa Aplicda., 16:11-14. Haque, A.U., Samadand, M.A. & Shapla, T.L., 2009. In vitro callus initiation and regeneration of potato. Bangladesh. J. Agril., 34(3):449-456. Khurana, S.M.P., Minhas, J.S. & Pandey, S.K., 2003. The Potato: Production and Uutilization in Subtropics. Mehta Publishers, New Delhi, India, 445 pp. Kuenhle, A.R., Chen, F.C. & Sugii, N., 1992. Somatic embryognesis and plant regeneration in (Anthurium andraeanum) hybrid. Plant Cell Reports, 11:438-442. Lima, E.C., Paiva, R., Nogueira, R.C., Soares, F.P., Mmrich, E.B. & Silva, A. A. N., 2006. Callus induction in leaf segments of (Croton urucurana) BAILL. Cienc. Agrotec. Lavras., 32(1): 17-22. Murashige, T. & Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. J. Physiol., 15: 473-497. Poehlman, M.K. & David, A.S., 2003. Breeding Field Crops. Henry Holt and Company Inc. New York. pp: 363 375. Prasad, R. 2006. Field Crop Production. Indian council of agriculture research (ICAR) publication, New Delhi. pp: 719-769. Saxena, C., Palai, S.K., Samantaray, K., Rou, G.R. & Das, P., 1997. Plant regeneration from callus cultures of (Psoralea corylifolia L.). Plant Growth Regul., 22:13 17. Smith, M.K. & Drew, R.A., 1990. Current applications of tissue culture in plant propagation and improvement. Aust. J. Plant.Physiol.,17:267-289. Sunpui, W. & Kanchanapoom, K., 2002. Plant regeneration from petiole and leaf of African violet Sain (Saintpaulia ionantha Wendl.) culture in vitro. Songklanakarin J. Sci. Technol. 24(3): 357-364. Yasmin, S., Nasiruddin, K.M., Begum, R. & Talukder, K.S., 2003. Regeneration and establishment of Potato. Aust. J. Plant Sci., 2(12): 936-940.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 225-230 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Some New Remains of Cervids (Cervidae, Ruminantia) from Tatrot Formation of Northern Pakistan *MUHAMMAD AKBAR KHAN, MADEEHA JAMIL, KHALID MAHMOOD, MUHAMMAD ADEEB BABAR, MUHAMMAD AKHTAR, & SAYYED GHYOUR ABBAS Department of Zoology, Quaid-e-Azam Campus, Punjab University, Lahore, Pakistan ABSTRACT Some new fossil specimens, recovered from the Tatrot type locality, Jhelum District, Northern Pakistan, are described and discussed here. The sample comprises isolated dentitions and indicates two species of cervids Cervus triplidens and C. sivalensis in the Tatrot type locality of the Tatrot Formation. The new sample contributes additional information about the Siwalik cervids. Key words: Mammalia, Fossils, Pliocene, Pleistocene, Soan Formation, Siwaliks. INTRODUCTION Cervids appeared in the Siwalik sequence during Plio-Pleistocene times (Made, 1999; Barry et al., 2002) and represented by many species (Lydekker, 1876, 1880, 1884; Brown, 1926; Matthew, 1929; Colbert, 1935; Azzaroli, 1954; Arif et al., 1991; Ghaffar et al., 2010, 2011, 2012). At least five species have been recognized from the Siwaliks, based on the dentitions and antlers (Arif & Raza, 1991). The studied specimens came from the deposits nearby the Tatrot village of the district Jhelum, northern Pakistan (Fig. 1). The unit is well known for its rich mammalian fossil assemblages (Akhtar, 1992; Basu, 2004; Dennell, 2008; Khan et al., 2010). Apart from the specimens described here, fossil material attributed to proboscideans, perissodactyls, primates and rodents (Colbert, 1935; Pilgrim, 1937, 1939; Sarwar, 1977; Akhtar, 1992; Nanda, 2002, 2008; Khan et al., 2009, 2010). The outcrops belong to the Tatrot Formation of the Upper Siwaliks (Shah, 1980; Johnson et al., 1982). The Upper Siwalik fluvial sequence of the subcontinent is one of the most continuous of its age, spanning in time from the Late Pliocene up to the Middle Pleistocene, ca. 3.3-0.6 Ma (Behrensmeyer & Barry, 2005; Dennell et al., 2008; Nanda, 2008). Lithostratigraphy the Upper Siwaliks comprises the three formations: Tatrot, Pinjor and Boulder Conglomerates (Pilgrim, 1910, 1913; Nanda, 2002). Fig. 1: Map of the Potwar Plateau indicating the studied area and a generalized stratigraphic section of the main Siwalik formations (map is modified from Behrensmeyer and Barry 2005 and the boundary dates are from Dennell et al., 2008 and Nanda, 2008; Cohen & Gibbard, 2008). *Corresponding author: akbaar111@gmail.com
226 M. A. KHAN ET AL BIOLOGIA (PAKISTAN) The fossiliferous deposits of the Tatrot Formation consists of pale pinkish orange brown clays, brownish grey siltstones and shale, and greenish grey fine to medium grained sandstones intercalated with dark grey conglomerates (Khan et al., 2010). Hussain et al. (1992) and Barry et al. (2002) dated the lower boundary of the Tatrot Formation between 3.5-3.3 or 3.4-3.2 Ma. Dennell et al. (2008) and Nanda (2008) dated the upper boundary of the Tatrot Formation between 2.4-2.6 Ma. The Tatrot Formation roughly corresponds to the base of Pleistocene (Cohen & Gibbard, 2008). MATERIALS AND METHODS The material comprising mandible fragments and isolated dentition comes from the sediments of the Tatrot type locality of the Tatrot Formation, Northern Pakistan (Fig., 1). Some fossils were exposed on the surface while some are partially entrenched. The measurements were taken with a vernier caliper as maximum length (L) and width (W) at the occlusal level and expressed in millimeters. The catalogue number of the specimens consists of series i.e., yearly catalogue number and the serial catalogue number, so the figure on the specimens represents the collection year (numerator) and the serial number (denominator) of that year (e.g. PUPC 06/12; PUPC institutional abbreviation). Upper letters stand for upper teeth and lower letters for lower teeth. The comparative measurements of the studied specimens are provided in table I. The morphometric characters of the specimens are described and their systematic determination is discussed. The examined specimens are distinguished from each other on the basis of the tooth morphology. A comparison with the type material is made for each described species (Azzaroli, 1954; Arif et al., 1991 a, b; Ghaffar, 2005; Ghaffar et al., 2010). The terminology follows Azzaroli (1954) and Arif et al. (1991a, b). SYSTEMATIC PALAEONTOLOGY Order Artiodactyla Owen, 1848 Family Cervidae Goldfuss, 1820 Subfamily Cervinae Goldfuss, 1820 Tribe Cervini Weber, 1928 Genus Cervus Linnaeus, 1758 Cervus cf. sivalensis Lydekker, 1876 Holotype: GSI B215, a right mandibular ramus with m2-3. Type locality: Maili, Punjab province, India (Lydekker, 1880). Time range: Upper Siwaliks (Late Pliocene Pleistocene). Occurrence: Asia, Siwaliks. Original diagnosis: A large cervid with relatively hypsodont molars. The skull and antlers resembles these portions in Cervus duvaucelli. The skull by virtue of the frontal concavity at the orbits and the forward swells at the pedicles. The lacrymal vacuity is smaller than in Cervus duvaucelli. The brow tine of the antlers arises immediately burr and form an obtuse angle with the beam (Colbert, 1935). New material: PUPC 12/43, right lower mandibular fragment with partial p4; PUPC 12/41, right lower mandibular fragment with m2 and partial m3; PUPC 13/52, partial lower left third molar m3; PUPC 06/24, partial left m3. Locality: Tatrot type locality (Tatrot Formation), Jhelum district, Punjab province, Pakistan. Description and comparison The material only includes lower dentition (Fig. 2(1-3)). The anterior valley is open in the p4. The posterior valley is narrow and placed obliquely. The parastylid and paraconid anteriorly, and the entoconid and entostylid posteriorly, are not fused. The inflated hypoconid is comparatively prominent in the premolar. The premolar represents deep labial furrow. A transverse crest connects the labiolingual walls. The molars are partial however PUPC 12/41 has complete 2 nd molar (Fig. 2(2)). The enamel is moderately thick and rugose; this rugosity is more prominent and evident on labial side. The ectostylid is well preserved and reaching to the summit of the crown. The weak median ribs and mesostyle are present lingually. The crown shows the comparatively strong accessory columns. The metastylid and the entostylid are present lingually. The metastylid is stronger than the entostylid, which is projected outwardly near the summit of the crown. The prefossettid is formed by the union of the protoconid and the metaconid, while the postfossettid is formed by the union of the hypoconid and the entoconid. The fossettids are narrow. The metaconid rib is well projected than the entoconid rib. The postprotocristid and posthypocristid are equally strong. The stylids are not well developed. The entostylid is moderately developed. The m3 is similar to the m2; the hypoconulid is missing in the m3 (Fig. 2(3)). The metaconid is slightly higher than the entoconid. The stylids of the m3 are weakly developed.
VOL. 60(2) Some New Remains of Cervids 227 The specimen being large in size and smooth enamel can be referred to family Cervidae. The Siwaliks cervid also exhibit the size variation in dentition from species to species as from C. rewati to C. sivalensis within the same genera with other distinguishing features. The studied teeth are characterized in having accessory columns, weak stylids, basal cingulum, pronounced anterior flange and strong ectostylid. The major conids are in straight line. The enamel is less sculpture. These characters make their inclusion to C. sivalensis and C. rewati and exclude them to Rucervus simplicidens, C. triplidens and Axis punjabiensis. In diagnostic features, C. rewati closes to C. sivalensis but it is a small size species. Cervus sivalensis has fairly big molars than to C. rewati (Arif & Raza, 1991) (Fig., 2(1-3); Table I). The described specimens are well worn, nevertheless they have metrical and morphological similarities with the type specimen GSI B215 of C. sivalensis. The morphometric comparison leads to the conclusion that the specimens are attributable to C. sivalensis. Nevertheless, the material is very scarce and C. cf. sivalensis can be assigned for the recovered sample. Cervus cf. triplidens Lydekker, 1876 Holotype: GSI B204, a right maxilla with M2-3. Type locality: Punjab province, Pakistan (typical site not specified). Time range: Higher Pliocene of Sub-Himalaya, for the type (Lydekker 1883). Occurrence: South Asia (Upper Siwaliks of the subcontinent). Original diagnosis: Molars hypsodont with a large accessory column and rugose enamel (Colbert, 1935). Basal cingulum is absent and prominent costae are present. New material: PUPC 06/23, lm2. Locality: Tatrot type locality (Tatrot Formation), Jhelum district, Punjab province, Pakistan. Description and comparison The specimen is well preserved and it is in late wear (Fig., 2(4)). The molar is quadrate in shape having broad crown. The main cusps are broad and U-shaped. The protocone is extended lingually. The paracone and hypocone are in good condition. The entostyle is absent. The mesostyle is prominent labially. The metaconus and paraconus ribs are weakly developed. The protocone and paracone are crescent. The labial cusps are higher than those of lingual ones. The prefossette and postfossette are almost similar in appearance. The comparative measurements are provided in table I. The referred materials include second left upper molar. The molar is large size comparatively. The basal cingulum is absent and the median valley is deep, excluding its attribution to C. sivalensis. The deep median valley and the folded enamel on the outer surface differentiate the sample from Axis punjabiensis since these characters are absent in A. punjabiensis. Based on the described morphometric features, the specimens under discussion belong to the cervid species Cervus triplidens. The studied specimens have greater anteroposterior and transverse diameter than the type material but this difference has no taxonomic importance. The studied specimen belongs to an old individual. DISCUSSION A detailed systematic of the Siwalik cervids is worked out by many earlier researchers (Lydekker, 1876, 1884; Brown, 1926; Colbert, 1935; Azzaroli, 1954; Akhtar et al., 1999; Ghaffar et al., 2011). Most of them are argued that the cervids first appear in India after 3.0 Ma (Heintz et al., 1990; DiStefano & Petronio, 1998; Gentry, 2000). This is likely the same time that cervids dispersed to Indonesia and Philippines (Heintz et al., 1990) and Africa (Gentry, 2000). Five species of cervids are described from the Siwaliks Hills of Pakistan: Axis punjabiensis, Cervus rewati, Cervus triplidens, Cervus sivalensis and Rucervus simplicidens (Ghaffar et al., 2011). The different species of the cervids described from the Siwaliks represent the stratigraphic range from the Early Pliocene Pleistocene times (5.3 1.6 Ma) contrary to the earlier workers whom stated that the cervids appeared in the Siwalik in the Late Pliocene times (3.5-1.6 Ma). Perhaps one basic reason for this dispute was the stratigraphic confusions that have been resolved now as a result of refined magnetostratigraphy. The primitive cervines were probably tropical in distribution, they certainly inhabited woodland or open country, not closed forest. The open woodlands or grassy woodlands environments are also indicated by the carbon isotope record after 7.4 Ma. The Tatrot type locality of the Tatrot Formation (Upper Siwaliks), from where the studied specimens, has been collected can be interpreted open country palaeoenvironment. Conclusion Two cervid species are documented from the Tatrot type locality of the Tatrot Formation. These two species are Cervus sivalensis and
228 M. A. KHAN ET AL BIOLOGIA (PAKISTAN) Cervus triplidens from the Upper Siwaliks. These cervid species are associated with the bovines like Bison, Bos, Proamphibos and Hemibos fits well with that of a mosaic of habitats ranging from grassy woodland and woodland, to riverine and forest settings. Fig. 2. Cervus sivalensis. 1. PUPC 12/43, right lower mandibular fragment with partial p4. 2. PUPC 12/41, right lower mandibular fragment with m2 and partial m3. 3. PUPC 06/24, partial left m3. Cervus cf. triplidens. 4. PUPC 06/23, lm2. a = occlusal view, b = lingual view, c = buccal view. Scale bar 10 mm. Table I: Comparative measurements (mm) of the cheek teeth of C. sivalensis and C. triplidens. *the studied specimens. Referred data have been taken from Colbert (1935), Arif et al. (1991a, b) and Ghaffar (2005). Taxa Number Nature/Position L W W/L ratio C. sivalensis PUPC 12/43* rp4 23.0 12.00 0.52 PUPC 12/41* PUPC 84/119 rm2 24.6 18.0 0.73 rm3-19.0 m2 25.0 15.0 0.60 m3 24.5 13.0 0.53 PUPC 87/279 m3 31.0 18.0 0.58 m2 29.0 20.0 0.68 PUPC 66/9 m3 43.0 21.0 0.48 m1 10.5 9.50 0.90 m2 12.0 10.0 0.83 PUPC 02/35 m3 15.0 9.00 0.60 p2 6.80 4.15 0.61 GSI B215 m3 35.5 9.40 0.26 PUPC 85/95 m3 36.0 17.0 0.47
VOL. 60(2) Some New Remains of Cervids 229 PUPC 83/641 m3 55.0 16.5 0.30 PUPC 85/95 m3 36.0 17.0 0.47 C. triplidens PUPC 06/23* lm2 22.00 28.00 1.27 PUPC 98/77 m1 18.0 14.0 0.77 m2 20.0 16.0 0.90 m3 26.0 14.0 0.53 PUPC 69/146 m1 19.0 14.0 0.73 m2 20.0 20.0 1.00 m3 25.0 16.0 0.64 GSI B204 M2 20.0 23.7 1.18 M3 25.0 25.0 1.00 AMNH 19792 M2 24.0 26.0 0.92 REFERENCES Akhtar, M., 1992. Taxonomy and distribution of the Siwalik bovids. Ph.D. Thesis, University of the Punjab, Lahore, Pakistan, 372 pp. Akhtar, M., Ghaffar, A. & Qureshi, M.A., 1999. On Cervus punjabiensis Brown from the Siwalik Hills of Pakistan and Azad Kashmir. Punjab University J. Zool., 14: 93-96. Arif, M. & Raza, S.M., 1991. New findings of Cervidae (Mammalia) from the Upper Siwaliks of Potwar-Mirpur Areas, Pakistan. Proc. Pakistan Congr. Zool., 11: 275-281. Arif, M., Shah, S.M.I. & Vos, J.D., 1991a. Cervus rewati sp. nov. (Mammalia, Cervidae) from the Upper Siwaliks of Pakistan. Geol. Sur. Pak., Mem., 17: 1-11. Arif, M., Shah, S.M.I. & Vos, J.D., 1991b. Cervus triplidens (Mammalia, Cervidae) from the Upper Siwaliks of Pakistan. Geol. Sur. Pak., Mem., 17: 1-11. Azzaroli, A., 1954. Critical observations upon Siwalik deer. Proc. Linn. Soc. London, pp: 75-87. Barry, J., Morgan, M., Flynn, L., Pilbeam, D., Behrensmeyer, A.K., Raza, S., Khan, I., Badgely, C., Hicks, J. & Kelley, J., 2002. Faunal and Environmental change in the Late Miocene Siwaliks of Northern Pakistan. Paleobiol., 28: 1-72. Basu, P.K., 2004. Siwalik mammals of the Jammu Sub-Himalaya, India: an appraisal of their M3 26.0 26.0 1.00 diversity and habitats. Quat. Int., 117: 105-118. Behrensmeyer, A.K. & Barry, J.C., 2005. Biostratigraphic surveys in the Siwaliks of Pakistan: A method for standardized surface sampling of the vertebrate fossil record. Palaeont. Electr., 8: 1-24. Brown, B., 1926. A new deer from the Siwalik. Novitat., 242: 1-6. Cohen, K.M. & Gibbard, P.L., 2008. Global chronostratigraphical correlation table for the last 2.7 million years. Episodes, 31: 243-247. Colbert, E.H., 1935. Siwalik mammals in the American Museum of Natural History. Trans. Am. Phil. Soc., N. S., 26: 1-401. Dennell, R., 2008. The Taphonomic Record of Upper Siwalik (Pinjor stage) Landscapes in the Pabbi Hills, Northern Pakistan, with consideration regarding the preservation of Hominin remains. Quart. Int., 192: 62 77. Dennell, R., Coard, R. & Turner, A., 2008. Predators and Scavengers in Early Pleistocene southern Asia. Quart. Int., 192: 78-88. Distefano, G. & Petronio, C., 1998. Origin and relationships among Dama-like cervids in Europe. N. Jb. Geol. Palaeont. Abh., 207: 37-55. Gentry, A.W., 2000. The Ruminants Radiation. In: E.S. Vrba & G.B. Schaller (eds.), Antelopes, Deer and Relatives: Fossil Record, Behavioural Ecology, Systematics and
230 M. A. KHAN ET AL BIOLOGIA (PAKISTAN) Conservation. Yale University Press, New Haven, pp: 11-25. Ghaffar, A., 2005. Studies on equids, cervids and Carnivora from the Siwalik Hills of Pakistan. Ph. D. Thesis., University of the Punjab, Lahore. 425 pp. Ghaffar, A., Khan, M.A. & Akhtar, M., 2010. Early Pliocene Cervids (Artiodactyla-Mammalia) from the Siwaliks of Pakistan. Yerbilimleri. Earth Sci., 31: 217-231. Ghaffar, A., Akhtar, M., Khan, M.A., Khan, A.M., Samiullah K. & Iqbal, M. 2012. Discovery of antler from a new site in the Pinjor Formation (Pleistocene) of Pakistan. J. Geol. Soc. India, 80: 119-122. Ghaffar, A., Akhtar, M., Khan, M.A., Butt, M. J. & Khan, A. M., 2011. Cervus cf. rewati (Cervidae, Mammalia) from the Dhok Pathan Formation (Middle Siwaliks), Pakistan. Austrian J. Earth Sci., 104(1): 107-113. Heintz, É., Michel, B., Bernard, B. & Yves, J., 1990. The Main Features of the Cervid Palaeobiogeography. Quartärpaläontologie, Berlin, 8: 79-82. Hussain, S.T., Bergh, G.D., Steensma, K.J., Dee Visser, J.A., De Vos, J., Arif, M., Van Dam, J., Sondaar, P.Y. & Malik, S.M., 1992. Biostratigraphy of the Plio-Pleistocene continental sediments (Upper Siwaliks) of the Mangla-Samwal Anticline, Azad Kashmir, Pakistan. Proc. Kon. Ned. Akad. V. Wetensclr., 95: 65-80. Johnson, N.M., Opdyke, N.D., Johnson, G.D., Lindsay, E.H. & Tahirkheli, R.A.K., 1982. Magnetic polarity stratigraphy and ages of Siwalik Group rocks of the Potwar Plateau, Pakistan. Palaeogeogr., Palaeoclim., Palaeoec., 37: 17-42. Khan, M.A., Butt, S.S., Khan, M. A. & Akhtar, M., 2010. A new collection of Giraffokeryx punjabiensis (Giraffidae, Ruminantia, Artiodactyla) from the Lehri outcrops, Jhelum, northern Pakistan. Pakistan J. Sci., 62: 120-123. Khan, M.A., Iliopoulos, G. & Akhtar, M., 2009. Boselaphines (Artiodactyla, Ruminantia, Bovidae) from the Middle Siwaliks of Hasnot. Pakistan. Geobios, 42: 739-753. Khan, M. A., Kostopoulos, D. S., Akhtar, M. & Nazir, M., 2010. Bison remains from the Upper Siwaliks of Pakistan. Neues Jahrbuch für Geologie und Paläontologie, 258: 121-128. Lydekker, R., 1876. Molar teeth & other remains of Mammalia from the Indian Tertiaries. Pal. Indica, 16: 2-19. Lydekker, R., 1880. A sketch of the history of the fossil vertebrata of India. Journal Asiatic Society of Bengal, pp: 8-40. Lydekker, R., 1883. "Siwalik Selenodont Suina." Pal. Indica, X: 143-177. Lydekker, R., 1884. A sketch of the history of the fossil vertebrata of India. J. Asiatic. Soc. Bengal, XLIX: 8-40. Made, J.V.D., 1999. Intercontinental relationship Europe-Africa and the Indian Subcontinent. In: The Miocene Land Mammals of Europe. In: Rossner G.E. and Heissig K. (eds.), Munchen, Verlag Dr. Friedrich Pfeil, pp: 457-472. Matthew, W.D., 1929. Critical observations upon Siwalik Mammals. Bull. Amer. Mus. Natural Hist., LVI: 437-560. Nanda, A.C., 2002. Upper Siwaliks mammalian faunas of Indian and associated events. J. Asia. Earth Sci., 21: 47-58. Nanda, A.C., 2008. Comments on the Pinjor Mammalian Fauna of the Siwalik Group in relation to the Post-Siwalik Faunas of Peninsular India and Indo-Gangetic Plain. Quat. Int., 192: 6-13. Pilgrim, G.E., 1939. The fossil Bovidae of India. Pal. Indica, 26: 1-356. Pilgrim, G.E., 1937. Siwalik antelopes and oxen in the American Museum of Natural History. Bull. Am. Mus. Natural Hist., 72: 729-874. Pilgrim, G.E., 1910. Notices of new Mammalian genera and species from the Tertieries of India-Calcutta. Rec. Geol. Sur. India, 40: 63-71. Pilgrim, G.E., 1913. Correlation of the Siwaliks with Mammal Horizons of Europe. Rec. Geol. Sur. India, XLIII: 264-326. Sarwar, M., 1977. Taxonomy and distribution of the Siwalik Proboscidea. Bull. Dept. Zool. Univ. Punjab, N. S., 10: 1-172. Shah, S.M.I., 1980. Stratigraphy and economic geology of Central Salt Range. Recent geological Survey Pakistan, 52: 1-20.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 231-236 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Effects of Dalmazin on Luteal Cysts in Crossbreed Cows in Multan, Punjab (Pakistan) MUHAMMAD ZAFAR & TASAWAR HUSSAIN KHAN Institute of Pure and Applied Biology, Bahauddin Zakariya University, Multan, Pakistan ABSTRACT This study was conducted on the crossbreed cows (Sahiwal x Friesian) n=323 maintained at the Multan Dairy Farm Vehari Road Multan. The study aims to assess the response of treatment of crossbreed cows identified to possess luteal cyst using the prostaglandin analogue. The animals which did not show estrus up to 80-100 days, post partum were considered as cystic disorder. These animals were initially examined through rectal palpation. Sixty five (20.12%) animal showed no visible estrus signs. The incidence of postpartum disorders were luteal cyst, 15 (4.64%), follicular cyst, 11 (3.40%), corpus luteum 12 (3.71%), persistent corpus luteum 12 (3.71%), Anoestrous 13 (4.02%), and cystic ovary 2 (0.61%) through rectal palpation in the crossbreed cows. Three clinical examinations with a 7 day interval were performed in these cows and blood samples were also collected for progesterone analysis through radioimmunoassay (RIA). The results of the rectal palpation were confirmed by plasma progesterone concentration. The concentration of the progesterone before treatment in the blood was 1.44±0.44 ng/ml, 1.12±0.56 ng/ml and 0.56±0.23 ng/ml during 1 st, 2nd and 3 rd week respectively. The 8 cows were found as heaving luteal cyst. The treatment with Dalmazin (PGF2α) changed the plasma concentration of progesterone and it was 1.25±0.47 ng/ml, 3.88±0.88 ng/ml and 6.03±1.91 ng/ml during 1 st, 2 nd and 3 rd week respectively. All the treated animals were responded, 75%were pregnant and 25% were in regular cycling. The dalmazin (PGF2α) treatment enhanced the reproductive efficiency of the crossbreed cows, which were suffering from luteal cyst. Key words: Luteal Cysts, Dalmazin, Progesterone, Estrogen, GnRH, RIAS. INTRODUCTION The estrus duration of 6 to 24 h with a mean of 15 h in the cattle is designated as d 0, or the start of the cycle. The predominant reproductive hormone during the estrus phase of the cycle is estrogen (Hansel & Echternkamp, 1972). In cows, the estrus period reoccurs after every 21 day but it may range from 17 to 24 days and also this cycle may fluctuate between periods of estrogens (E) to progesterone (P4) dominance. The preparation of uterus and potential coneptus is predominated by progesterone (P4) during the luteal phase. The increase in milk yield for lactating dairy cows is associated with a decrease in fertility (Khan, et al., 2012), concluded that conception rate increase by 16.6% through hormonal therapy followed by fixed time AI in Kundi buffalo under field conditions. In the normal human female the corpus luteum (CL) grows to approximately 1.5 cm in diameter, reaching as stage of development approximately 7 or 8 days after ovulation (Guyton & Hall, 2000). In the cow the growth is completed by days 11-13 of the cycle and mature corpus luteum may have a diameter from 22 mm 30 mm depending on the shapes of the corpus luteum. (Salisbury et al.,1985). A mean time to estrus of 70 and 62 hours respectively was resulted through prostaglandin administration in mid-cycle (day 8 to day 11) and later in the luteal phase (day 12 to 15) (Stevenson et al., 1984). Ovarian cysts are an-ovulatory structures and as long as they persist, cows will remain infertile (Youngquiest & Threlfall, 2007). In some studies, GnRH plus PGF2α was found highly effective in expelling uterine fluid, resolving ovarian cyst and achieving considerable rate of conception (Shah, 2009). The following objectives were determined to accomplish our purpose: 1. To study the estrous cycle of cattle 2. The prevalence incidence of the luteal cyst in the cross breed cows 3. The accuracy of rectal palpation for the diagnosis of luteal cyst 4. The efficacy of Dalmazin for treatment of luteal cyst. MATERIALS AND METHODS The present study was carried out on the crossbreed cows (Sahiwal x Friesian) from a dairy herd at the Multan Diary Farm Vehari Road Multan. Cross breed cows were housed in a tie stall barns and nourish green fodder, cotton seed cake and *Corresponding author: m.zafar1214@gmail.com
232 M. ZAFAR & T.H KHAN BIOLOGIA (PAKISTAN) wheat barn hey and concentrate. The cows after 80-100 days post partum were examined through rectal palpation to check the luteal cysts. These conditions were confirmed by progesterone profile in the blood plasma using RIAs. Rectal Palpation Procedure 1) The cow was restrained by placing it in a tube and scaffold. 2) The cow can be gently touched on the flank or back to make it aware of the palpator's presence and to allow evaluation of the cow's temperament. 3) The disposable palpation sleeve with a tighter-fitting latex glove fitted over the hand was used. 4) The commercially available lubricants were used to lubricate the gloves. 5) By grabbing the tail with the ungloved hand, the gloved hand is inserted into the rectum by joining the fingers and thumb together (cone shape). 6) If there is abundance of feces, it can be removed by the palpator, otherwise the rapid motions are avoided which can cause intake of air in rectum and also shifting rectum balloon outward. Collection of Blood Sample Disposable syringes were used to collect blood samples from jugular vein for three week from the post partum animals for the analysis of the plasma progesterone level after regular interval of one weak. These blood samplings were also repeated after the treatment of Dalmazin (1ml). Heparin was used as an anticoagulant. One ml of heparin was mixed in 100 ml of 1% saline solution. In each test tube mixed 1 ml of heparin solution and 5 ml of blood sample. Then these blood samples were centrifuged for 10-15 minutes at 3000rpm. The serum was harvested with the help of micropipette. The serum was analyzed by radio immune assay (RIAs). Progesterone Assays Procedure By using RIAs, progesterone concentration in blood sample was determined as described by Hoffmann. At a room temperature (25 0 C) all reagents were mixed thoroughly by gentle inversion before use. In appropriate tubes with pipette 25µl of the standards controls and 500µl of progesterone (I- 125) reagent were added. After shaking the test tubes gently by hand, the tubes were incubated in a water bath at 37±2 0 C for 60-70 minutes. Except total count tubes, decant all tubes and simultaneous inversion with a sponge rack in to a radioactive waste receptacle. For complete drainage, stroke the tubes sharply on absorbent material for a minimum of 2 minutes. Furthermore, for one minute count all tubes in gamma counter and then dispose off all non-radioactive and nonhazardous reagents by flushing with large amounts of water to prevent buildup of chemical hazards in plumbing system. Statistical Analysis SPSS was used for the calculation of means (standard descriptive statistics) and the results were described as mean ± SEM and percentage. Furthermore, one way ANOVA by using SPSS was performed to compare the different type of means from various parameters. In this test P<0.05 was considered as statistically significant. RESULTS The results of the 323 crossbreed cows were investigated, 65 (20.12%) failed to show visible sign of estrous up to 90 days post partum. The incidence of post partum disorders were based on rectal palpation such as the luteal cyst 15 (4.64%), anoestrous 13 (4.02%), corpus luteum 12 (3.71%), persistent corpus luteum 12 (3.71%), follicular cyst, 11 (3.40%), and cystic ovary 2 (0.61%) (Fig., 1). Fig., 2 explained the plasma progesterone profile in the blood before treatment. Blood samples of each cow were taken for three consecutive weeks. The concentration of the progesterone in the blood was 1.44±0.44 ng/ml, 1.12±0.56 ng/ml and 0.56±0.23 ng/ml during 1 st, 2nd and 3 rd week respectively. The eight animals were identified as having luteal cyst. They were treated with Prostaglandin F2α analogue Dalmazin (Dextrorotatory cloprostenol) Fatro Pharmaceutical 2ml (i/m). There was no difference in the plasma progesterone concentration during the study period (P>0.05). The treatment with Dalmazin (PGF2α) changed the plasma concentration of progesterone and it was 1.25±0.47 ng/ml, 3.88±0.88 ng/ml and 6.03±1.91 ng/ml during 1 st, 2nd and 3 rd week respectively (Fig., 3). The progesterone concentration was significantly
VOL. 60 (2) THE EFFECTS OF DALMAZIN ON LUTEAL CYSTS 233 different during different week (P < 0.5) after treatment. Eight animals were treated with Dalmazin (Dextrorotatory cloprostenol). All animals 8(100%) were responded. The 6(75%) animals became pregnant. The remaining 2(25%) were exhibited in regular cycling process. Table I represent the effect of Dalmazin (Dextrorotatory cloprostenol) treatment with according to age (years), body weight (kg) relationship. The three animals at the younger age (three year) with body weight of 193.3 kg showed response after 17.6 days of treatment. The animals at age of four year, body weight 160 kg showed response 32 days past treatment. The animals of six years old with a body weight of 270 kg showed response after 32 days of treatment. The 11 years old cow with a body weight of 300kg represented response after 37 days post treatment. The animals at the age of 12 years with a body weight of 280 kg give response after three days and the cows at the of 14 years with body weight of 315 kg represents the response after 10 days. Table II & Fig., 4 explained the average birth body weight, puberty weight, and milk yield and lactation length. The mean birth body weight and puberty weight was 22.59±0.71 and 2.78.65±1.69 kg respectively. The milk yields at different stages of lactation have been presented in Table II & Fig., 5. The over all lactation period in these animals was 208.95±3.74, 256.36±9.44 and 290.53±9.45 days during 1 st, 2 nd and 3 rd lactation respectively. The mean production of the milk was 1614.12± 58.74, 2312.06± 66.87 and 2656.53±94.99 litters during 1 st 2 nd and 3 rd lactation respectively. The milk yields increased with the increase in lactation number. It represents that 1 st lactation has a low milk production than the 2 nd and 3 rd lactation number. Prevalence % 5 4 3 2 1 0 Luteal cyst Anoestrus Corpus Luteum 4.64 4.02 3.71 3.71 Incidences Persistant Corpus Luteum Cytic Ovary Follicular Cyst 0.61 3.4 Fig., 1: The overall prevalence of cystic ovarian disease in the crossbreed cows at Multan Dairy Farm Vehari Road Multan. Progesterone % 2 1.5 1 0.5 0 1.4 1.12 0.56 1st Week 2nd Week 3rd Week 1st Week 2nd Week 3rd Week Fig., 2: The Plasma Progesterone concentration before treatment at Multan Dairy Farm. Progesterone % 8 6 4 2 0 1st Week 2nd Week 3rd Week 1st Week 2nd Week 3rd Week Fig., 3: The Plasma Progesterone concentration after treatment with Dalmazin (PGF2α) at Multan Dairy Farm. Kilogram 300 250 200 150 100 50 0 22.59 Birth Body Weight 278.65 Puberty Weight Birth Body Weight Puberty Weight Fig., 4: Average Birth Body Weight & Puberty Weight in Cross Breed Cows. 1614 2312 2657 Milk Yield (Ltr) 209 2564 290.5 Lacation Length (Days) 1st Lactation 2nd Lactation 3rd Lactation Fig., 5: The comparison of the milk production and lactation period in the cross breed cows at Multan Dairy Farm Vehari Road Multan.
234 M. ZAFAR & T.H KHAN BIOLOGIA (PAKISTAN) Table No. I: The effect of Dalmazin treatment in the crossbreed cows suffering from luteal cyst of different body weight and age at Multan Dairy Farm Vehari Road Multan. Sr. No. Breed Age (Year) Weight (kg) Date of last Calving Day after which animal responded Pregnancy result No. of Calving 1 ¾ 3 170 Y S 11 After 1 Service Y S 2 5/8 3 200 Y S 08 After II Y S 3 ½ 3 210 Y S 34 After II Y S 4 ¾ 4 160 Y S 32 After I Y S 5 5/8 6 270 10/1/03 32 After I 02 6 5/8 11 300 23/1/03 37 After II 06 7 ½ 12 280 3/1/03 03 After I 05 8 5/8 14 315 1/3/02 10 After I 08 Table No. II: The comparison of the milk production and lactation period in the crossbreed cows at Multan Dairy farm Vehari Road Multan. Birth Body Weight Mean ±SEM Puberty Weight Mean ±SEM Milk Yield (Litters) Mean ±SEM Lactation Length (Days) Mean ±SEM 1 st Lac. 1614.12±58.74 208.95±3.74 22.59±0.71 278.65±1.69 DISCUSSION The important feature of present study was to demonstrate the luteal cysts and the effect of Dalmazin (Dextrorotatory cloprostenol) in cross breed cows. The current study illustrate that the generally prevalence of cystic ovarian disease was 20.12% in this cross breed animals. Barlett et al. (1986) has reported that ovarian cysts in dairy cows vary form 10-13% and herds may have a greater incidence (30 to 40%) for brief periods (Archibald & Thatcher, 1992). Only 8 cases out of 18 cases (44.44%) were correctly diagnosed through rectal palpation of clinical forms of luteal cyst by progesterone analysis and this is supported by previous studies where misdiagnoses of ovarian function ranged from 20 to 50% (Grunert, 1993). Grunert (1993) has described rectal palpation as the main method for clinical evaluation of ovarian activity in dairy herds also described that it may cause high proportion of misdiagnosis in incorrectly treated animals. But according to Pieterse et al. (1990), ultrasound scanning can be used to avoid misdiagnosis and progesterone 2 nd Lac 2312.06±66.87 256.36±9.44 3 rd Lac. 2656.53±94.99 290.53±9.45 determination in milk or blood. Even for an experienced practitioner, rectal palpation can create difficulties to differentiate between follicular and luteal cyst (Farin et al., 1992). However, with identification of greater than 90% of luteal and about 75% of follicular cysts, use of transrectal ultrasonography can generate accurate diagnosis (Farin et al., 1992). Follicular and luteal cysts also can be classified based on serum progesterone profile (Farin et al., 1992).The mean (se) plasma progesterone concentration was lower in the cows with follicular cysts than in those with luteal cysts (0.29 [0.05] v 3.90 [0.63] ng/ml; P<0.05) (Douthwaite & Dobson, 2000). Administration of PGF2α can induce the regression of luteal cysts (Nanda et al., 1998). In present study the occurrence of the luteal cyst was found to be 8 (44.44%) of the 18 cases were correctly diagnosed by plasma progesterone profile in the blood. Booth (1988) indicated the progesterone assay that the diagnosis was correct in 54 per cent of the luteal cases in diary cow. The reported data indicates that the percentage of luteal cyst is greater than our study cross breed cows. The thick walled, fluid filled
VOL. 60 (2) THE EFFECTS OF DALMAZIN ON LUTEAL CYSTS 235 structure and 25mm in diameter luteal cysts secrete progesterone in normal or above normal amounts. Mostly these luteal cysts are formed through luteinization of follicular cysts (Garverick, 1997) which cause infertility when it maintains systemic progesterone at concentrations that inhibit that LH surge and ovulation. In heifers, during the estrous cycle and early pregnancy, 79% of otherwise normal CL contains cavities ranging from less than 2 to greater than 10mm in diameter observed through ultrasonographic examination. Luteal cysts had thicker walls (5.3 [0.04] v 2.5 [0.2] mm; P<0.0001), and the wall thickness of all the cysts was positively correlated with plasma progesterone concentration (r=0.52, P<0.0004). Cows with luteal cysts had more additional follicles greater than 5 mm in diameter (P<0.01). In cows with follicular cysts and other follicles greater than 5 mm in diameter, the mean oestradiol concentration was 7.9 (1.8) pg/ml compared with 24.2 (3.1) pg/ml (P=0.002) in cows without other follicles greater than 5 mm in diameter on either ovary (Douthwaite & Dobson, 2000) The current study showed that the prostaglandins were luteolytic agent in the cross breed cows as confirmed by Lauderdale (1972). An effective treatment for ovarian cysts is the use of injections of both GnRH and PGF2α called Ovsynch; a protocol for synchronizing ovulation in lactating dairy cows (Pursley et al., 1997). To synchronize estrus manifestations and improve the use of biotechnologies, prostaglandins are widely used. These prostaglandin causes corpora luteal to regress during the restriction phase of the estrous cycle, where the CL is responsive to consequent decrease in the levels of progesterone and estrous manifestations occurrence followed by ovulation often 2 to 5 days of the administration (Nebel & Jobst, 1998). In the present study the pregnancy rate was 75 percent in the luteal cyst disorder animals after treatment. The percentage of the regular cycling was 25%. While the early reports show 50 per cent pregnancy rate (Douthwaite & Dobson, 2000. It was cleared that the pregnancy rate in the present study was greater than reported in the literature. The percentage of the responded animal was hundred percent in the current study, while Booth (1988) reported that 74 per cent of the confirmed cystic cases responded to treatment within two weeks. This difference may be due to the follow up periods as this was 37 day in the present study. The data on the lactation milk yield was 1614.12 ± 58.74, 2312.06 ± 66.87 and 2656.53±94.99 litters during 1 st, 2 nd and 3 rd lactation number respectively. The overall average lactation period in these animals was 208.95±3.74, 256.36±9.44 and 290.53±9.45 days during 1 st nd and 2 3 rd lactation number respectively. It was observed that with the increase of milk yield level the lactation period was also increased. In conclusion the incidence of postpartum disorders studies by rectal palpation were 15 (4.64%), follicular cyst, 11 (3.40%), corpus luteum 12 (3.71%), persistent corpus luteum 12 (3.71%), Anoestrous 13 (4.02%), and cystic overy 2 (0.61%) in the cross breed cows. The results of the rectal palpation were confirmed by plasma progesterone concentration. The concentration of the progesterone before treatment in the blood was 1.44±0.44 ng/ml, 1.12±0.56 ng/ml and 0.56±0.23 ng/ml during 1 st, 2nd and 3 rd week respectively. The 8 cows were found as heaving luteal cyst. These were treated with Prostaglandin F2α analogue Dalmazin (Dextrorotatory cloprostenol). The treatment with Dalmazin (PGF2α) changed the plasma concentration of progesterone and it was 1.25±0.47 ng/ml, 3.88±0.88 ng/ml and 6.03±1.91 ng/ml during 1 st, 2nd and 3 rd week respectively. All the treated animals were responded, 75%were pregnant and 25% were in regular cycling. The dalmazin (PGF2α) treatment enhanced the reproductive efficiency of the crossbreed cows, which were suffering from luteal cyst. REFERENCES Archibald, L.F., & Thatcher, W.W., 1992. Ovarian follicular dynamics and management of ovarian cysts. In: Large Dairy Herd Management. Van. Horn, H.H. Wilcox, C.J., eds. Am. Dairy Sci. Assoc., Champaign, II. Bartlett, P.C., Ngategize, P.K., Kaneene, J.B., Kirk, J.H., Anderson, S.M. & Mather, E.C., 1986. Cystic follicular disease in Michigan Holstein-Friesian Cattle. Incidence, descriptive epidemiology and economic impact. Prev. Vet. Med., 4: 15-19. Booth, J.M., 1988. The milk progesterone test as an aid to the diagnosis of cystic ovaries in dairy cows. Vet. Res. 123: 437-439. Douthwaite, R. & Dobson, H., 2000 Comparison of different methods of diagnosis of cystic ovarian disease in cattle and an assessment of its treatment with a progesterone-releasing intravaginal device. Vet. Res. 147: 355-359
236 M. ZAFAR & T.H KHAN BIOLOGIA (PAKISTAN) Farin, P.W., Younguist, R.S., Parfet, J.R. & Garverick, H.A., 1992. Diagnosis of luteal and follicular ovarian cyst by palpation per rectum and linear array ultrasonography in diary cows. J. Am. Vet. Med. Assoc., 200(8):1085-9. Garverick, H.A., 1997. Ovarian follicular cysts in dairy cows. J. Dairy Sci., 80: 995-1004. Grunert, E., 1993. Der einflub der hochliestung auf gesundheit und fruchbarkeit des rindes. Mh. Vet. Med. 48: 239. Guyton, A.C., & Hall, R.B., 2000. Textbook of Medical Physiology. W.B. Saunders, London, Toronto. Harrison, J. H., Hancock, D. D. & Conrad, H. R. 1984. Vitamin E and selenium for reproduction of the dairy cow. J. Dairy Sci., 67: 123-132. Hensel, W., & Echternkamp, S.E., 1972. Control of ovarian function in domestic animals. American Zoologist. 12: 243-255. Khan, Q., Rehman, Z.U., Samo, M.U., Raziq, A., Khan, F.A., Younus, M., Samo, F.H. & Muhammad, D., 2012. The effect of PGF2. Analogue with or without GnRH on Fertility rate of Anestrus Kundhi Buffalo. J. Anim. Sci., 22(2): 51-54. Lauderdale, J.W. 1972. Effects of PGF2α on pregnancy and estrous cycle of cattle. J. Animal. Science 35: 246(abstr.). Nanda, A.S., Ward, W.R. & Dobson, H., 1998. Retrospective analysis of the efficacy of different hormone treatments of cystic ovarian disease in cattle. Vet. Res. 122: 155-159. Nebal, R.L. & Jobst, S.M., 1998. Evaluation of a systematic breeding programs for lactating dairy cows: a review. J. Dairy Sci., 81:1169-1174. Pieterse, M.C., Taverne, M.A.M., Kruip, T.A.M. & Willemse, A.H., 1990. Detection of corpora lutea and follicles in the cows A comparison of transvaginal ultrasonography and rectal palpation. Vet. Res. 156: 552-554. Pursley, J.R., Wiltbank, M.C., Stevenson, J.S., Ottober, J.S., Garverick, H.A. & Anderson, L.L., 1997. Pregnancy rate per artificial insemination for cows and heifers inseminated at a synchronization ovulation or synchronized estrus. J. Dairy Sci., 80: 295-300. Salisbury, G.W., Demark, N.L. Van., & Lodge, J.R., 1985. Physiology of reproduction and artificial insemination of cattle. CBS publisher and distributors, New Dehli. Shah, A.K., 2009. Persistent Tympany Associated with Hydrometra in a Cow. Vetscan., 4(2). Stevenson, J.S., Schmidt, M.K. & Call, E.P., 1984. Stage of estrous cycle, time of insemination, and seasonal effects on estrous and fertility of Holstein heifers after prostaglandin F2α. J. Dairy Sci. 67: 1798-1805. Youngquisy, R.S. & Threlfall, W.R., 2007. Ovarian Follicular Cysts. Current Therapy in Large Animal Theriogenology. St. Loius, MO: Saunders Elsevier, pp:379-383.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 237-242 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Isolation and Characterization of Pseudomonas Species Associated with Tomato Wilt MUHAMMAD ASHFAQ, *AMNA ALI, ANUM NAWAZ, UZMA BASHIR, MUHAMMAD SALEEM HAIDER & MUHAMMAD ALI Institute of Agricultural Sciences, University of the Punjab, Quaid-E-Azam Campus, Lahore, Pakistan ABSTRACT Bacterial wilt is an extremely serious plant disease of tomato and other crops. Infected plants wilt rapidly and often die. The disease is caused by a soil bacterium Pseudomonas and infects plants through the roots. The causal agent of tomato wilt (Pseudomonas species) was identified from the collected eleven varieties of tomato plant. A total of eleven local types of tomato were sown in different baked clay pot in a nursery and then transplanted in different lines. Diseased tomato samples were collected by simple and random collection techniques. The growth of pathogen was carried out on different specified culture media viz., triphenyl tetrazolium chloride (TTC) and yeast peptone glucose agar. The bacterial isolate was characterized by morphological, biochemical tests and its phytopathogenicity was verified by simple Rapid Streaming test. Key words: Characterization, bacteria, tomato, disease diagnose INTRODUCTION In Pakistan, plant diseases caused by phytopathogenic bacteria are a major problem that has an impact on valuable agricultural crops causing decrease in yield potential annually. Tomato plant (Lycopersicon esculentum L.) is a vegetable well known for its high nutritional value rich in vitamins A and C and by its favorable influence on kidney function and digestive tract (Hernandez et al., 2008; Olaniyi et al., 2010). Tomato is one of the most important greenhouse and field grown vegetables in Pakistan. Usually, tomato plants are severely affected by pathogenic bacteria that cause total defoliation or diseases in tomato besides it also affect hardly/strongly on photosynthesis and production potential of plant (Perez et al., 1995; Bashan & De Bashan, 2002). One of these diseases is bacterial wilt, the most complex and deadly soil borne vascular bacterial disease problem found in tomato growing plants. Not only decreases yield of plants through foliar necrosis, but it also blemishes the fruits and renders them unsuitable for the fresh market (Bashan & De Bashan, 2002). This disease caused by the pathogen, Pseudomonas species; it is a highly heterogenous bacterial pathogen that causes wilting of many important plants (Rico & Preston, 2008). Bacterial diseases were mostly disseminated by water, therefore bacteria has the potential to move through plug greenhouses very quickly; thus, infested seedlings could become an important inoculums source for field epiphytotics (Schneider & Grogan, 1977). Consequently, bacteria can survive up to 20 years in the crevices and cavities of the coat of tomato seeds causing bacterial wilt, a disease characterized by rapid plant death without yellowing or spotting of the foliage (Bashan et al., 1991). Moreover, bacterial wilt infected plant become flaccid by invading and gradually blocking the vascular tissue (Cuppels & Elmhirst, 1999). The main objectives of this study were to: (1) identify isolated bacterial species on the basis of various morphological features and (2) identify isolated bacterial species on the basis different biochemical tests. MATERIALS AND METHODS Collection of Tomato Seeds Seeds of 11 Local varieties of tomato were collected from Punjab Seed Corporation Lahore (PSCL) and Ayub Agricultural Research Institute (AARI) Faisalabad (Table I). *Corresponding author: write2amna@gmail.com
238 M. ASHFAQ ET AL BIOLOGIA (PAKISTAN) Table I: List of Tomato varieties and their parts used for the study. Sowing Date Seed variety Parts used Source Rio-grande The entire plant (leaf+stems+root) AARI, Faisalabad New-Yarker The aerial parts (stem+leaf) AARI, Faisalabad Waya-Head Leaves AARI, Faisalabad 2 nd November -2012 Sowing Nursery and Transplantation Siberian The aerial parts (stem+leaf) AARI, Faisalabad Gruschowka The aerial parts (stem+leaf) AARI, Faisalabad Pakit The aerial parts (stem+leaf) AARI, Faisalabad Oregonspring Leaves AARI, Faisalabad Naqeeb The aerial parts (stem+leaf) AARI, Faisalabad Roma The aerial parts (stem+leaf) AARI, Faisalabad Nagina The aerial parts (stem+leaf) AARI, Faisalabad Super-special Leaves PSCL, Lahore Seeds of eleven local varieties of tomato were sowed in separate earthen pots to be grown up to nursery and then transplanted in separate rows. Transplantation of tomato plants was made 20 days after germination, in variety wise in separate rows of ridges, taken from nursery earthen pots, and tags containing their variety name sowing date etc, were fixed for each variety, under known condition of soil and water in IAGS fields in November-2012, on one side of their respective rows. Symptoms of bacterial wilt were monitored daily. No symptoms were found in any variety till the month of April. Tomato Plants for Disease Diagnosis Total eleven varieties of tomato plant were planted in experimental area of Institute of Agricultural Sciences, University of the Punjab Lahore. Simple random sampling technique was adopted for collection of wilted samples. On observance of symptoms in the field, wilted samples were collected in polythene bags and transported to laboratory for diagnosis the disease. The method of pathogen identification in wilted samples was performed. The presence of bacterial pathogen in stems of wilted tomato plants was indicated by the simple Rapid Streaming test. Stem was cut just above the soil level. The cut surface was suspended in a tube of clean water. Characteristic spontaneous streaming of threads of bacterial slime coming from the cut vascular bundles after few minutes was observed. Isolation of Bacterial Pathogen from Collected Samples The tomato plant tissues were collected at the flowering stage. Five infected plants from each variety were carefully removed, washed under tap water to remove soil. Stems and roots were cut into sections of 2-3 cm long. Infected sections were rinsed with distilled water and drained in large beaker. Afterward it was soaked in 70% ethanol for 30 seconds subsequently sterilized with 0.1% HgCl 2 for 5 minutes for stems and 3 minutes for roots and nodules. Tissues were washed ten times with sterile water (Pham & Annapurna, 2004). Later on homogenize mixture was prepared by maceration of surface-disinfected tissues aseptically. Moreover, serial dilution was made by diluting macerated tissue in 9 volumes of sterile distilled water for 10-1 dilution followed by 1 ml of well-shaken suspension and adding into 9 ml water blank tubes for 10-6 dilution. After that, inoculation was done on plate by spreading 100 µl of each dilution on two different specified media, viz. triphenyl tetrazolium chloride (TTC) and yeast peptone glucose agar (YPGA) and incubated for 48 hours at 28±30 o C.
VOL. 60 (2) STUDY OF PSEUDOMONAS SPECIES 239 Morphological and Physiological Characterization of Pathogen Bacterial identification was carried out by observing the morphological and physiological characters viz., colony colour, colony morphology, cell shape, cell colour, motility and growth pattern. Bacterial colonies were purified followed by subjected to Gram staining and characterized using biochemical tests (catalase, oxidase, utilization of citrate, nitrate reduction, mannitol, indole and arginine tests) and consulting the pertinent literature (Benson, 1996; Holt et al., 1997; Kvitko, 2009). Koch Postulates For the pathogenicity tests, leaves of eleven varieties of tomato plants were inoculated by injection with a bacterial suspension (108 colony forming units (CFU ml -1 ). After inoculation, detached leaves were incubated on Petri plates containing 20 ml of TTC and YPGA media with rifampicin (50 μg ml -1 ) at 28 C. Disease development on tomato leaves was evaluated 7 days after inoculation. Re-isolations and identification were made from the diseased plants. Sterile distilled water was used as a negative control. plant samples used in the present study presented the symptoms of Bacterial wilt on leaves and stem, appearing as small black lesions surrounded by a yellow halo. After thorough washing, this material was used to isolate the pathogenic bacterial species. The resulting bacterial suspension was spread on TTC and YPGA media plates. After 24 h incubation at 28 C, circular bacterial colonies were observed on the media surface. Both microbiological features and plant disease symptoms are identical to those described in other studies on strain pathogenicity (Cuppels & Elmhirst, 1999; Preston, 2001; Bashan & De-Bashan, 2002). Identification of Bacterial Species According to the description of Bergey s Manual of Systematic Bacteriology (Vos, 2009), the bacterial isolate appeared to be a Pseudomonas species. Thereby, a set of specific identification tests based on morphological and biochemical characters were carried out, as described by previous literature (Bouchra et al., 2013). Thereby, a set of specific identification tests were carried out, as described by Lelliott & Stead (1987). Table 3 summarizes the results obtained. Besides, bacterial cells were Gram negative, motile, mannitol negative and oxidatively metabolized glucose. Moreover, the results revealed that the bacterial isolates showed growth on nutrient agar (N.A) medium (supplemented with 5%, w/v, glucose) and exhibit positive reaction in the presence of 3% Hydrogen peroxide (H 2 O 2 ) solution. However, oxidase and arginine activity were absent in all bacterial isolates. All these identifying features show that the isolates correspond to Pseudomonas species. Similar strategy and microbiological tests were used by Milijasevic et al. (2009) for the identification of Pseudomonas isolates from Eastern Europe. Fig., 1: Collection of Tomato wilt samples from field, Symptom of browning of vascular bundle in tomato stem and Rapid Streaming Test RESULTS AND DISCUSSION Plant Disease Symptoms and Isolation of Phytopathogenic Bacterium Bacterial wilt is one of the most common bacterial diseases of growing tomato plants. All Fig., 2: Pure culture of Pseudomonas species and its gram negative rod shaped cells
240 M. ASHFAQ ET AL BIOLOGIA (PAKISTAN) Pathogenicity Tests The pathogenicity of each field isolate should normally be checked before assigning it to a pathovar (Bultreys & Kaluzna, 2010). Disease development on tomato leaves was evaluated 7 days after inoculation (10 8 CFU ml -1 ) with Pseudomonas sp. All infected plants showed the same first symptoms (moist spots), and after 5 days the spots became dark-brown with chlorotic halos, corresponding to the typical symptoms of bacterial wilt. No symptoms appeared on control leaves injected with distilled water. All re-isolated bacteria were identified as Pseudomonas sp. and eventually stored at -20 C. Similar results of pathogenicity tests on tomato leaves, pepper leaves, and immature tomato and pepper fruits were reported by Bouchra et al. (2013). Likewise, data by Milijasevic et al. (2009) indicate similar effects of other pathogenic bacteria on plant infected tissues after 4 days. Table II: Morphological and biochemical features of the bacterial isolate. Identification Features Morphological characters Result Biochemical tests Results Cell color Pink Mannitol activity -ve Cell shape rod Oxidase activity -ve Gram type -ve Catalase activity +ve Motility +ve Arginine activity -ve Growth on N.A + 5% glucose +ve Indole activity -ve Capsule +ve Citrate utilization activity -ve Grow at 28 0 C +ve Nitrate reduction activity -ve The present study revealed the widespread nature and high incidence of bacterial wilt in tested varieties of tomato plants. The bacterial wilt pathogen, Pseudomonas species was commonly associated to diseased plants and seeds as well as to soil samples taken in the affected fields. The high incidence of bacterial wilt indicates that bacterial wilt is a recurrent problem in Pakistan and that all popular varieties appeared to be susceptible to the disease (Burney et al., 1999). The incidence of the disease could in fact be higher as no attempts were made to isolate the pathogen from plants without symptoms. Assessment of the presence of pathogen in plants merely by scoring of disease symptoms and CFUs often gives only a superficial picture of the actual invasive properties of this organism. Latency of infection has been reported in tomato (Graham & Lloyd, 1978). The consequence of symptomless invasion of tomato plants by Pseudomonas is, without doubt, an important means for the survival of the pathogen resulting in the potential for infestation of soil and other plants. Bacterial wilt was easily distinguished from fungal wilt based on the brown discoloration of the vascular tissues, and in the profuse bacterial ooze observed when cut sections of the stems were placed in clear water. The morphological characteristics of the bacteria on TTC agar medium, physiological, biochemical characterization results and pathogenicity test results confirmed the identity of the pathogen as Pseudomonas species (Kelman 1954). In the present study, Pseudomonas was easily detected by the rapid streaming method. TTC agar medium proved to be useful also in the detection of pathogen from tomato plants (Kelman 1954). Pseudomonas on or in the seed may provide to be a potentially dangerous source of inoculum and play a role in the perpetuation of bacterial wilt in tomato crop production of small farm holders in Pakistan. Conclusion In this study we presented a basic method for detection and identification of the phytopathogenic bacterium Pseudomonas species isolated from tomato plant with their pathogenicity test. The diversity and characterization of different bacterial species that isolated from diverse tomato germplasm lines tells us about the association
VOL. 60 (2) STUDY OF PSEUDOMONAS SPECIES 241 between them with specific relation to the environment and crop genetics. This study may also equally helpful for the scientist and farmers community for the classification (on the basis of resistant, tolerant and susceptibility of tomato genotypes against various pathogens and also provides the information for further investigation in to new insight in scientific field. Acknowledgment The authors would like to thank the Director, Institute of Agricultural Sciences (IAGS), University of the Punjab, Quaid-e-Azam campus, Lahore, Pakistan, for the research work carried out in the bacterial lab of Fungal Culture Bank and Director Ayub Agricultural Research Institute (AARI) for providing us the research material. We are highly thankful to the University Grant Commission (University of the Punjab) for the financial support of this research work REFERENCES Bashan, Y. & De-Bashan, L.E., 2002. Protection of tomato seedlings against infection by Pseudomonas sy- ringae pv. tomato by using the plant growth-promoting bacterium Azospirillum brasilense. Appl. Environ. Microbiol., 68: 2637-2643. Bashan, Y., Hanna, L. & Robert, E.W., 1991. Root surface colonization of non-cereal crop plants by pleomorphic A zospirillum brasilense Cd. J. General Microbiol., 137: 187-196. Benson, H.J., 1996. Microbiological applications, laboratory manual in general microbiology. W. M.C. Brown Publishers, Dubuque, U.S.A. Bouchra E., Abderrazak, E., Aurelio, S. & Abdelaziz, S., 2013. Antibacterial activity of plant methanolic extracts on a field isolate of Pseudomonas syringae pv tomato from the casablanca region (Morocco). Adv. Biosci. Biotechnol., 4: 1-9. Bultreys, A. & Kaluzna, M., 2010. Bacterial cankers caused by Pseudomonas syringae on stone fruit species with special emphasis on the pathovars syringae and mor- sprunorum race 1 and race 2. J. Plant Pathol., 92: S1- S21. Burney, K., Roshan, Z. & Iftikhar, A., 1999. Bacterial wilt caused by Pseduomonas solanacearum in Solanaceous crops of Pakistan. Proc. 2 nd National Conference of Plant Pathol., pp: 27-29. Cuppels, D.A. & Elmhirst, J., 1999. Disease develop- ment and changes in the natural Pseudomonas syringae pv. tomato populations on field tomato plants. Plant Dis., 83: 759-764. Graham, J. & Lloyd, A.B., 1978. An improved indicator plant method for the detection of Pseudomonas solanacearum race 3 in soil. Plant Dis. Rep., 62: 35 37. Hernandez, S.M., Rodriguez, R.E.M. & Diaz, R.C., 2008. Chemical composition of tomato (Lycopersicon esculentum) from Tenerife, the Canary Is- lands. Food Chem., 106: 1046-1056. Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T., Stager, T.W. & Winn, J., 1997. Atlas and textbook Street, Philadelphia, PA 19106-3621 USA. Kelman, A., 1954. The relationship of pathogenicity in Pseudomonas solanacearum to colony appearance on tetrazolium medium. Phytopathol., 64: 693-695. Kvitko, B.H., 2009. Deletions in the repertoire of Pseudomonas syringae pv. tomato DC3000 type III se- creation effectors genes reveal functional overlap among effectors. Plant Pathol., 5: 10-38. Lelliott, R.A. & Stead, D.E., 1987. Methods for the diag- nosis of bacterial diseases of plants. Blackwell Scientific Publications, Oxford. Milijasevic, S., Todorovic, B., Rekanovic, E., Potocnik, I. & Gavrilovic, V., 2009. Races and hosts of Pseudomo- nas syringae pv. tomato in Serbia. Arch. Biolog. Sci., 61: 93-103. Olaniyi, J.O., Akanbi, W.B., Adejumo, T.A. & Akande, O.G., 2010. Growth fruit yield and nutritional quality of tomato varieties. African J. Food Sci., 4: 398-402. Perez, G.A,, Canovas, F.M., Gallardo, F., Hirel, B. & Vicente, A., 1995. Differential expression of glutamine synthetase isoforms in tomato detached leaflets in- fected with Pseudomonas syringae pv. tomato. MPMI- Mol. Plant Microbe Interat., 8:96-103. doi:10.1094/mpmi-8-0096. Pham, Q.H. & Annapurna, K., 2004. Lsolation and characterization of endophytic bacteria in soybean (Glycine sp.). Omonrice, 12: 92-101. Preston, G.M., 2001. Pseudomonas syringae pv. tomato: The right pathogen, of the right plant, at the right time. Mol. Plant Pathol., 1: 263-275.
242 M. ASHFAQ ET AL BIOLOGIA (PAKISTAN) Rico, A. & Preston, G.M., 2008. Pseudomonas syringae pv. Tomato DC3000 uses constitutive and apoplast-induced nutrient assimilation pathways to catabolize nutrients that are abundant in the tomato apoplast. Mol. Plant Microbe Interact., 21: 269-282. Schneider, R.W. & Grogan, R.G., 1977. Bacterial speck of tomato: sources of inoculum and establishment of a residentpopulation. Phytopathol., 67: 388-394. Vos., P., 2009. Bergey s manual of systematic bacteriology: Volume 3, the firmicutes. Springer, Berlin.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 243-247 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Characterization of Algal Oils and Their Potential as Biofuel in Pakistan ABU BAKAR MUHAMMAD 1, *UZMA HAMEED 1, IKRAM-UL-HAQ 1 & MALIK BADSHAH 2 1 Institute of Industrial Biotechnology, GC University, Katchery Road, Lahore, Pakistan 2 Department of Microbiology, Quaid-i-Azam University, Islamabad, Pakistan ABSTRACT Biodiesel is becoming increasingly attractive fuel because of its ecological advantages. Algae are the fastestgrowing plants on the earth and macroalgae are rich in storage lipids that have potential to be converted to biodiesel. In the present study, three high oil yielding, naturally occurring algal species i.e., Cladophora sp. Spirogyra sp. and Oedogonium sp. were collected and their potential was evaluated for oil yields and characterized for lipids composition. Biomass from three different algae was obtained by cultivating in the individual aquarium for about three months. The oil was extracted by solvent extraction method using soxhlet apparatus. These oils were analyzed for lipid contents using thin layer chromatography. Among all the oils extracted from these algae, the lipid contents of Oedogonium sp. were found to be highest. Oil yield of Oedogonium sp. was 26% (based on dry matter) and contained triacylglycerol, free fatty acids and sterol. Algae can be a substitute for oil based fuels and can be grown anywhere i.e., sewage or salt water. Thus, macroalgal oil has potential to be used as biofuel in Pakistan. Key words: Algae, Biodiesel, Energy, Fossil fuel INTRODUCTION Recent energy crisis has shifted the focus to develop eco-friendly and renewable bioenergy resources (Shahir et al., 2014). Owing to the rapid industrialization and ever increasing population, there is an incessant increase in the energy demand (Fazal et al., 2014). The situation has become more alarming due to the exhaustion of worldwide natural fossil fuels. It is expected that the natural resources of oil, natural gas and coal will deplete in year 2044, 2047 and 2117, respectively (Shafiee & Topal, 2009). However, biomass is considered to be the only renewable resource that can replace the carbon based fossil fuels. Biomass based energy includes bioethanol, biodiesel, biomethane and biohydrogen, etc., (Ashnani & Anwar, 2014). Biodiesel is considered to be eco-friendly and carbon neutral fuel as it does not disturb the carbon dioxide cycle (Ahmad et al., 2011; Sharma & Jain, 2010). Biodiesel is monoalkyl ester of fatty acids that are derived through the transestrification reaction of vegetable oils and fats (Shirazi et al., 2014). As a result, biodiesel has a rising market potential, that can be classified according to its enduse applications in: transportation, non-road applications (mining, forestry, construction, etc.), marine and heating (Rincon et al., 2014). Though, vegetables oils are the prominent sources for the production of biodiesel (Wen et al., 2010; Ma & Hanna, 1999) but non-edible and algal oils are preferred due to world food crisis (Haq et al., 2014). Algae are rich in oil and grow rapidly (Guschina & Harwood, 2006; Ito et al., 2013), but lipid contents are variable depending upon source. Some species have been reported to contain up to 60% (w/w) fatty acids of dry weight (Baddiley et al., 1994). The harvest of oil from algae (per acre) is 200 times more compared to the best-performing plant/vegetable (Sheehan et al., 1998). Therefore, algal oil can be the promising source for the production of biodiesel. Even the algal waste after oil extraction can be used as feedstock for anaerobic digestion for the production of biogas as well as biofertilizer. The National Policy of Pakistan encourages the substitution of fuel for transportation and other applications with biofuel to alleviate the energy crisis and meet the objective of environmental protection and climate change. The policy intends to introduce a minimum of 10% biodiesel by the year 2025 (Majeed, 2009). Therefore, there is a need to develop sustainable solution that have no competition with feed directly or indirectly and enhances the economy of the country. This study is aimed to characterize presence of fatty acid, i.e., triacylglycerol (TAG), diacylglycerol (DAG), monoacylglycerol (MAG) and free fatty acid (FFA) found in the oil yielding macroalgae present in Pakistan for using as a feedstock for biofuel production. *Corresponding author: uzmahameed@gmail.com
244 A. B. MUHAMMAD ET AL BIOLOGIA (PAKISTAN) MATERIALS AND METHODS Cultivation of Algae and Microscopic Examination Three different algal species were collected from Botanic Garden, GC University, Lahore Pakistan and were identified by microscopic examination as Cladophora sp. Spirogyra sp. and Oedogonium sp. The starter cultures of these species were cultivated in the individual aquarium with dimensions of 4 10 8 cm 3 containing waste water from fish aquarium having KH 2 PO 4 (0.2 g/l) and NaHPO 4 (0.6 g/l) as major constituents at 25±3 C under natural sunlight for about 3 months to obtain enough algal biomass. Oil Extraction from Algal Biomass Algal biomass was filtered thoroughly using Whattman filter paper (Sigma Aldrich, 2.5 μm) and kept in sunlight for 6-7 h to remove excess water and afterwards was kept in air oven at 100 C for 15 min. Dried biomass was crushed with pestle and mortar. Oils from the algal biomass were extracted using soxhlet equipment by following the procedure of Shahidi (2003). The solvent vessel was washed and 3-4 boiling chips were added in the vessel, which was afterwards dried in a drying oven at 103±2 C for 1 hr. The weight of dried vessel with chips was recorded and 200 ml of extraction solvent i.e., hexane was added. Dried and ground algal mass (40 g) was placed in porous cellulose thimble which was then, loaded into the main chamber of the soxhlet extractor. The Soxhlet extractor was placed onto the flask extraction vessel containing the extraction solvent. The soxhlet was then equipped with the condenser. Lipids were extracted at 70 C. After completion of extraction of (5-6) h, the solvent was removed from the extracted oil in the rotary evaporator. Total mass of lipids extracted from algae were estimated using following formula. Mass of lipids extracted = (wt. of flask+ boiling chips + extracted oil) (wt. of flask + boiling chips) Lipid contents in algae were calculated as below: Oil (lipids) contents (%) = mass of lipids extracted (g) / mass of algae (g) 100 TLC Analysis In order to determine the lipid composition of the algae, a thin layer chromatography was carried out. Oil samples of (30 μl) were carefully spotted onto silica gel plate (Merck 8 6.5 cm). The mobile phase consisted of solvents having chloroform, hexane and methanol. The ratio (based on volume) of chloroform: hexane: methanol were 8:6:1, respectively. The plate was placed in the mobile phase for about 45 min for the movement of mobile phase and samples moved by capillary action. The spots were pictured by spraying the plate with 10% (v/v) H 2 SO 4 in ethanol and heating on a hot plate until charring occurred (Patil et al., 2011). Measurement of R f The distance covered by substance and mobile phase was measured and R f value was calculated as follows: R f = Distance travelled by visualized spot/ Distance travelled by solvent front RESULTS AND DISCUSSION In the present study, three macroalgae species that are abundantly distributed in the Pakistan were used for the evaluation of oil yield and lipids composition by using thin layer chromatography. Microscopic Identification The algae were identified microscopic examination. Cladophora is reticulated filamentous green algae, grows as microscopic thin, hair-like threads. It has multinucleated cells containing oval shaped reticulated, pyrenoid-packed chloroplasts. Genus spirogyra is a multicellular green algae and contains cellulosic cell wall. Long unbranched filaments are surrounded by slime. In each cell a large, coiled shaped chloroplast, containing numerous pyrenoids is also present along with large vacuole. Oedogonium is also a multicellular filamentous algae containing convulated Chloroplast (one or more pyrenoids located in the chloroplast). The oil extraction was carried out with n- hexane by soxhlet extraction method using solvent. Among all three algae, maximum oil yield (26% which corresponded to 31.70 kg/acre/anum of dry matter) was obtained from Oedogonium sp. However, the oils extracted from Spriogyra sp. and Cladophora sp. on dry matter basis was 16.20 % and 20.64 % which corresponded to 26.0 and 29.16 kg / acre / annum, respectively (Table I).
VOL. 60 (2) ALGAL OILS AND THEIR POTENTIAL AS BIOFUEL 245 Table I: Oil yields from three selected macroalgae species Treatment Dry Weight(g) Oil extracted (g) Oil Yield (%) Oil yield (Kg/ acre/ anum) Cladophora sp. 443 72.6 16.20 29.16 ± 0.5 Spirogyra sp. 310 64.0 20.64 26.0 ± 0.7 Oedogonium sp. 300 78.0 26.0 31.70±0.2 Table II: R f values obtained by TLC analysis of lipid contents of different algal oils Neutral lipids Monoacylglycerol and diacylglycerol Standard R f values R f values obtained for oils Cladophora Spirogyra Oedogoniu m 0.083 0.105 0.087 - - Cholesterol (sterol) 0.167 0.298 0.19 0.245 0.245 Free fatty acids 0.315 0.500 - - - Triacylglycerol 0.670 0.742-0.42 0.50 There are many microorganisms which have the ability to accumulate oils under some special growth conditions (Li et al., 2008; Doan et al., 2011). Berglund et al. (2001) reported that both the quantity and quality of lipids produced will vary with the identity of the algal species. The fatty acid proportion in algal cell varied and depended on growth conditions (Cohen, 1988; Thompson et al., 1990) e.g. environmental or culturing parameters such as light intensity, growth phase, photoperiod, temperature, salinity, CO 2 concentration, nitrogen and phosphorous concentration (Wu et al., 2011). These oils were analyzed for lipid contents using TLC (Fig., 1). The results of fatty acid composition of algal oil with respect to their Retardation factor (R f ) values are given in Table II. The R f of the bands indicated the presence of triacylglycerols, free fatty acids, diacylglycerol when compared with the standard R fs values of neutral lipids. Oedogonium sp. contained triacylglycerol, free fatty acids and sterol which proved to be the best algal oil for the biodiesel production. Presence of the free fatty acids (FFA) was not observed in the oil extracted from three algae studied. During transesterification presence of the FFA (>1% w/w) caused the side-saponification initiation and as such could not be used for biodiesel production (Hingu et al., 2010; Atadashi et al., 2011). FFA scavenge catalyst and reduce catalyst effectiveness ultimately lowered the yield of biodiesel (Kusdiana & Saka, 2004). However, the 0.56 oil could be pretreated by number of ways to reduce the FFA to less than 1% w/w, and afterwards could be converted to biodiesel by transesterification. Fig., 1 : TLC analysis of lipid contents of algal oils In addition to, the production of biodiesel as chief product from the extracted algal oils, the waste of algal biomass could be anaerobically digested for the production of biogas, thus, making biodiesel production more economical. This excess amount of energy (biogas) could be utilized for domestic purpose or could be sold to improve the economics of integrated system (Chisti, 2007). The growth of algae was not optimized in the present work. The optimization of the growth of algae would certainly enhance the oil yield. Conclusion This research supports the concept that macrolagae present in Pakistan can be a potential
246 A. B. MUHAMMAD ET AL BIOLOGIA (PAKISTAN) source of biofuel as lipid contents ranged from 15-26% (MAG, DAG and TAG). The oil from these algae can be successfully converted into biodiesel by transesterification. Overall regional cultivation of macroalgae processing into biofuels may provide economic benefits to Pakistan rural communities. REFERENCES Ahmad, M., Khan, M.A., Zafar, M. & Sultana, S., 2011. Environment-Friendly Renewable Energy from Sesame Biodiesel. Energ. Source. Part A., 32(2): 189-196. Ashnani, M.H.M. & Anwar, A.J.H., 2014. A source of renewable energy in Malaysia, why biodiesel?. Renew. Sust. Energ. Rev., 35: 244-57. Atadashi, I.M., Aroua, M.K & Abdul Aziz, A., 2011. Biodiesel separation and purification: A review. Renew. Energ., 2(36): 437-43. Becker, E.W., 1994. In "Microalgae: biotechnology and microbiology" Ed. Baddiley, J. et al., 1978 (1994) Cambridge Univ. Press, Cambridge, New York. 178 pp. Berglund, O., Larsson, P., Ewald, G. & Okla, L., 2001. The effect of Lake Trophy on lipid content and PCB concentrations in plank tonic food webs. Ecology., 82(4):1078-1088. Chisti, Y., 2007. Biodiesel from microalgae. Biotechnol. Adv., 25(3): 294-306. Cohen, Z., Vonshak, A. & Richmond, A., 1988. Effect of environmental conditions on fatty acid composition of the red alga Porphyridium cruentum: correlation to growth rate. J. Phycol., 24(3): 328-332. Doan, T.T.Y., Balasubramanian, S. & Jeffrey, O.P., 2011. Screening of marine microalgae for biodiesel feedstock. Biomass. Bioenerg., 35(7): 2534-2544. Fazal, M.A., Jakeria, M.R. & Haseeb, A.S.M.A., 2014. Effect of copper and mild steel on the stability of palm biodiesel properties: A comparative study. Ind. Crop. Prod., 58: 8-14 Guschina, I.A. & Harwood, J.L., 2006. Lipids and lipid metabolism in eukaryotic algae. Prog. Lipid Res., 45(2): 160-186. Haq, Ul, I., Muhammad, A.B. & Hameed, U., 2014. Comparative assessment of Cladophora, Spirogyra and Oedogonium biomass for the production of fatty acid methyl esters. Appl. Biochem. Micro., 50(1): 69-72. Hingu, S.M., Gogate, P.R. & Rathod, V.K., 2010. Synthesis of biodiesel from waste cooking oil using sonochemical reactors. Ultrason. Sonochem., 5(17): 827-832. Ito, T., Sugomoto, M., Toya, Y., Ano, Y., Kurano, N., Soga, T. & Tomita, M., 2013. Time resolved metablomic of a novel trebouxiophycean alga using 13 CO 2 feeding. J. Biosci. Bioeng., 3(116): 408-415. Kusdiana, D. & Saka, S. 2004. Effects of water on biodiesel fuel production by supercritical methanol treatment. Fuel, 80(2): 225-231. Li, Q., Wei, D. & Dehua, L., 2008. Perspectives of microbial oils for biodiesel production. Appl. Microbiol. Biot., 80(5): 749-756. Ma, F. & Hanna., 1999. Biodiesel production: a review. Bioresoure Technol., 70(1): 1-152. Majeed,S., Bint, Z.S. & Shahid, A., 2009. Agriculture Sector Strategy and Framework for Action for the Development of Bio-fuels in Pakistan. Research Brief., 1(7):1-9. Patil, P.D., Gude, V.G., Mannarswamy, A., Peter, C., Stuart, M., Nirmalakhandan N., Lammers, P. & Deng, S., 2011.Optimization of microwave-assisted transesterification of dry algal biomass using response surface methodology. Bioresoure Technol., 102(2):1399 1405. Rincon, L.E., Jaramillo, J.J. & Cardon, C.A., 2014. Comparison of feed stock and technologies for biodiesel production: An environmental and techno-economic. Renew. Energy, 69: 479-87. Shafiee, S. & Topal, E., 2009. When will fossil fuel reserves be diminished? Energ. Policy, 37(1): 181-189. Shahidi, F., 2003. Extraction and Measurement of Total Lipids. Current Protocols in Food Analytical Chemistry. D:D1:D1.1. Shahir, S.A., Masjuki, H.H., Kalam, M.A., Imran, A., Rizwanul Fattah, I.M. & Sanjid, A., 2014. Feasibility of biodiesel-biodieselethanol/bioethanol blend as existing Cl engine fuel: An assessment of properties, materials compatibility, safety and combustion. Renew. Sust. Energ. Rev., 32: 379-395. Sharma, M.P. & Jain, S., 2010. Prospects of biodiesel from Jatropha in India: a review. Renew. Sust. Energ. Rev., 14(2): 763-771. Sheehan, J., Dunahay, T., Benemann, J., & Roessler, P., 1998. A look back at the US Department of Energy s aquatic species program-biodiesel from algae (NREL/TP- 580-24190). Golden, CO: National
VOL. 60 (2) ALGAL OILS AND THEIR POTENTIAL AS BIOFUEL 247 Renewable Energy Laboratory (NREL), US DOE. Shirazi, M.A., Akram, A. & Kalhor, K., 2014. Energy and Cost analysis of biodiesel production from waste cooking oil. Renew. Sust. Energ. Rev., 33: 44-49. Thompson, P.A., Harrison, P.J. & Whyte, J.N.C., 1990. Influence of irradiance on the fatty acid composition of phytoplankton. J. Phycol., 26(2): 278-288. Wen, Z., Xinhai,Y., Shan-Tung, T, Jinyue, Y. & Erik, D., 2010. Biodiesel production from waste cooking oil catalyzed by TiO 2 -MgO mixed oxides. Bioresoure Technol., 101(24): 9570-9576. Wu, H., Volponi, J.V., Oliver, A.E., Parikh, A.N., Simmons, B.A. & Singh, S., 2011. In vivo lipdomics using single-cell Raman spectroscopy. Proc. Natl. Acad. Sci., USA., 108(9): 3809-3814.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 249-253 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Euphorbia wallichii and Oxyria digyna: Valuable Antioxidant Sources MADIEHA AMBREEN 1, SAFDAR ALI 1, MUHAMMAD ZAFAR 2 & MUSHTAQ AHMED 2 1 Department of Botany, GC University, Lahore, Pakistan 2 Department of Plant Sciences, Quaid-i-Azam University, Islamabad, Pakistan ABSTRACT The objective of present study was to assess the phytochemistry with reference to total phenolic and flavonoid content and antioxidant activity of extracts of Euphorbia wallichii Hook.f and Oxyria digyna (L.) Hill plant materials. Phenolic content in methanolic extract of E. wallichii plant material was expressed as (486±0.05) µg/ml of Gallic Acid Equivalent (GAE) and the same extract of E. wallichii showed total flavonoid content, calculated as (1069±0.65) µg/ml of Rutin Equivalent (RE). Oxyria digyna plant material indicated lower phenolic (86.13 ±0.32) and flavonoid content (797.3 ± 0.78 µg/ml of RE). Value of DPPH scavenging activity expressed as percentage inhibition observed was low in O. digyna and high in E. wallichii. High value of antioxidant potential in plant material of E. wallichii showed that positive correlation was found between phytochemical and antioxidant capacity. The extracts of the plants with their useful properties may be helpful in pharmacological investigation and in depth chemical elucidation. Key words: Phytochemical, Antioxidant, Oxyria digyna, Euphorbia wallichii INTRODUCTION In spite of remarkable development during recent decades, plants yet maintain their status of the main bases of drugs in contemporary as well as in traditional system of medicine. Plant derived compounds and constituents provide valuable medicinal agents that protect animals against harmful diseases. Plants provide many bioactive molecules which are useful as antioxidant and antimicrobial agents (Sengul et al., 2009; Chopra et al., 1992; Bruneton, 1995; Khalil et al., 2007). Phenolics and flavonoids are the secondary metabolites used as natural antioxidants, i.e derived from the various parts of plants depending upon the plant species (Apak, 2007). Phenolic compounds possess multiple biological activities including biochemical activities such as antimutagenic, antioxidant, anticarcinogenic in addition to having the ability to modify gene expression (Marinova et al., 2005). Flavonoids, another noticeable group of naturally occurring phenolic compounds found in different plant parts both in Free State and as glycosides (Peter et al., 1999), show different activities including antiviral, antiallergenic, anticancer, anti-inflammatory antibacterial, vasodilatory and immune-stimulating as well as inhibitors of some enzymes (Priecina & Karlina, 2013). Antioxidants being dynamic constituents protect body from free radical induced oxidative stress related damages (Ozsoy et al., 2008; Ajaib et al., 2013). Synthetic antioxidant compounds, such as butylated hydroxyanisole (BHA) and butylated hydroxytoluene (BHT) used in processed foods have been reported to cause DNA damage and are carcinogenic (Sasaki et al., 2002; Ku & Mun, 2007). Euphorbiaceae is cosmopolitan in distribution, particularly in tropical and temperate regions and is a diverse family containing herb, shrub and tall tree (Willis, 1973; Mabberley, 1987). Members of family are known to have a considerable medicinal and economic importance. Euphorbia wallichii Hook. f., belongs to Euphorbiaceae, a perennial herb up to 60 cm tall has significant medicinal value. Its leaves are used as purgative and digestive. The juice of plant is applied externally on wart and used for dermatological infection (Farooq et al., 2014). Seed and whole plant are used as remedy for edema, cutaneous diseases, exanthema, asthma and anthrax (Ul-Haq et al., 2012). Oxyria digyna (mountain sorrel), member of Polygonaceae is a perennial herb, 20 to 45 cm tall and grows at height of 10 to 30 cm. It is important in curing scurvy and dysentery. Aerial parts of plant are used as appetizer and tonic for liver (Devi et al., 2013). Its leaves are rich source of vitamin C and used as salad. In present research, phenolic and flavonoid contents and free radical scavenging activity was investigated in whole and aerial part of E. wallichii and O. digyna respectively. MATERIALS AND METHODS Collection and Authentication of Plants Plants of Euphorbia wallichii and Oxyria digyna were collected from Naran valley Pakistan. Plants were identified from herbarium, Department of Plant Science QAU, Islamabad and voucher *Corresponding author: madiha.ambreen@yahoo.com
250 M. AMBREEN ET AL BIOLOGIA (PAKISTAN) specimens were deposited in the herbarium of the same. Plant Material Preparation and Extraction Plant materials were washed in tap water to remove dust particles. Both specimens were dried in shade at room temperature for 10 to 15 days. Using pestle and mortar the dried plant materials were converted to fine powder. Hundred gram powder was soaked in 300 ml of methanol for 15 days. Each mixture was stirred at intervals to make sure proper extraction of compounds from plant powder. After 15 days, each mixture of plant powder in methanol was filtered through Whatmman Filter Paper no. 42 and extra methanol was evaporated from the filtrate using a rotary evaporator. Determination of Total Phenolic Content Phenolic content was determined following the method of Singleton and Rossi (1965). The absorbance of reaction mixtures was recorded against blank solution at 765 nm through double beam UV/visible spectrophotometer (UVD-3200, Labomed Inc., USA). The total phenolic content in each plant sample was determined with the help of standard curve of GA, expressed as µg/ml of GAE per 100 g sample extract. The GAE was derived using equation y=0.0005x-0.0344 from the standard curve of GA (Fig. 1). y is the absorbance of the sample at 765 nm, x is the amount of GA (mg/l). Determination of Total Flavonoid Content The total flavonoid content was determined using the method of Park et al. (2008). The absorbance of reaction mixture was recorded against blank solution at 506 nm through double beam UV/Visible spectrophotometer. Total flavonoid content was expresses as µg/ml of RE/100 g of plant sample extract. The RE was derived using the equation y=0.0002x-0.0808 from the standard curve of Rutin (Fig. 2) where y is the absorbance of the sample at 506 nm, x is the amount of Rutin (mg/l). Determination of Antioxidant Activity The DPPH radical scavenging activity was evaluated following the method of Brand-Williams et al. (1995). The absorbance of the reaction mixture was recorded at 517 nm and the scavenging activity was calculated as follows: DPPH Scavenging activity (%age) = Absorbance (control) Absorbance (sample) Absorbance (control) 100 EC 50 was determined by making different concentrations. Each part of experiment was repeated three times and statistical means and standard errors were calculated. Total Phenolic Content RESULTS The total phenolic content in each plant sample determined from standard curve of GA, expressed as µg/ml of GAE/100 g plant sample extract showed that the total phenolic content in E. wallichii was 486 µg/ml of GAE/100 g of plant sample extract which was significantly higher compared with O. digyna (Table I). Total Flavonoid Content The total flavonoid content expressed as RE was obtained from the standard curve of Rutin. The total flavonoid content investigated in both the test plants was compared, it showed that the total flavonoid content was significantly higher in E. wallichii i.e. 1069 µg/ml of RE/100 g of plant sample extract as compared with total flavonoid content of O. digyna (Table 1). However an insignificant correlation was found between the total phenolic and flavonoid contents of E. wallichii and O. digyna (Fig., 3). Antioxidant Potential Percentage inhibition and EC 50 values of ascorbic acid as standard were found to be 93.35 and 230.18 respectively. Percentage inhibition of both test plants species was low as compared to standard (Fig. 4); however percentage inhibition of O. digyna was distinctly low as compared to E. wallichii, consequently EC 50 value of O. digyna was markedly high as compared to E. wallichii (Table I). DISCUSSION Medicinal plants rich in phenolic and flavonoid constituents are of increasing interest in food industry since they delay oxidative degradation of lipids thereby improving the quality of food (Patel et al., 2010). Flavonoids are useful in reducing hydrolytic and oxidative enzymes. It is well documented that the flavonoids exhibit antioxidant activity and have considerable positive effects on human health (Younes 1981; Das & Pereira 1990).
VOL. 60 (2) EUPHORBIA WALLICHII AND OXYRIA DIGYNA: VALUABLE ANTIOXIDANT SOURCES 251 Table I: Total phenolic and flavonoid content expressed as µg/ml of GAE and RE and inhibition (%) and EC 50 values of DPPH scavenging activity Plant species Family name GAE (µg/ml) RE (µg/ml) Inhibition (%) EC 50 (µg/ml) E. wallichii Euphorbiaceae 486 ±0.05 1069 ±0.65 82.225 ±0.89 478.2333 O. digyna Polygonaceae 86.13 ±0.32 797 ±0.78 6.592 ±0.54 4682.2011 Fig., 1. Standard curve of GA for determination of phenolic content of extract of E. wallichii and O. digyna Fig., 2. Standard curve of Rutin for determination of flavonoid content of extract of E. wallichii and O. digyna Fig., 3. Insignificant correlation between total phenolic and flavonoid content Fig., 4. Comparison of inhibition percentage and EC 50 values of the extracts of test plant species with standard. The present study showed that low value of EC 50 and high content of radical scavenging potential is present in plant material of E. wallichii. Ali et al. (2009) quoted significant results regarding in vitro cytotoxicity, phytotoxicity and antioxidant potential in root extract of E. wallichii, they considered that these activities were due to the presence of flavonoids, saponins, tannins, terpenoids and cardiac glycosides. Higher value of phenolic contents in E. wallichii may be playing important role in absorbing and neutralizing free radicals (Osawa, 1994). Oxyria. digyna had exhibited high value of EC 50 and low antioxidant potential which indicated that it may be due to less quantity of phenolic compounds. Low value of total phenolics and flavonoids present in plant material of O. digyna could be attributed to the presence of less no of hydroxyl groups which function as antioxidants by stabilizing the free radicals, involved in oxidation procedures. Orhan et al. (2008) exhibited similar results by using the ethanolic extract of aerial part of O. digyna. Insignificant correlation was found between total phenolic and flavonoid content. Extracts of both plants showed antioxidant activity at high concentration of 1000 µg/ml while E. wallichii exhibited 50 to 70 % antioxidant activity at low concentration i.e., 10 µg/ml.
252 M. AMBREEN ET AL BIOLOGIA (PAKISTAN) Conclusion Due to presence of large quantities of bioactive constituents, medicinal plants like E. wallichii may be considered for preparation of therapeutic and health promoting formulations which may provide cheap and new sources of drugs to increasing human population. REFERENCES Ajaib, M., Ali. S., & Khan, Z., 2013. Antioxidant and Antimicrobial activities of an ethnobotanically important plant Notholirion thomsonianum from District Kotli, Azad Jammu & Kashmir. J. Anim. Plant. Sci., 24(3): 774-780. Ali, A., Naz, R., Khan, W.N., Gul, R.M.I. & Choudhary, M.I., 2009. Biological screening of different root extracts of Euphorbia wallichii. Pak. J. Bot., 41(4): 1737-1741. Apak, R., Guclu, K., Demirata, B., Ozyurek, M., Esin, C. S., Bektasoglu, B., Berker, K. & Ozyur, D., 2007. Comparative evaluation of various total antioxidant capacity assays applied to phenolic compounds with the CUPRAC assay. Molecules, 12: 1496-1547. Brand-William, W., Cuvelier, M.E. & Berset, C., 1995. Use of a free radical method to evaluate antioxidant activity. Lebensmittel- Wissenschafund Technologie/Food Sci. & Technol., 28: 25-30. Bruneton, J., 1995. Pharmacognosy Phytochemistry Medicinal plants, France: Lavoisiler Publishing Co. pp: 265-380. Chopra, R.N., Nayer, S.L. & Chopra, I.C., 1992. Ed. Glossary of Indian Medicinal Plants, 3rd Edn, Council of Scientific and Industrial Research, New Delhi. pp: 7-246. Das, N.P. & Pereira, T.A., 1990. Effects of flavonoids on thermal autooxidation of Pa.lm oil: structure- activity relationship. J. Am. Oil Chem. Soc., 67:255 258. Devi, U., Seth, M.K., Sharma P. & Rana, J.C. 2013. Study on ethnomedicinal plants of Kibber Wildlife Sanctuary: A cold desert in Trans Himalaya, India. 7(47): 3400-3419. Farooq U., Abaas, G., Saggoo M.I.S. & Dar, M.A., 2014. Ethno botany of some selected Monochlamydeae plant species from the Kashmir Himalaya,India. J. Med. Plant Res., 8(23):834-839. Khalil, M.Y., Moustafa, A.A. & Naguib, N.Y., 2007. Growth, phenolic compounds and antioxidant activity of some medicinal plants grown under organic farming condition. World J. Agric. Sci., 3(4): 451-457. Ku, C.S. & Mun, S.P., 2007. Antioxidant activities of ethanol extracts from seeds in fresh Bokbunja (Rubus coreanus Miq.) and wine processing waste. Biores. Technol., 99: 2852 2856. Mabberley, D.I., 1987. The Plant Book. Camb. Univ. Press. Cambridge. New York. Marinova, D., Ribarova, F. & Atanassova. M., 2005. Total phenolics and total Flavonoids in Bulgarian fruits and vegetables. J. Uni. Chem. Tech. Metal. 40 (3): 255-260. Orhan, I., Kartal M., Abu-Asaker, M., Şenol, F.S., Yilmaz. G. & Şener, B., 2008. Free radical scavenging properties and phenolic characterization of some edible plants. Food Chem., 114: 276-281. Osawa, T., 1994. Novel natural antioxidants for utilization in food and biological systems. In I. Uritani, V.V. Garcia & E.M. Mendoza (Eds.), Postharvest biochemistry of plant food-materials in the tropics, Tokyo, Japan. Japan Scientific Societies Press. pp: 241 251. Ozsoy, N., Can, A., Yanardag, R. & Akev, N. 2008. Antioxidant activity of Smilax excelsa L. leaf extracts. Food Chemistry. 110:571 583. Park, Y.S., Jung, S.T., Kang, S.G. Heo, B. K., Arancibia-Avila, P., & Toledo F., 2008. Antioxidants and proteins in ethylene treated kiwifruits. Food Chem., 107(2):640-648. Patel R.V., Patel, R.P. & Kajal, S.S., 2010. Antioxidant activity of some selected medicinal plants in western region of India. Adv. Biol. Res., 4(1): 23-26. Peter, B., Kaufman, Leland, J., Warber, C.S., James, A., Harry, D.L., Brielmann, 1999. Natural products from Plants. CRC Press London. Priecina, L. & Karlina, D., 2013. Total polyphenol, flavonoid content and antiradical activity of celery, dill, parsley, onion and garlic dried in conventive and microwave-vacuum dryers. 2 nd Int. Conf. Nutr. & Food Sci., 53: 21. Sasaki, F., Kawaguchi, S., Kamaya, A., Ohshita, M., Kabasawa, K., Iwama, K., Taniguchi, K. & Tsuda, S., 2002. The comet assay with 8 mouse organs: Results with 39 currently
VOL. 60 (2) EUPHORBIA WALLICHII AND OXYRIA DIGYNA: VALUABLE ANTIOXIDANT SOURCES 253 used food additives. Mutat. Res-Gen. Tox. En., 519:103 119. Sengul, M., Yildiz, H., Gungor, N., Cetin, B., Eser, Z., & Ercisli, S., 2009. Total phenolics content, antioxidant and antimicrobial activities of some medicinal plants. Pak. J. Pharm. Sci., 22(1):102-106. Singleton, V.L. & Rossi, J.A., 1965. Colorimetry of total phenolics with phosphomolybdicphosphotungstic acid reagents. Am. J. Enol. Vitic., 16:144-158. Ul-Haq, I., Ullah, N., Bibi, G., Kanwal, S., Ahmad, M. S. & Mirza, B., 2012. Antioxidant and cytotoxic activities and phytochemical analysis of Euphorbia wallichii root extract and its fractions. Iran. J. Pharma. Res., 11: 241. Willis, J.C. 1973. A Dictionary of the flowering Plants and Ferns. VII. Cambridge University Press. Younes, M., 1981. Inhibitory action of some flavonoids on enhanced spontaneous lipid peroxidation following glutathione depletion. Planta Med., 43:240 245.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 255-260 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Optimization of Nested RT-PCR for the Detection of a Common Fusion Oncogene AML1/ETO of Acute Myeloid Leukemia in Pakistan SANA SHAHBAZ 1, * TANVEER AKHTAR 1, & ZAFAR IQBAL 2 1 Department of Zoology, University of the Punjab, Lahore, Pakistan 2 Molecular Clinical Hematology, King Saud University, Riyadh, KSA ABSTRACT In this study, detection of AML1/ETO fusion has shown morphological and clinical characteristics. The prevalence of t (8;21) in Acute Myeloid Leukemia (AML), especially in AML-M2 showed comparative analysis in AML1-ETO positive and negative group of AML in Pakistan and also evaluates its association with other biological parameters. Thirty (30) AML patients were studied, including 14 patients with AML-M2. RNAs were extracted from blood and AML1/ETO fusion transcript was detected through reverse transcriptase polymerase chain reaction (RT-PCR). The prevalence of t(8:21) fusion was 23.3% in total AML patients and 42.9% in its M2 type. This research showed the morphological and clinical characters with high incidence of blast cells, Auer rods, and abnormal granules present in AML1/ETO positive patients in Pakistan. Key words: Acute myeloid leukemia (AML), AML1-ETO, Nested RT-PCR. INTRODUCTION Acute myeloid leukemia (AML) is a disorder of haemopoietic stem cells. It is characterized by the inhibition of differentiation and the subsequent increase of cells at different stages of incomplete maturation, and cause reduced production of healthy haemopoietic cells (Ferrara & Schiffer, 2013). Acute leukemia s (ALs) account for approximately 20,000 cancer diagnoses and 10, 000 deaths annually in the United States (Jemal, 2011), but the etiology of most ALs remains unknown (Linet, 2006). Worldwide leukemia affects more men than women and white people are more affected with leukemia than black (Brown, et al., 2012). It is most common types of leukemia in Middle East and Iran (Ahmadi, et al., 2012). In Pakistan, it is estimated that a total of 18,026 patients are suffering from leukemia and it was found that 89% of them are suffering from acute type only, 9% having chronic type leukemia, in Karachi it is about 800 annually (Hamayun et al., 2005). Acute leukemia is more prevalent than chronic leukemia (Nasim et al., 2013). AML is more prevalent in the Punjab province than the KPK and Northern areas, the majority (65.4%) of AML patients in Pakistan belonged to standard risk groups whereas 11.6% belong to poor risk group (Aziz et al., 2008). The age of AML patients range from 15 to 70 years and the mean age is 38 years (Kakepoto et al., 2002). AML is a heterogeneous disease, which comprises multiple subtypes (Bacher et al., 2006). The subtypes are classified according to the French-American-British (FAB) classification system (Table 1). The subtypes are denoted as M0- M7. The grouping is based on the degree of granulocytic maturation (M1, M2, M3) or monocytic differentiation (M4 & M5) or presence of large number of erythroblasts (M6) or magakaryoblasts (M7) ((Kumar, 2011). Table I: French-American-British (FAB) Classification of Acute Myeloid Leukemia (AML) on the basis of morphology and cytogenetics (Bennett et al., 1985; Seiter, 2011; Kumar, 2011). FAB subtype Morphological And Cytogenetic Classification AML-M0 AML-M1 AML-M2 AML-M3 Undifferentiated acute myeloblastic leukemia Acute myeloblastic leukemia with minimal maturation Acute myeloblastic leukemia with maturation t(8;21)(q22;q22), t(6;9) Acute promyelocytic leukemia (APL) t(15;17) *Corresponding author: dr_tanveerakhtar@yahoo.com
256 S. SHAHBAZ ET AL BIOLOGIA (PAKISTAN) AML-M4 AML-M4 eos AML-M5 AML-M6 Acute myelomonocytic leukemia inv(16)(p13q22), del(16q) Acute myelomonocytic leukemia with eosinophilia inv(16), t(16;16) Acute monocytic leukemia del (11q), t(9;11), t(11;19) Acute erythroid leukemia AML-M7 Acute megakaryoblastic leukemia t(1;22) In AML patients the early presenting feature were oral lesions such as gums swelling and echymosis with weakness and distress (Motwani et al., 2013; Williams et al., 2013). The most important prognostic factor of acute myeloid leukemia is cytogenetics (Martens & Stunnenberg, 2010). Translocations associated with AML often cause gene fusions that encode oncofusion proteins. In AML, 749 chromosomal aberrations have been reported (Martens & Stunnenberg, 2010; Mitelman et al., 2010). The frequencies of most common translocations have been between 3% and 10%. Which are AML1-ETO, and CBFβ-MYH11, fusions (Kumar, 2011). AML1/ETO fusion proteins is among the most common chimeric transcription factors created by chromosomal translocations in acute myeloid leukemia (AML) whose pathogenic roles involve perturbations of epigenetic mechanisms of gene regulation. AML1/ETO is caused by the t(8;21) translocation and is present in approximately 12 15 % of AMLs (Duque-Afonso et al., 2014). The AML1 ETO fusion protein that is not leukaemogenic, but it suppresses proliferation and reduce cell survival (Reikvam et al., 2011). Keeping in view all of this, the current study was undertaken on a cohort of 30AML patients to screen the common fusion oncogene i.e. AML1- ETO by using combination of different techniques. Blood Sampling MATERIALS AND METHODS Blood samples of 59 AML patients of all ages were collected from the Mayo Hospital and Jinnah Hospital, Lahore, with the help of paramedical staff with considering all ethical aspects. A consent form was signed by patients or their guardians. Whole blood (3ml) was drawn from each patient by sterilized syringes and collected in the vacutainer tubes containing EDTA with patient number, age and time/date of collection. All the samples were stored at -40 0 C. RNA Separation by Trizol Method RNA separation was done by Trizol method because trizol minimized the RNA degradation (Chomzynski & Mackey, 1995). RNA pellets were air-dried, incubated at 55-60 0 C for 10-15 minutes and stored at -20 0 C. cdna Synthesis Reverse transcriptase (RT) reaction protocol and other reaction conditions were adopted from van-dongen et al., 1999. Briefly, RNA was added to 10µl of RT-reaction mixture containing 5xRT buffer, 25mM dntps, 10mM random hexamer primers. RNAs inhibitors, M-mLV reverse transcriptase and DEPC treated water. Reaction was carried out by incubating mixture of template, random hexamer and DEPC treated water at 70 0 C for 10 min. Then added rest of reagents and incubated at 42 0 C for 60 min., at 70 0 C for 10 min. and held at 4 0 C in the last step. Glyceraldehyde Phosphate Dehydrogenase (GAPDH; Housekeeping gene) Amplification To minimize pipetting errors, master mix was prepared in a single tube in which all the components of PCR reaction were added except for the component being optimized or template cdna volume. This master mix was prepared using 10x buffer with KCl, 2mM dntps mix, DEPC water, forward primer (5 - GCAATTTTAGGTATGAAAGCCAGC-3 ), reverse primer (5 -CTTTCAGCATTTTGACGGCAACC-3 ) (e-oligos), 25mM MgCl 2, Taq DNA polymerase and 2µl of cdna was added in each reaction mix at the end. Then put this mixture in PCR machine for 35 cycles (Applied Biosystems, 2720 Cycles). Thermal cycling profile for nested PCR was: Preliminary denaturation at 94 0 C for 5 minutes, denaturation of
VOL. 60 (2) DETECTION OF A COMMON FUSION ONCOGENE AML1/ETO 257 double standard DNA at 94 0 C for 30 seconds, annealing of primers to DNA template at 58 0 C for 35 seconds and extension to form multiple copies of DNA strands at 72 0 C for 40 seconds and final extension at 72 0 C for 10 minutes and holding at 4 0 C for infinite time. Amplification of AML1-ETO Fusion Oncogene Nested PCR protocols and PCR primers were used for the screening of AML1-ETO Fusion oncogene in patients with acute myeloid leukemia (Choi et al., 2004). The chemicals for reaction mixture was same as used for GAPDH reaction except for the AML1-ETO forward and AML1-ETO Fusion oncogenes reverse primers, whose sequences were given in the (Table I). Thermal cycling profile for nested PCR was: Preliminary denaturation at 95 0 C for 9 minutes, denaturation of double standard DNA at 95 0 C for 30 seconds, annealing of primers to DNA template at 56 0 C for 60 seconds and extension to form multiple copies of DNA strands at 72 0 C for 2 minutes and final extension at 72 0 C for 7 minutes and holding at 4 0 C for infinite time. Selected Primers The primers used for the detection of AML1- ETO Fusion oncogene in PCR 1 st round and 2 nd round are given in (Table II) and (Table III) respectively. Table II: Primers used for AML1-ETO Fusion oncogene amplification in PCR 1 st round. PCR 1st Round Primer Primer sequence (5/-3/) Forward AML1-A 5 -CTACCGCAGCCATGAAGAACC-3 Reverse ETO-B 5 -AGAGGAAGGCCCATTGCTGAA-3 Table III: Primers used for AML1-ETO Fusion oncogene amplification in PCR 2 nd round. PCR 2nd Round Primer Primer sequence (5/-3/) Forward AML1-C 5 - ATGACCTCAGGTTTGTCGGTCG -3 Reverse ETO-D 5 - TGAACTGGTTCTTGGAGCTCCT -3 Analysis of PCR Products by Agarose Gel Electrophoresis PCR products of both GAPDH and AML1- ETO fusion oncogene amplifications were analyzed by electrophoresis with 2% agarose gel, stained with 3% ethidium bromide (MERCK, Germany) (Sambrook et al., 1989) and visualized under ultraviolet light. The gel was photographed in the UVP PhotoDoc-It TM Imaging System. Statistical Analysis For this study we used convenient sampling technique to collect the data, Fisher exact test was used to study the association between oncogenotype and clinical and laboratory parameters of leukemia patients. Cohort RESULTS AND DISCUSSION The present study focused on 30 AML patients (16 males; 14 females) for the screening of AML1-ETO fusion oncogene. The gender ratio was 16,14 (Male, Female) respectively, and the median age was 45 years, ranging from 14-86 years (Fig 1). Patient s Classification The patients were classified according to the FAB-classification system of AML. In present study, the frequency was M0;2, M1;7, M2;14, M4;2, M5;1, M6;2, M7;2 patients, (Table IV).
258 S. SHAHBAZ ET AL BIOLOGIA (PAKISTAN) Table IV: Comparison of total number of AML patients to their FAB subtypes and gender. AML FAB Subtypes No. of AML patients (n=30) (%) Male, Female (16,14) (%) M0 02 (6.7) 1,1 (3.3,3.3) 2), which was in 7/30 (23.3%) in AML patients and 6/14 (42.9%) in AML-M2 (Table V). M1 03 (10) 2,1 (6.7,3.3) M2 14 (46.7) 8,6 (26.7,20) M3 4 (13.3) 1, 3(3.3, 10) M4 02 (6.7) 1,1 (3.3,3.3) M5 01 (3.3) 1, 0 (3.3,0) M6 02 (6.7) 1, 1 (3.3,3.3) M7 02 (6.7) 1,1, (3.3,3.3) Fig., 2: AML1/ETO fusion by RT-PCR in patients with AML in Pakistan. lane M: marker, Lane 01, 02, 03, 04, positive patients, Lane ve C: negative control. Clinical and Hematological Characteristics According to AML1-ETO Transcripts This study showed a comparison of the clinical and hematological parameters such as age, sex, white blood cells, hemoglobin, and blast cells respectively, between the AML1/ETO positive and negative group, but these were not significantly different. But the value of white blood cells was 53x10 3 /µl in the negative group and 20x10 3 /µl, which was increase in the negative group. In the positive AML1/ETO patients the median blast % was 60%, which was high in negative group but not significant (Table V). Fig.,1: Comparison of percentages of AML patients to their FAB subtypes and gender. In AML patients, the incidence of AML1/ETO fusion transcripts by RT-PCR is 13% and 30-40% in AML-M2 (Langabeer et al., 1997). In this study, M2 patients were 14 (46.7%), whose sex ratio was 8, 6 (Male, Female) (26.7, 20)% respectively and the median age was 43years. (Fig 1). Detection of AML1/ETO Transcript by RT-PCR In this study, nested PCR was used as a technique for detection of AML1/ETO for executing a wide range of genetic manipulations. AML1-ETO transcript was detected at 395bp in the 1 st PCR products and at 260bp in the 2 nd PCR products (Fig Fig., 3: Comparison of clinical findings between AML1/ETO positive and negative groups Morphological Characteristics According to AML1/ETO Transcripts in AML-M2: In 14, AML1/ETO positive patients of AML- M2, Auer rods, large blast and abnormal granules
VOL. 60 (2) DETECTION OF A COMMON FUSION ONCOGENE AML1/ETO 259 Table V: Comparison of clinical findings between AML1/ETO positive and negative groups. Clinical Parameters Positive AML1/ETO (n=7) AML (N=30) Negative AML1/ETO (n=23) P value Age 43 45 0.60 Sex (M,F) 16, 14 24:22 0.55 WBC (x10 3 /L) 20 53 0.34 Hemoglobin (g/dl) Platelet (x10 3 /L) 6.5 7.0 0.12 44.2 53.0 0.15 Blast % 60 80 0.06 Table VI: Comparison of morphological characteristics between AML1/ETO positive and negative group within AML-M2 Positive (n=6) Negative (n=8) P value Auer rods 65.2% 6.8% 0.05 Eosinophilia 32.2% 11.3% 0.05 Abnormal granules 56.8% 13.1% 0.05 Large blast with prominent golgi 94.3% 14.7% 0.05 Fig.,4: Comparison of percentages of morphological characteristics between AML1/ETO positive and negative group within AML-M2 were more observed. The eosinophilia are over 3% of all nucleated cells which was not statistically significant. (Table VI). In the Western world, AML prevalence was approximately 25% in adults and so the most recurring type of leukemia. Globally United States, Australia and Western Europe have maximum rate of frequency of AML cases (Deschler & Lubbert 2006). The morphologic features of t (8; 21) fusion showed lots of granules Vacuoles and Auer rods in cytoplasm. Auer rods in 65.2% of AML-M2 in the positive group and the large blasts with prominent Golgi bodies were also significantly found. In future, these results and techniques will support in diagnostic estimation of AML patients, and examination of the therapeutic response of patients. This study will assist to increase ability to
260 S. SHAHBAZ ET AL BIOLOGIA (PAKISTAN) overcome this disease; to make advance strategies related to treatment for patients and to improve the survival rate. Acknowledgement Financial assistance provided by Higher Education Commission, (HEC) Pakistan Vide NO: 106-1333-BM6-031, is gratefully acknowledged by first author under Indigenous Ph.D. 5000 Fellowship program. REFERENCES Ahmadi, S., Taverani, M.R., Divsalar, A., Khodakarim, A. & Tahmasebi, L., 2012. Study of contributing factors for cure response in patients with acute myeloid leukemia. J. Life Sci., 6: 570-76. Aziz, F. & Qureshi, I.Z., 2008. Clinical and cytogenetic analysis in Pakistani leukemia patients. Pakistan J. Zoo., 40(3):147-57. Bacher, U., Haferlach, T., Schoch, C., Kern, W. & Schnittger, S., 2006. Implications of NRAS mutations in AML: a study of 2502 patients. Blood., 107: 3847 53. Brown, G., Hughes, P.J., Ceredig, R. & Michell, R. H., 2012. Versatility and nuances of the architecture of haematopoiesis - Implications for the nature of leukaemia. Leukemia Res., 36(1):14-22. Chomzynski, P. & Mackey, K., 1995. Short technical report: Modification of the Trizol reagent procedure for isolation of RNA from polysaccharide and proteoglycan rich sources. Biotechnique., 19(6): 942-5. Deschler, B. & Lubbert, M., 2006. Acute myeloid leukemia: Epidemiology and etiology. Cancer.,107(9): 2099-2107. Duque-Afonso, J., Lubbert, M. & Cleary, M.L., 2014. Epigenetic Modifications Mediated by the AML1/ETO and MLL Leukemia Fusion Proteins. E. Therapy Canc., 23: 121-144 Ferrara, F. & Schiffer, C.A., 2013. Acute myeloid leukaemia in adults. Lancet., 381(9865): 484 495. Hamayun, M., Khan, S.A. & Wazir, M., 2005. Investigation on the prevalence of leukemia in North West Frontier province of Pakistan. Cancer., 35(3): 119-22. Jemal, A., Siegel, R., Xu, J. & Ward, E., 2011. Cancer statistics,. CA Cancer J. Clin., 60(5): 277-300 Kakepoto, G.N., Burney, I.A., Adil, S.N., Zaki, S. & Khurshid, M., 2002. Long term outcomes of acute myeloid leukemia in adults in Pakistan. J. Pak. Med. Assoc., 52(10): 482-6. Kumar, C.C., 2011.Genetic Abnormalities and Challenges in the Treatment of Acute Myeloid Leukemia. Genes Canc., 2(2): 95 107. Linet, M. S., Devesa, S.S. & Morgan, G. J., 2006. The leukemias. 3 rd ed In: Schottenfeld D, Fraumeni JF Jr,. Cancer Epidem Biomar., New York, NY: Oxford pp: 841-871. Martens, J. H. A, & Stunnenberg, H. G., 2010. The molecular signature of oncofusion proteins in acute myeloid leukemia. FEBS Lett., 584:2662-9. Mitelman, F., Johansson, B. & Mertens, F., 2010. Database of Chromosome Aberrations and Gene Fusions in Cancer. Available from http://cgap.nci.nih.gov/ Chromosomes/ Mitelman. Motwani, M., Patni, V., Matghare, P., Ignote, R., Pal, D. & Dutta, A., 2013. Oral symptoms as primary manifestations of acute myeloid leukemia: recent advances. Curr. Opin. Hematol., 14: 209-14. Nasim, N., Malik, K., Malik, N.K., Mobeen, S., Awan, S. & Mazhar, M., 2013. Investigation on the prevelance of leukemia at a tertiary care hospital, Lahore. Biomedica, 29: 19-22 Reikvam, H., Olsnes, A. M., Gjertsen, B.T., Ersvar, E. & Bruserud, O., 2011. Nuclear factor-b signaling: a contributor in leukemogenesis and a target for pharmacological intervention in human acutemyelogenous leukemia, Crit. Rev. Onco., 15(12): 1 41. Sambrook, J., Fritsch, E.F. & Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. 2 nd Ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. 1626 pp. van Dongen, J.J., Macintyre, E.A., Gabert, J.A., Delabesse, E., Rossi, V., Saglio, G., Gottardi, E., Rambaldi, A., Dotti, G., Griesinger, F., Parreira, A., Gameiro, P., Diaz, M.G., Malec, M., Langerak, A.W., San Miguel, J.F. & Biondi, A., 1999. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia., 13: 1901-1928. Williams, L.A., Ault, P.S., Kantarjian, H.M., Garcia- Manero, G., Quintas-Cardama, A., Borthakur, G., Fadrel, S.H., Jabbour, E.J., Cleeland, C.S. & Cortes, J.E., 2013. Symptoms burden in acute myeloid leukemia (AML) and myelodysplastic syndrome (MDS). Blood., 122(21): 2988-95.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 261-266 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Some New Fossils of Reduncini (Bovidae, Ruminantia) from Tatrot Formation Pliocene of Northern Pakistan AFTAB IQBAL 1, MUHAMMAD ADEEB BABAR 2, * MUHAMMAD AKBAR KHAN 3, MUHAMMAD AKHTAR 4, ASMA FATEHULLAH 5, SAYYED GHYOUR ABBAS 6 & MAHBOOB IQBAL 7 1,7 Department of Zoology, Government College of Science, Wahdat Road, Lahore, Pakistan 2,3,4,5,6 Department of Zoology, Quaid-e-Azam Campus, Punjab University, Lahore, Pakistan ABSTRACT Some new reduncine fossils have been collected from the outcrops nearby Tatrot village of District Jhelum, Northern Pakistan. The collected material comprises isolated dentitions and provides existing evidence of the large sized antelopes in the Tatrot type locality of the Tatrot Formation (ca 3.4-2.6 Ma). The new material from Tatrot confirms the idea that the early reduncines was present in the Tatrot Formation of the Upper Siwaliks during the Late Pliocene. Key words: Mammalia, Fossils, Pliocene, Pleistocene, Soan Formation, Siwaliks. INTRODUCTION The Tatrot type locality is situated in the district Jhelum of Northern Pakistan (Fig., 1). The Tatrot village is built on resistant layers of grey conglomeratic sandstone, below which are two coarser and thinner beds. The thinner bed is composed of rounded and subangular pebbles of pink granite, porphyrite, various quartzites, chert and purple stone. The upper bed is similar and rather coarser in composition than the lower bed. Lithologically, these beds contrast with the underlying Dhok Pathan rocks with prevailing orange and pink colors. The pebble components of Dhok Pathan Formation are less varied and quite different than that of the Tatrot Formation (Shah, 1980; Barry et al., 1982; Berggren et al., 1985; Nanda, 2002; Dennell et al., 2006). The age of the Tatrot Formation is Late Pliocene to Early Pleistocene. The Tatrot stage records 3.5-3.3 Myr old (Barry et al., 2002)). Hussain et al. (1992) noted that the age of the Formation is from 3.2-3.4 Ma. Nevertheless, the Soan Formation is one of the longest sequences of their age spanning ca. 3.3 0.6 Ma (Dennell et al., 2006). The Pliocene outcrops of the northern Pakistan represent grazing reduncines indicating reverine landscape. The reduncines preferred to live in the wetlands (Khan et al., 2010). Fig., 1: Map of the Potwar Plateau indicating the studied area and a generalized stratigraphic section of the main Siwalik formations (map is modified from Behrensmeyer & Barry (2005) and the boundary dates are from Dennell et al. (2008), Nanda (2008), Cohen & Gibbard (2008). *Corresponding author: akbaar111@gmail.com
262 A. IQBAL ET AL BIOLOGIA (PAKISTAN) MATERIALS AND METHODS The fossil collection was done during various field trips of the Tatrot Formation, northern Pakistan. Partially embedded fossils were excavated by fine chisels and geological hammers. The fragile broken specimens were assembled by epoxy magic, elphy and fixin. The material was observed carefully to determine the taxonomic position. The length and width of the specimens were measured by digital vernier caliper. The numeric figure on the specimens indicates yearly catalogue number (nominator) and serially catalogue number (denominator). The capital letter is used for upper teeth and the small case is used for lower teeth. The taxonomy and terminology is followed by Gentry & Hooker (1988), and Gentry et al. (1999). SYSTEMATIC PALAEONTOLOGY Order Artiodactyla Owen, 1848 Suborder Ruminantia Scopoli, 1777 Family Bovidae Gray, 1821 Subfamily Hippotraginae Gray, 1821 Tribe Reduncini Gray, 1821 Genus Kobus A. Smith, 1840 Type species. Kobus ellipsiprymnus (Ogilby, 1833). KOBUS PORRECTICORNIS (LYDEKKER, 1878) Type species. Kobus porrecticornis (Lyddeker, 1878). B229. Holotype. Frontlet with the horn-cores: GSI Geographical distribution. Late Miocene to Pliocene of the Subcontinent and Eurasia (Pilgrim, 1939; Gentry, 1980; Thomas, 1980; Khan & Akhtar, 2014). Stratigraphic range. Middle & Upper Siwaliks (Pilgrim, 1939; Gentry, 1980; Thomas, 1980; Khan & Akhtar, 2014). Horizon and locality. The village of Tatrot lies approximately on the border line between Dhok Pathan and younger rocks which in past have yielded many fossils (Pilgrim, 1910). The Tatrot Formation is a part of the Upper Siwalik subgroup. Original diagnosis. As in Gentry (1980, 1997), Khan and Akhtar (2014). New material. GCS 13/04 right P4, GCS 13/06 right maxillar fragment with partial molar, GCS 13/07 partial M, GCS 13/08 partial M, GCS 13/09 right p4, GCS 13/01 left mandible fragment with m1, GCS 13/05 right m1, GCS 13/02 right m3. Description and Comparison The 4 th premolar represents deep labiolingual grooves anteriorly (Fig., 2(1)). The hypoconid is strongly projected. A deep and narrow labial valley is present posteriorly. The upper molars have smooth enamel without wrinkling (Fig., 2(2-4)). The molars are hypsodonts. The central fossettes with indentations (spurs) can be clearly seen (Fig., 2(2)). The molars lingual cones are constricted (Fig., 2(2-4)). The molars represent strong styles and ribs (Fig., 2(2-4)). The lower molars are characterized by goat folds anteriorly and ectostylids centro-labially with constricted labial lobes (Fig., 2(5-7)). Morphometrically, the sample allots the medium size antelope. The molars are essentially differ from those of antelopes in having hypsodonty and constricted lobes (in upper molar lingually and in lower molar labially) (Khan & Akhtar, 2014). The overall morphology of the molars is very similar to that of the Siwalik primitive reduncine (Lydekker, 1878; Pilgrim, 1939; Thomas, 1980). The studied molars are very similar in morphology to K. porrecticornis (Table 1) and can be referred to Kobus porrecticornis. DISCUSSION Reduncine fossils are found abundantly in Plio-Pleistocene epochs (Azzaroli et al., 1988; Vrba, 1985, 1995; Gentry, 1990; Rossner, 2006) and it is true for the Siwaliks also (Pilgrim, 1939; Khan et al., 2009). Earlier reduncine fossils have been recovered from the Dhok Pathan Formation of the Siwaliks (Pilgrim, 1939; Gentry, 1980; Khan et al., 2010), contemporary to the reduncines appear in Africa at Lukeino and Mpesida sites. In the Pinjor Formation of the Upper Siwaliks, the reduncines were continued where some more complete remains were identified. Kobus porrecticornis, a primitive reduncine is recovered from the Pliocene deposits of the Tatrot type locality (Pilgrim, 1939; Khan et al., 2010). The extant reduncines are now grazing antelopes found in habitats nearby wetlands. The recovery of the reduncines from the Tatrot type locality adds weight to the suggestion that the Pliocene outcrops comprise open grass land environment with wetlands rather than the dry regions.
VOL. 60 (2) SOME NEW FOSSILS OF REDUNCINI 263 Table I: The comparative measurements of the cheek teeth of Kobus porrecticornis. * the studied specimens. The comparative data are taken from Gentry (1997), Khan and Akhtar (2014). Taxa Inventory Number Nature/Position Length Width W/L K. porrecticornis GCS 13/01* lm1 17.6 7.6 0.43 GCS 13/02* rm3 26.4 13.0 0.49 GCS 13/04* rp4 11.7 16.8 1.43 GCS 13/05* rm1 17.6 11.0 0.63 GCS 13/06* rm 17.9 16.5 0.92 GCS 13/07* M 16.5 - - GCS 13/08* M 21.7 15.0 0.90 GCS 13/09* rp4 3.7 18.2 1.32 PUPC 82/14 lm1 16.6 16.3 0.98 PUPC 82/13 lm2 17 15 0.88 PUPC 83/837 lm1 16.5 10.8 0.65 lm2 19 11.5 0.60 PUPC 88/03 rm2 17.4 9.6 0.55 rm3 23 9.0 0.39 PUPC 02/137 rm2 21 10.6 0.50 rm3 23.5 PUPC 69/67 rm3 25.7 13 0.50 PUPC 83/816 lm3 28 12.5 0.44 K. aff. porrecticornis WM969/92 rm2 17.9 14.9 0.83 WM975/92 lm2 19.0 7.7 0.40
264 A. IQBAL ET AL BIOLOGIA (PAKISTAN) Fig., 2. Kobus porrecticornis. 1. GCS 13/04, rp4. 2. GCS 13/06, right maxillar fragment with partial molar. 3. GCS 13/07, partial M. 4. GCS 13/08, partial M. 5. GCS 13/09, right p4. 6. GCS 13/01, left mandible fragment with m1. 7. GCS 13/05, right m1. a = occlusal view, b = lingual view, c = buccal view. Scale bar 10 mm.
VOL. 60 (2) SOME NEW FOSSILS OF REDUNCINI 265 REFERENCES Azzaroli, A., Giuli, C., Ficcarelli, G., & Torre, D., 1988. Late Pliocene to early mid Pleistocene mammals in Eurasia: Faunal succession and dispersal events. Palaeogeogr., Palaeoclimat., Palaeoecol., 66: 77-100. Barry, J., Morgan, M., Flynn, L., Pilbeam, D., Behrensmeyer, A.K., Raza, S., Khan, I., Badgely, C., Hicks, J. and Kelley, J., 2002. Faunal and Environmental change in the Late Miocene Siwaliks of Northern Pakistan. Paleobiol., 28: 1-72. Barry J.C., Lindsay, E.H. & Jacobs L.L., 1982. A biostratigraphic zonation of the Middle and Upper Siwaliks of the Potwar Plateau of northern Pakistan. Palaeogeogr., Palaeoclimat., Palaeoecol., 37: 95-130. Behrensmeyer, A., Barry, J., 2005. Biostratigraphic Surveys in the Siwaliks of Pakistan. A Method for Standardized Surface Sampling of the Vertebrate Fossil Record. Palaeontologia Electronica, 8(1): 1 24. Berggren, W.A., Kent, D.V., Flynn, L.J. & Van Couvering, J.A., 1985. Cenozoic geochronology. Bull. Geol. Soc. Amer., 96: 1407-1418. Cohen, K.M. and Gibbard, P. L., 2008. Global chronostratigraphical correlation table for the last 2.7 million years. Episodes, 31: 243-247. Dennell, R., Coard, R., Turner, A., 2008. Predators and Scavengers in Early Pleistocene southern Asia. Quat. Int., 192: 78 88. Dennell, R., Coard, R. & Turner, A., 2006. The biostratigraphy and magnetic polarity zonation of the Pabbi Hills, northern Pakistan: An Upper Siwalik (Pinjor Stage) Upper Pliocene-Lower Pleistocene fluvial sequence. Palaeogeogr., Palaeoclimat., Palaeoecol., 234: 168-185. Gentry, A.W. & Hooker, J.J., 1988. The phylogeny of Artiodactyla, pp. 235-272. In: Benton M. J. (ed.), The Phylogeny and Classification of the Tetrapods, Vol. 2: Mammals Systematics Association Special Volume No. 35B Clarendon, Oxford. Gentry, A.W., 1990. Ruminant artiodactyls of Pasalar, Turkey. J. Hum. Evol., 19 (4-5): 529-550. Gentry, A.W., 1980. Fossil Bovidae (Mammalia) from Langebaanweg, South Africa. Ann. S. African Mus., 79: 213-337. Gentry, A.W., 1997. Fossil ruminants (Mammalia) from the Manonga Valley, Tanzania. pp: 107-135. In: Harrison. T. J. (ed.), Neogene Paleontology of the Manonga Valley, Tanzania. Plenum Press, New York. Gentry, A.W., 1999. Fossil Pecorans from the Baynunah Formation, Emirate of Abu Dhabi, United Arab Emirates. In: Abu Dhabi pecorans (Chap. 22), Yale University Press, New Haven. PP: 290-316. Hussain, S.T., Van Den Bergh, G.D., Steensma, K.J., De Visser, J.A., De Vos, J., Arif, M., Van Dam, J., Sondaar, P.Y. & Malik, S.M., 1992. Biostratigraphy of the Plio- Pleistocene continental sediments (Upper Siwaliks) of the Mangla-Samwal anticline, Azad Kashmir, Pakistan. Proc. Koninklijke Nederlandse Akademie van Wetenschappen, B95: 65-80. Khan, M.A. & Akhtar, M., 2014. Antilopes (Mammalia, Ruminantia, Bovidae) from the Upper Siwaliks of Tatrot, Pakistan, with description of a new species. Paleontol. J., 48:79-89. Khan, M.A., Akhtar, M. & Iqbal, M., 2010. The Late Miocene Artiodactyls in the Dhok Pathan Type Locality of the Dhok Pathan Formation, the Middle Siwaliks, Pakistan. Pakistan J. Zool., Suppl. Ser., 10:1-87. Khan, M.A., Iqbal, M., Ghaffar, A. & Akhtar, M., 2009. Proamphibos (Bovini, Bovidae, Mammalia) from the Tatrot Formation in the Upper Siwaliks of Pakistan, J. Anim. Pl. Sci. 19: 104-107. Lydekker, R. 1878. Indian Tertiary and Post-Tertiary vertebrate. 3. Crania of Ruminants, Palaeontolgia Indica, 10: 88-181. Nanda, A.C., 2002. Upper Siwalik mammalian fauna of India and associated events. J. Asian Ear. Sci., 21: 47-58. Nanda, A.C., 2008. Comments on the Pinjor Mammalian Fauna of the Siwalik Group in relation to the Post-Siwalik Faunas of Peninsular India and Indo-Gangetic Plain. Quat Int., 192(1): 6 13. Pilgrim, G.E., 1910. Notices of new Mammalian genera and species from the Tertieries of India-Calcutta. Rec. Geol. Sur. India, 40: 63-71. Pilgrim, G.E., 1939. The fossil Bovidae of India. Palaeont. Indica, N. Ser., 26(1): 1-356. Rossner, G.E. 2006. A Community of Middle Miocene Ruminantia (Mammalia, Artiodactyla) from the German Molasse
266 A. IQBAL ET AL BIOLOGIA (PAKISTAN) Basin. Palaeontographica Abt. A., 277: 103-112. Shah, S.M., 1980. Stratigraphy and economic geology of Central Salt Range. Rec. Geol. Sur. Pak., 52: 1-104. Thomas, H., 1980. Les bovides du Miocene superieur des couches de Mpesida et de la formation de Lukeino (district de Baringo, Kenya), pp : 82-91. In: Leakey R. E. F. & Ogot B. A. (eds.), Proc. 8 th Pan-African Cong. Prehistory, Nairobi, Nairobi. Vrba, E.S., 1985. African Bovidae: evolutionary events since the Miocene. S. Africa J. Sci., 81: 263 266. Vrba, E.S., 1995. The fossil record of African antelopes (Mammalia, Bovidae) in relation to human evolution and palaeoclimate, pp: 385 424. In: Vrba E.S., Denton G.H., Partridge T.C. & Burkle L.H. (eds.) Paleoclimate and Evolution: with emphasis on human origins, Yale University Press, New Haven.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 267-272 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Phytosociological Studies on Vegetation of India Morr District Kotli, Azad Jammu & Kashmir *SHOUKAT HUSSAIN 1, ZAHID HUSSAIN MALIK 1, NAFEESA ZAHID MALIK 1 & MUHAMMAD AJAIB 2 1 Department of Botany, University of Azad Jammu & Kashmir Muzaffarabad, Azad Kashmir 2 Department of Botany, GC University Lahore, Pakistan ABSTRACT In the investigated area, i.e., India Morr, District Kotli, Azad Jammu & Kashmir, ten plant communities were recoded, viz. 1. Pinus Community 2. Acacia-Themeda Community. 3. Themeda-Ficus-Mallotus community. 4. Themeda-Carissa Community. 5 Themeda-Dalbergia-Carissa Community. 6. Myrsine-Carissa-Themeda Community. 7. Themeda-Carissa-Mallotus Community. 8. Themeda-Dodonaea-Pinus Community 9. Olea- Taraxacum Community. 10. Pinus roxbughii Community. Among all these communities 49 species are being reported. It was also noticed that soil in these communities was loamy with acidic (6.4 ph) to basic (7.5 ph). Organic matter varied from 0.86-4.3 %, nitrogen contents ranged from 0.43-2.1 ppm where as phosphorus and potassium contents were 7.5-13.75 ppm and 40-100 ppm respectively. Environmental factors such as soil, climate, temperature, rain fall, humidity and biotic factors were studied and discussed in relation to vegetation. Key words: Plant Communities, Soil, Phytosociology, India Morr, District Kotli INTRODUCTION Vegetation is a characteristic feature of the flora and it responds to changes in the habitat. When repeatedly mowed, scraped, trampled and grazed, most of the components species are reduced until some of them disappear which may or may not be replaced by the others. Hence, the distribution of the vegetation of a certain area can be accessed by its chance of occurrence (frequency). As an important index reflecting species spatial patterns, density and frequency reflects not only the importance of species, but also the evenness of spatial distribution in community. Therefore the physical variations among the density and frequency of different plant communities indicate the specific vegetation of a particular habitat (Dale, 1999; Magurran, 1988). The investigated area is situated in District Kotli Azad Jammu & Kashmir and lies between longitudes 73 53 / to 73 60 / and latitude 33 44 / to 33 60 / (Topo sheet No. 43 G /15). It is bounded on Northern by Boluch District Sadnuti AJK, on East by Hajira District Rawalkot AJK, South by Kotli City and on West by Tesil Sehnsa District Kotli. The climate of the area is subtropical type where maximum rain fall occurs in the months of March and August, i.e., 180.1 mm to 238.7 mm. Minimum rain fall occurs during November and May, i.e., 32 mm and 29.9 mm respectively. June and July were hottest months of years with temperature 37.9 C to 38.0 C. Minimum temperature was recorded during January and December, which was 2.4 C to 4.3 C (Table I). In the study area no detailed work on vegetation was carried out so for. Only some references exist on different areas of Azad Jammu & Kashmir. Following studies have been carried out on various aspects of vegetation, phytosociology and ethnobotany such as Malik et al. (1990a,1990b); Dastagir et al. (1999); Shahzad et al. (1999), Ajaib et al. (2008, 2010 & 2012) on different parts of Azad Jammu & Kashmir. MATERIALS AND METHODS The Area was divided physiognomically into ten stands on the basis of altitude. Quadrat method was used for sampling the vegetation. Trees, shrubs and herbs were sampled by 10x2 m, 5x2 m and 1m 2 quadrat, respectively (Malik & Hussain, 1987). Density, frequency and cover of each species were recorded and converted into their relative scales and these three parameters were added to get Importance value (I.V.) (Table II) following Curtis & Mclntosh (1950). *Corresponding author: shoukatch2013@yahoo.com
268 S. HUSSAIN ET AL BIOLOGIA (PAKISTAN) Table I: Climatic data of District Kotli Azad Jammu & Kashmir (1998-2002) MONTH RAINFALL TEMPERATURE HUMIDITY cm Max.ºC MinºC Max.% Min% January 69.6 13.42-1.17 78.41 57.99 February 5.24 13.62-0.76 72.79 56.45 March 6.45 19.47 4.71 74.46 47.46 April 3.32 27.16 9.49 63.43 40.64 May 1.97 29.60 13.1 48.74 37.96 June 7.60 30.16 14.98 69.41 49.17 July 19.66 29.18 17.88 64.93 64.08 August 9.45 27.76 17.37 84.52 67.28 September 4.56 26.39 14.06 81.53 59.82 October 3.73 24.13 8.25 70.39 44.82 November 1.42 19.21 4.01 70.48 42.57 December 0.11 15.77 0.76 65.16 42.02 Courtesy: Pakistan Meteorological Centre Jail Road Lahore Table II: Height wise importance values of different plant communities recorded from India Morr during monsoon. S. No. Species Minimum I.V Maximum I.V Average I.V Presence in stands 1. Acacia modesta Wall. 4.07 4.07 0.40 1 2. Acacia nilotica (L.) Willd. ex Delile 85.73 85.73 8.57 1 3. Adhatoda zeylanica Medic. 33.9 39.63 11.14 3 4. Adiantum incisum Forssk. 9.14 18.67 5.48 4 5. Agrostis viridis Gouan. 13.12 19.68 5.19 3 6. Aristida adscensionis Linn. 6.22 8.11 1.43 2 7. Asparagus gracilis Royle 7.85 7.85 0.78 1 8. Boerhavia procumbens Banks & Roxb. 7.65 9.64 2.66 3 9. Carissa opaca Stapf. ex Haines 18.90 48.13 29.27 9 10. Chrysopogon aucheri (Boiss) Stapf. 7.64 8.67 2.47 3 11. Colebrookea oppositifolia Sm. 3.53 3.53 0.35 1 12. Cynodon dactylon (Linn.) Pers. 13.84 13.84 1.38 1 13. Cynoglossum lanceolatum Frossk 3.82 8.08 1.19 2 14. Cyperus rotundus Linn. 12.09 12.09 1.20 1 15. Dalbergia sissoo Roxb. 5.09 66.92 14.75 7
VOL. 60 (2) PHYTOSOCIOLOGICAL STUDIES ON VEGETATION OF INDIA MORR 269 16. Dichanthium annulatum (Frossk.) Stapf. 9.65 12.71 3.24 3 17. Dodonaea viscosa (Linn) Jacq. 7.73 58.24 21.72 9 18. Eriophorum comosum (Wall ex Roxb) Nees. 9.37 15.9 5.27 4 19. Euphorbia helioscopia Linn. 10.54 10.54 1.05 1 20. Euphorbia indica Lam. 7.96 11.42 1.93 2 21. Euphorbia prostrata Ait. 5.92 9.15 2.32 3 22. Ficus palmata Forssk. 3.74 40.26 4.4 2 23. Fragaria nubicola Lindl. 9.12 13.61 2.27 2 24. Geranium nepalense (Edgew.) Hook. 9.89 9.89 0.98 1 25. Heteropogon contortus (L.) Beauv. ex Roem. & Schult. 7.49 14.11 2.16 2 26. Mallotus philippensis (Lam). Muell. 8.46 38.76 7.56 3 27. Malvestrum coromandelianum (Linn.) Gracke 15.31 17.67 3.29 2 28. Maytenus royleanus Wall ex Lawson 4.55 12.69 5.31 7 29. Micromeria biflora Benth. 9.35 23.82 8.50 6 30. Myrsine africana Linn. 6.85 55.66 7.31 3 31. Olea ferrugenia Royle. 3.57 70.6 7.41 2 32. Oxalis corniculata Linn. 5.67 13.54 3.87 4 33. Pinus roxburghii Sargent 3.88 98.24 33.60 8 34. Poa annua Linn. 4.79 8.09 1.28 2 35. Punica granatum Linn. 2.74 5.49 1.29 3 36. Rubus fruticosus Linn. 6.77 6.77 0.67 1 37. Rumax hastatus D. Don. 13.11 13.11 1.31 1 38. Saccharum spontaneum Linn. 4.52 4.52 0.45 1 39. Sauromatum venosum (Ait) Schott. 3.82 7.51 1.67 3 40. Setaria glauca Auct. 7.4 14.97 6.06 5 41. Setaria palmifolia (Koen) Stapf. 9.65 17.14 2.67 2 42. Solanum nigrum Linn. 6.55 6.55 0.65 1 43. Solanum Xanthocarpum (Schard) Wendle. 9.24 9.24 0.92 1 44. Sorghum halepense (L.) Pers. 7.36 17.14 3.51 3 45. Taraxacum officinale Weber 13.19 44.54 5.77 2 46. Themeda anathera Nees ex Steud. 28.15 67.67 47.11 10 47. Woodfordia floribunda Salisb. 3.11 33.21 7.38 5 48. Zanthoxylem alatum Roxb. 3.2 5.36 1.2 3 49. Ziziphus nummularia Wight & Arn. 3.90 17.71 2.79 3
270 S. HUSSAIN ET AL BIOLOGIA (PAKISTAN) Plant communities were recorded on the basis of highest importance values of species and were named after the two or three leading dominants. Details of this method have been reported by Malik & Hussain (1988). Nomenclature followed here is that of Stewart (1972). Soil sample from each stand were collected up to the depth of 15cm and were analyzed physically and chemically in the soil testing laboratory of Agriculture Department, Muzaffarabad. RESULTS AND DISCUSSION Following ten plant communities were identified from India Morr, District Kotli, Azad Jammu & Kashmir. 1. Pinus roxburghii Community: This community is being reported from India Morr at an altitude of 710 meter (m). Pinus Roxburghii with I.V 98.24 was dominant. Codominant species were Themeda anathera and Adhatoda zeylanica. Remaining 15 species are rare. Soil in this community was loamy with basic ph. Phosphorous contents are medium and Potassium was low. Organic matter was very high 4.3% and Saturation percentage was 30 (Table III). Table III: Physico-chemical characteristic of soil of 10 plant communities of India Morr recorded during monsoon Community Locality Height m Texture Soil ph Saturation % Nitrogen ppm. Phosphorus ppm. Potassium ppm. Organic matte % 1. Gujar Morr 710 Loamy 7.42 30 2.15 11.25 40 4.3 2. Chamba 735 Loamy 7.18 36 0.43 10 60 0.86 3. Chamba 755 Loamy 7.41 31 0.86 12.5 80 1.72 4. Gharataan 770 Loamy 7.45 33 0.43 7.5 80 0.86 5. Gharataan 795 Loamy 6.49 30 0.86 7.5 80 1.72 6. Gharataan 815 Loamy 7.49 41 0.43 10 40 0.86 7. Saroota 835 Loamy 7.32 35 0.86 11.25 100 1.72 8. Saroota 860 Loamy 7.54 34 0.43 11.25 80 0.86 9. Peetian 885 Loamy 7.66 33 0.43 13.75 60 0.86 10. Lahsa 925 Loamy 6.04 38 1.29 12.5 60 2.58 2. Acacia Themeda Community: At an elevation of 735m Acacia nilotica and Themeda anathera community was recognized with importance values of 85.73 and 43.63 respectively. Co-dominant species were Adhatoda zeylanica and Carissa opaca while Dodonaea viscosa and Fragaria nubicola was associated species. Remaining 9 species were rare. Soil in this community was loamy with basic ph. Phosphorous and Potassium contents were medium. Organic matter was low 0.86% and Saturation 36% (Table III). 3. Themeda Ficus Mallotus Community: This Community is being reported at an altitude of 755m. There were 16 species in this community out of which Themeda anathera, Ficus palmata and Mallotus philippensis were dominant species with importance values 83.76, 43.07, and 40.26 respectively. Co-dominant species were Adhatoda zeylanica and Carissa opaca. Remaining 11 species were rare. Soil in this community was loamy with basic ph. Phosphorous and Potassium contents were medium. Organic matter was 1.72% and Saturation was 31% (Table III).
VOL. 60 (2) PHYTOSOCIOLOGICAL STUDIES ON VEGETATION OF INDIA MORR 271 4. Themeda Carissa Community: At an altitude of 770m. Dominant species in this community were Themeda anathera with I.V. 52.56 and Carissa opaca with 43.98. Woodfordia floribunda, Dalbergia sissoo and Dodonaea viscosa were co-dominant species. Malvestrum coromandelianum, Oxalis corniculata and Rumax hastatus were associated species. Remaining 7 species were rare. Soil in this Community was loamy with basic ph. Phosphorous contents were low while Potassium contents were medium. Organic matter was 0.86% while Saturation was 33% (Table III). 5. Themeda Dalbergia Carissa Community: This community recognized at an elevation of 795m and was dominated by Themeda anathera with I.V. 67.67, Dalbergia sissoo 66.92 and Carissa opaca 44.9. Agrostis viridus and ziziphus nummularia were Co-dominant species. Remaining 8 species were rare. Soil in this community was loamy with slightly acidic ph. Phosphorous contents were low while Potassium contents were medium. There were low Organic matter and Saturation percentage (Table III). 6. Myrsine Carissa Themeda Community: At an altitude of 815m Myrsine Carissa Themeda Community is being reported. Myrsine Africana with an importance values 55.66 with I.V. Carissa opaca with I.V. 48.13 and Themeda anathera 44.52 were dominant species. Pinus roxburghii and Dodonaea viscosa were co-dominant species. Remaining 8 species were rare. Soil in this Community was loamy with least basic ph. Phosphorous contents were medium while Potassium contents were low. Organic matter was low and Saturation was 41% (Table III). 7. Themeda Carissa Mallotus Community: This community was recognized at an elevation of 835m. Themeda anathera with I.V. 54.68 was dominant species while Carissa opaca with I.V. 31.44, Mallotus philippensis with I.V. 28.42 and Dodonaea viscosa with I.V. 28.24 were Codominant species. Woodfordia floribunda and Agrostis viridus were associated species. Remaining 12 species were rare. Soil was loamy with basic ph. Phosphorous and Potassium contents were in medium amount. Organic matter was 1.72% while Saturation was 35% (Table III). 8. Themeda Dodonaea Pinus Community: This community was recorded at an elevation of 860m. It was dominated by Themeda anathera with I.V. 65.9, Dodonaea viscosa with I.V. 58.29 and Pinus roxburghii 51.68. Carissa opaca and Eriophorum comosum were co-dominant species. Remaining 8 species were rare. Soil in this community was loamy with slightly basic ph. Phosphorous and Potassium contents were in medium amount. Organic matter was low and Saturation was 34% (Table III). 9. Olea Taraxacum Community: This community was recorded at an altitude of 885 m. This Community was dominated by Olea ferrugenia with I.V. 70.6 and Taraxacum officinale with I.V. 44.54. Carissa opaca and Themeda anathera were co-dominant species. Remaining 15 species were rare. Soil in this community was loamy with least basic ph. Phosphorus and Potassium contents were in a medium amount. Organic matter was low and Saturation was 33% (Table III). 10. Pinus-Themeda Community: At an elevation of 925m. Pinus-Themeda Community was found. It was dominated by Pinus roxburghii with I.V. 98.24 (Table 2) and Themeda anathera with I.V. 70.89. Micromeria biflora with importance value 23.82 was associated species. Soil was loamy with slightly acidic ph. Organic matter was high and Saturation point was 38% (Table III). In the investigated area Themeda anathera was recorded as dominant species in five stands while Carissa opaca in 3 communities. Themeda anathra is a fine fodder grass in Azad Jammu & Kashmir. It increases under grazing. It is an allelopathic grass which reduces germination of other species. Similarly Carissa opaca was dominant in 3 stands due to its spiny nature while its leaves are palatable. The soil of the area was loamy. The localities were dominated by arid conditions that supported Dodonaea viscosa to be dominant in one stand. Salim & Rashid (1973) reported it to be a plant of arid area. Pinus roxburghii was present from 0 to 140cm DBH while Olea ferrugenia was present upto 60 cm and then starts declining & again some plants of this species were recorded from 100 to 140cm which was the maximum girth class in the area.
272 S. HUSSAIN ET AL BIOLOGIA (PAKISTAN) Deforestation, overgrazing and soil erosion were the main factor that are changing the community structure. Similar finding were reported by Nazir et al. (2012) during the Phytosociological studies of Sarsawa hills District Kotli, Azad Jammu & Kashmir. The area needs complete protection for at least 50 years, so that original vegetation can start functioning, which can be a source of medicinal plants, rangelands and Agroforestry. REFERENCES Ajaib, M., Khan, Z. & Siddiqui, F.M., 2012. Ethnobotanical Study of Useful Climbers/twiners of District Kotli, Azad Jammu & Kashmir. Int. J. Biol. & Biotech., 9(4): 421-427. Ajaib, M., Khan, Z., Khan, N. & Wahab, M., 2010. Ethnobotanical Studies on useful Shrubs of District Kotli, Azad Jammu & Kashmir, Pakistan. Pak. J. Bot., 42(3):1407-1415. Ajaib, M., Khan, Z., Muhammad, S. & Mahmood, R., 2008. Biological Spectra of Saney Baney Hills District Kotli Azad Jammu & Kashmir. Pak. J. Science, 60(1-2): 53-58. Curtis, J.T. & Mclntosh, P.R., 1950. The interrelations of certain analytic and synthetic phytosociological characters. Ecology, 31: 434-455. Dale, M.R.T., 1999. Spatial Pattern Analysis in Plant Ecology. Cambridge University Press. Dastagir, G., Haq, I.U. & Malik, Z.H., 1999, Phytosociology of Mai Dhani Hill near Muzaffarabad Azad Kashmir. Pak. J. Bio. Sci., 2(1): 185-191. Magurran, A.E., 1988. Ecological Diversity and Its Measurement. New Jersey: Princeton University Press. Malik, Z.H., Awan, A.A., Murtaza, G. & Hussain, F., 1990b. Phytosociological studies of Sudhan Gali near Muzaffarabad Azad Jammu and Kashmir. J. Sc. & Tech., 14: 111-116. Malik, Z.H., Shakeel, M. & Hussain, F., 1990a. Phytosociological studies of Badana and Palana Hills near Kotli, Azad Jammu and Kashmir. J. Sci. & Tech., 12: 65-70. Malik, Z.H. & Hussain, F., 1987. Phytosociological studies of the vegetation around Muzaffarabad, Azad Jammu and Kashmir. Mod. Trends Plant Sci. Res. Pakistan, pp. 13-17. Malik, Z.H. & Hussain, F., 1988. Phytosociological studies of Badana and Palalan Hills near Kotli Azad Kashmir, J. Sci. & Tech.,12: 65-70. Nazir, A., Malik, R.N. & Ajaib, M., 2012. Phytosociological Studies of the vegetation of Sarsawa Hills District Kotli, Azad Jammu & Kashmir. Biologia (Pakistan), 58 (1&2): 123-133. Salim, K.M. & Shahid, R.G., 1973. A winter flora of the Cherat hills. Part II, Pak. J. Forest, 23(3): 267-282. Shehzad, K.R., Malik, Z.H. & Qureshi, R.A., 1999. Phytosociological survey of Samahni Valley, Bhimber Azad Kashmir. Pak. J. Forest., 49(1-4): 91-98. Stewart, R.R., 1972. An Annotated Catalogue of the Vascular Plants of West Pakistan and Kashmir, Flora of West Pakistan, E. Nasir & Ali, S.I. (Eds.), Fakhri Printing Press Karachi.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 273-278 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Health Status and Hygiene Practices in Slums: A Case Study of Lahore, Pakistan *GUL ZAREEN GHAFOOR 1, EJAZ MAHMOOD AHMED QURESHI 2, NAGHMANA GHAFOOR 3 & LAILA SHEHZAD 1 1 Sustainable Development Study Centre, GC University, Lahore, Pakistan 2 Department of Environmental Health, Institute of Public Health, Lahore, Pakistan 3 Department of Economics, Lahore College for Women University, Lahore, Pakistan ABSTRACT Worldwide urbanization is increasing at rapid rate and is responsible for establishment of underprivileged settlements deprived of basic amenities. A questionnaire based study was conducted on the health status of slum dwellers in Lahore (metropolitan city), Pakistan. Also Most Probable Number (MPN) Technique was used to determine the bacteriological quality of drinking water being used by the slum dwellers. Results confirmed high feacal coliform contamination in 98% of the samples. Analysis of Variance revealed significant relationship of personal health with low literacy level, low family income, drinking water quality, sanitation system, hygiene practices and availability of health services in nearby locality. It was concluded that a long term strategic planning is required to address the socioeconomic and infrastructural issues for the health and well-being of dwellers. Key words: Feacal Coliforms; Health; Hygiene practices; Sanitation system; Slums; Urbanization. INTRODUCTION Urbanization is increasing at a high rate all over the world and nearly half of the total 6.4 billion population is living in the urban areas (WHO, 2008). In the race of urbanization Asian countries are no exception. Pakistan is experiencing urbanization with a change from previous 82.26% rural population in 1951 to 66% in 2008 with a current population growth rate of 1.5%. Cities are growing at a rate of 3% with 2% rural-urban migration per annum (Ikramullah & Shair, 2011). The unprecedented urban growth results in the formation of informal settlements (slums) as a solution to house the poor low income migrants where the rate is high in cities like Karachi, Lahore, Kolkata, Mumbai and Dhaka (Ooi & Phua, 2008). In Pakistan the term katchi abadis is used as a synonym of slum (Kalim & Bhatty, 2006). Being located in vulnerable areas such as floodplains and landfill sites these settlements are characterized by inadequate houses, environmental degradation and lack of basic amenities including healthcare centres, drinking water supply and sanitation facilities. Being illegal in status, City Governments often have no obligation and responsibility to provide basic infrastructure to the dwellers which further affects their health and well-being (Ooi & Phua, 2008). But in Pakistan, in the mid-1970s, slum dwellers were given equal rights at par to other citizens and measures such as Katchi Abadi (slum) Improvement Programs (KAIPs) were initiated to regularize/ formalize and notify such settlements in 1985 (Anwar et al., 2008). This paper focuses on assessing the health status of dwellers of notified slums of Lahore, Pakistan. Objectives of the research were: 1) to analyze the demographic, socioeconomic and health profile of the households, 2) and to check their level of awareness about the health risks associated with unsafe drinking water and hygiene practices. Study Area MATERIALS AND METHODS Lahore Metropolitan city was selected in this survey. There were total 153 notified slums in Lahore consisting of 38073 dwelling units mostly in poor structural conditions and were devoid of basic amenities including potable water, sanitation and health care facilities at the time of survey. Study Design A descriptive cross sectional study was conducted by taking a sample of 250 households derived using Equation 1 (Kasely & Kumar, 1989; Brase & Brase, 1995). n = (Z/h) 2 x PQ (Equation 1) Where n = sample size, Z = normal variate or confidence level (95%), h = accepted error margin in the estimates (5%), P and Q are the *Corresponding author: zareen.sdsc@gmail.com
274 G. Z. GHAFOOR ET AL probability of success and failure, taken 80% and 20% respectively. For convenience, sample of 250 dwelling units from slums was taken randomly along with 60 drinking water samples taken in sterilized bottles. Research Instrument This study utilized a structured questionnaire as data collection instrument which had four main sections concerning the demographic background, drinking water quality, sanitation and hygiene knowledge and health status of the slum dwellers. Data was analyzed using SPSS software and drinking water samples were analyzed in laboratory for their bacteriological quality, using Most Probable Number (MPN) Technique (Clesceri et al. 1989). RESULTS AND DISCUSSION Demographic Characteristics The demographic profile of the slum dwellers is summarized in Table 1. About half of the target population had no primary education (54.5%), a major factor of their low socioeconomic status which led to their poor health due to gastrointestinal tract diseases and skin infections (Qureshi, et al. 2011). Majority of the dwelling units had a household size between 5-10 persons and were earning their livelihoods through small occupations. Most of them were able to earn up to Pakistani rupees (PKR.) 6000 per month. Results of this study are consistent with a survey conducted in England where low earnings were attributed to poor health as a reason of least expenditures on health and well-being (Benzeval et al. 2000). Drinking Water In the present study (Fig. 1) the surveyed settlements were receiving unsafe water in terms of taste (110), smell (122) presence of particles (144) and colour (133). All of these factors were contributing to poor health among dwellers. Still many people (145) stated their water clean because they were used to their living conditions. Results of this study are consistent with the findings of Rajendra, et al. (2012) who found that particles and taste was responsible for waterborne infections among consumers. Sanitation and Hygiene Practices Table 2 depicts that 96% of the households had toilet facility (as 40.8% had flush toilets and 55.2% had toilets without flushing system) and underground sewerage system was available to 52% of the respondents. Rest of the respondents reported open sewerage system and this figure cannot be ignored as it was responsible for the spread of malaria and insect borne diseases in the community. In Pakistan this percentage is significantly higher than that of India and Bangladesh (Karn & Harada, 2002; Rana, 2009). Reason could be the effort of Government of Pakistan to regularize slum areas to improve dwellers quality of life and well-being. Hygiene practices, such as hand washing after visiting toilet and before having meal were practiced less in the surveyed settlements of Lahore as compared to those in Bangladesh where 90% reported the practice of washing hands after visiting toilet. This is one of the main reasons for the prevalence of hygiene related diseases, most commonly diarrhea and dysentery in the surveyed sites (Rana, 2009). Health Status Due to the poor living conditions, except 9.2%, the rest respondents had ill family members at the time of survey. Majority of the dwellers (60%) had gastrointestinal (GI) tract related problems. Incidence of sickness from waterborne, hygiene and sanitation related diseases was high among the sampled individuals of this study as compared to India and Bangladesh (Karn & Harada, 2002; Rana, 2009). There are many inter-linked contributing factors to this high disease occurrence rate, most significantly the low income, poor quality drinking water and open sewerage system. Although the dengue epidemic rate was high in Pakistan in 2011 but in case of present study the occurrence of malaria and dengue fever was less in slums of Lahore as compared to those present in India (Table 3) where 30% of the respondent were affected by malaria and 8% by dengue fever (Sundari, 2003, Qureshi et al., 2014). Healthcare units were available and were in access to only 57.2% of the respondents situated at varying distance in a range of 2 to 5 km or less than 2 km (Ali et al., 2008). This was also a major cause of poor health in slums. Laboratory Analysis of Drinking Water Drinking water samples were analyzed for the presence of faecal coliforms and results revealed a high level of MPN index in 59 samples out of 60 showing the level of contamination in water exceeding the World Health Organization (WHO) limits and National Environmental Quality Standards (National Environment Quality Standards, 2010). This accounts for 98% of
VOL. 60 (2) HEALTH STATUS AND HYGIENE PRACTICES IN SLUMS 275 contamination due to poor water supply infrastructure and drainage system. Analysis of Variance One way ANOVA was used to find the impact of independent variables on the dependent variable i.e., health status. Table 5 presents a highly significant difference between personal health and education (F=12.33, p < 0.001) and family income (F= 45.10, p < 0.001). A significant positive relationship of colour (F=7.79, p < 0.01) and taste in water (F=6.07, p < 0.01) was observed with the dependent variable of health. It was revealed also through analysis that the practices of washing hands were significantly affecting health of dwellers. Results also revealed that personal health was significantly affected by poor health of other family members (F=5.57, p < 0.001). It was negatively affected by communicable disease(s) of any other family member. Conclusion On the basis of statistical and laboratory analyses it was found that low livelihood due to illiteracy was significantly affecting the health and well-being of slum dwellers. A kind of significant relationship was observed between poor drinking water quality and health status. All these situations, including poor structural condition of sewerage system and unhygienic practices were affecting health and well-being of dwellers. These all factors are of significance in not only in Pakistan but in other countries also which are facing high rate of urban growth. There is a dire need for strategic planning of such underprivileged areas which should focus on the provision of basic amenities. Also Government authorities should use all resources to increase the literacy level and awareness about health and causes of diseases. Table I: Demographic profile of the respondents in slums Variables N (%) variables N (%) Education Illiterate Matriculation and Below Intermediate Graduate Household size Less than 5 persons 5-10 persons More than 10 persons N= Frequency, %= Percentage 136 (54.5) 92 (36.8) 14 (5.6) 8 (3.2) 16 (6.4) 148 (59.2) 86 (34.4) Occupation Begging Government employee Self employed Labourer Monthly income (PKR) Below 6000 6001-7000 More than 7000 4 (1.6) 25 (10) 120 (48) 101 (40.4) 137 (54.8) 41 (16.4) 72 (28.8) 160 140 120 145 105 122 128 110 140 144 106 133 117 100 80 60 Yes No 40 20 0 Clean Smell Taste Particles Color Fig., 1: Dweller's perception about drinking water quality
276 G. Z. GHAFOOR ET AL Table II: Status of hygiene practices and sanitation system in slums Toilet use: Flush system Variables N (%) Variables N (%) Without flushing system Open field Washing hands after using toilet Yes No N= Frequency, %= Percentage 102 (40.8) 138 (55.2) 10 (4.0) 218 (87.2) 32 (12.8) Washing hands before eating meal Yes No Kind of sewerage system Open drain Underground Not applicable Table III: Health status of slum dwellers 166 (66.4) 84 (33.6) 69 (27.6) 130 (52) 51 (20.4) Variables N (%) Variables N (%) Ill family members Children Young people Aged All No ill person Common family diseases Respiratory infections GI tract diseases ENT infections Skin infections N= Frequency, %= Percentage 53 (21.2) 46 (18.4) 121 (48.4) 7 (2.8) 23 (9.2) 83 (33.2) 151 (60.4) 11 (4.4) 5 (2.0) Recently contracted diseases Typhoid Malaria Dengue fever Jaundice Hepatitis No illness Health care centre in nearby locality Within 2 km vicinity At a distance of 2-5 km No health care centre 14 (5.6) 20 (8.0) 11 (4.4) 27 (10.8) 57 (22.8) 121 (48.4) 104 (41.6) 39 (15.6) 107 (42.8) Table IV: Results of drinking water samples tested for the detection of feacal coliforms MPN index/100ml No. of samples Status 1600 26 Contaminated 1600 8 Contaminated 350 4 Contaminated 280 7 Contaminated 170 3 Contaminated Below 170 <2 11 1 Contaminated Un-contaminated
VOL. 60 (2) HEALTH STATUS AND HYGIENE PRACTICES IN SLUMS 277 Table V: ANOVA; Socioeconomic conditions on personal health Variables SS df MS F Education level 49.019 2 24.509 12.33*** Family income 77.070 2 38.535 45.10*** Colour in water 3.697 2 1.848 7.79** Taste in water 2.886 2 1.443 6.07** Washing hands after visiting toilet 1.142 2.571 5.27** Hand washing before having meal 10.263 2 5.132 27.85*** Ill family members 46.6 2 23.3 5.57** Common diseases in family 75.9 2 37.9 3.03* Recently contracted diseases 508.9 2 254.4 13.96** * p <.05 ** p <.01 *** p <.001 SS= Sum of squares, df = degree of freedom, MS= Mean square, F= F statistics REFERENCES Ali, M., Bhatti A.M. & Kuroiwa, C., 2008. Challenges in Access to and Utilization of Reproductive Health Care in Pakistan. J. Ayub Med. Coll., 20(4): 3-7 Anwar, H.N., Parveen S., Nousheen F. & Ahmad, Z., 2008. Physical Impact Assessment of Katchi Abadi Improvement Programme in Punjab-Pakistan. Pak. J. Life Soc. Sci., 6(2): 108-111 Benzeval, M., Taylor J. & Judge, K., 2000. Evidence on the Relationship between Low Income and Poor Health: Is the Government Doing Enough? Fisc. Stud., 21(3): 375 399 Brase, C.H. & Brase, C.P., 1995. Understandable statistics: Concepts and methods. Boston New York: Houghton Mifflin Company. Clesceri, S.L., Greenberg, E.A., Trussell, R.P. & Franson, H. A. M., 1989. Standard Methods for the Examination of Water and Waste Water. Washington, DC: American Public Health Association. Ikramullah., & Shair, G., 2011. Economic and Social Dimensions of Rural-Urban Migration in Pakistan: Results from a Recent Survey in the North West Pakistan. Int. J. Busi. Soc. Sci., 2(3): 119-126. Kalim, R. & Bhatty, A.S., 2006. Quantification of Socio Economic Deprivations of Squatter Settlement s Inhabitants: A Case Study of Lahore. 6 th Global Conference on Business & Economics. Gutman Conference Centre, USA. Karn, S.K. & Harada, H., 2002. Field Survey on Water Supply, Sanitation and Associated Health Impacts in Urban Poor Communities A Case from Mumbai City, India. Water Sci. Technol., 46(11-12): 269-279. Kasely, D.J. & Kumar, K., 1989. The Collection, Analysis and Use of Monitoring and Evaluation Data. The World Bank, IFAD, and FAO London: John Hopkin University Press. National Environment Quality Standards (NEQS), 2010. The Gazette of Pakistan. Part II. Statutory Notification (S.R.O). Ministry of Environment Government of Pakistan. pp:3207-3210. Ooi, L. G. & Phua, H.K., 2008. Urbanization and Slum Formation. Knowledge Network on Urban Settings WHO Centre for Health Development. Qureshi, E.M., Khan, A.U. & Vehra, S., 2011. An Investigation into the Prevalence of Water Borne Diseases in relation to Microbial Estimation of Potable Water in the Community Residing near River Ravi, Lahore, Pakistan. African J. Env. Sci. Technol. 5(8): 595-607. Qureshi, E.M.A., Vehra, S., Ghafoor, G.Z., Ali, A.S. & Ahmad, F., 2014. Community Perception Regarding Dengue Epidemic in Lahore, Pakistan. Pak. J. Sci., 66(1): 7-10 Rajendra, S., Rubin, D. & Abhishek, M. (2012). Microbiological Quality of Potable Water in Dahradun city. Int. Res. J. Pharm. 3(6): 130-137.
278 G. Z. GHAFOOR ET AL Rana, S.D.M., 2009. Status of Water Use Sanitation and Hygiene Conditions of Urban Slums: A Study on Rupsha Ferighat Slum, Khulna. Desalination, 246: 322-328. Sundari, S., 2003. Quality of Life of Migrant Households in Urban Slums. Proceedings of the Third International Conference on Environment and Health, Chennai, India. WHO, 2008. Our Cities, our Health, our Future: Towards Action on Social Determinants of Health in Urban Settings. A Synopsis of the Report of the Knowledge Network on Urban Settings to the WHO Commission on Social Determinants of Health, Japan.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 279-283 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Impact of Physicochemical Parameters of Water on Tintinnopsis from Safari Zoo Lake Lahore, Pakistan SARA HAYEE, NAVEED AKHTAR, *ABDUL QAYYUM KHAN SULEHRIA, FAHEEM NAWAZ, ALTAF HUSSAIN & MUHAMMAD EJAZ Department of Zoology, GC University, Lahore, Pakistan ABSTRACT A survey was conducted from September 2013 to August 2014 in Safari Zoo Lake to investigate zooplanktons. During this study, Tintinnids (Phylum Ciliophora) emerged in the beginning of December, 2013 and disappeared at the end of February, 2014. Three species of tintinnids belonging to one genus Tintinnopsis were identified. The order of abundance of species of tintinnids was T. sinensis, T. wangi and T. subpistillum. Tintinnids population was high in December. Analysis of variance (ANOVA) showed that physico-chemical parameters including air temperature (F=2.56, P=0.185), water temperature (F= 1.25, P=0.327), dissolved oxygen (F=1.21, P= 0.334), oxygen saturation (F=0.09, P=0.778), transparency (F=1.62, P=0.272), ph (F=0.32, P=0.600), turbidity (F=10.87, P=0.030) and salinity (F= 2.83, P=0.168) were statistically non-significant. Electrical conductivity was statistically significant (F=5019.92, P=0.00). Shannon-Weaver index ranged 0.888 to 0.435 showing low diversity of tintinnids. These results were supported by Simpson index of dominance, Simpson index of diversity and Simpson reciprocal index. Species evenness was lower in February (0.396) and high in December (0.809) indicating even distribution in December. Species richness ranged 0.1-0.32 which meant very small food chain. Key words: Tintinnopsis, Lakes, physico-chemical parameters, Ciliophora INTRODUCTION Zooplanktons are suspended microscopic organisms present in water. These include different types of protozoan, microscopic crustaceans and many other small invertebrates which are present in fresh and marine water bodies. Major groups of zooplanktons belong to Copepods, Rotifers, Cladoceras and Ostracods. Zooplanktons are important in food chain as they transfer energy from producers to higher trophic level. They are important source of food for fish population. They also act as an important bioindicator of water in aquatic environment as zooplankton association, seasonal variation and richness and diversity can be used for the assessment of water pollution. Any change in physico-chemical parameters of a water reservoir such as temperature, salinity, oxygen and nutrient level brings about the corresponding dramatic change in composition and abundance of zooplanktons. These fluctuations also affect the reproductive cycle of the zooplankton (Allan, 1976; Melo et al., 2013). Ciliated protozoa have short generation time. They react rapidly for short term changes of food conditions of a water body. They are significant part of all microzooplanktons (Jiang et al., 2013). Huge number of ciliated species have been reported in periods of blooms. It suggests that these organisms suppress and shorten the blooming of microalgae (Montagnes & Lessard, 1999; Tillmann, 2004; Jiang et al., 2013). It has been reported that ciliates are a good source of food for fish larvae and metazoan predators. They play an important role in energy transfer from producer to higher trophic levels (Takashi & Taniguchi, 2003; Karayanni et al., 2004). Tintinnids are the organisms belonging to phylum Ciliophora; Class Spirotrichea; Subclass Choretrichia; Order Tintinnida; and Family Codonellidae. Tintinnids are major part of marine planktonic ciliates. They are distributed in seas and oceans so are cosmopolitan in distribution (Marshall, 1969). Pierce & Turner (1993) reported that genus and species of this organism have distinct geographic distribution and are also restricted to shallow water. Tintinnids are unique unicellular ciliates among planktons as they build vase-shaped shells called loricae. These are considered as the main apomorphy of this taxon. After the death of the ciliate, the lorica sediments become transporting chemical compounds to deeper water layers and finally to the bottom of the ocean or lake. Occasionally, Tintinnids dominate the microzooplanktons. So the material flux might be considerable because of contribution to the benthic food web and recycling of nutrients (Agatha & Simon, 2012). The aim of present study was to *Corresponding author: khansulehria@hotmail.com
280 S. HAYEE ET AL BIOLOGIA (PAKISTAN) investigate the effect of physico-chemical parameters on population of Tintinnopsis. Study Site MATERIALS AND METHODS An artificial lake having five islands, four large and one small island is situated in Lahore Zoo Safari located on Raiwind Road, Lahore. This lake is covers an area of 5 acres. Sampling Period Sampling was started from December, 2013 to February, 2014. Zooplankton samples were collected on monthly basis from 10 am to12 pm from the Lake. The whole lake was divided into four sites, Eastern Safari Lake (ESL-1), Western Safari Lake (WSL-2), Northern Safari Lake (NSL-3) and Southern Safari Lake (SSL-4). Each site was sub divided into four sub-sites A-D. Zooplankton Sampling and Analysis In order to study the diversity and population density of planktonic tintinnids, samples were collected from lake in sample bottles. Tintinnid sampling was done by taking about 40 litres of water in a bucket and passing through a sieve of mesh size 341 µm. The water was then filtered with a sieve having mesh size of 37 µm and contents were preserved in 4 % formalin in 50 ml pre-cleaned bottles (Koste, 1978; Sulehria & Malik, 2012). The physico- chemical parameters studied include dissolved oxygen, salinity, turbidity, ph, electrical conductivity and temperature. Water temperature was measured in the field with thermometer. All the parameters were measured with their respective meters. Campbell (1939), Hada (1937,1938), Yoo et al. (1988), Yoo & Kim (1990), Sano (1975), and Bakker & Phaff (1976). Tintinnopsis wangi Tintinnopsis subpistillum Fig., 1: Map of Study Area The numerical estimation of the Tintinnopsis in water sample was done by using Sedgewick- Rafter Counting chamber. Photographs of tintinnids were taken with the help of LEICA HC 50/50 microscope on which a 5.0 megapixel Cannon camera was fitted. In the laboratory, tintinnids were identified up to species level by consulting Kofoid & Tintinnopsis sinensis Fig., 2: Various species of Tintinninopsis
VOL. 60 (2) IMPACT OF PHYSICOCHEMICAL PARAMETERS OF WATER ON TINTINNOPSIS 281 Statistical Analysis ANOVA was applied to study the significant differences in tintinnids. Pearson s correlation test was applied to find out the relationships between the observed environmental parameters and tintinnid species. The Minitab 13 software was used for ANOVA and Pearson s correlation. Diversity Indices Shannon Weaver (1949) and Simpson (1949) indices were employed to quantify the diversity of tintinnids in Safari Zoo lake. Species richness and species evenness were also calculated (Sulehria, et al., 2013; Sulehria & Malik, 2013). RESULTS AND DISCUSSION Physicochemical Parameters Physico-chemical parameters measured during the study include air temperature, water temperature, ph, dissolved oxygen, oxygen saturation, transparency, turbidity, salinity and electrical conductivity. Air temperature was highest in January (24.1) and lowest in December (18.4). Water temperature was lowest in December (14.06 ± 0.202) and highest in February (23.11±0.710). Dissolved oxygen was lowest in December (12.5). No change was observed in salinity during study period. Turbidity was highest in December (189) and lowest in January (64). Electrical conductivity was highest in February (538.3±0.92) and lowest in January (526.5±1.22). It was observed that ph (0.850) and turbidity (0.340) showed positive correlation with tintinnids whereas air temperature (0.863), water temperature (0.997), dissolved oxygen (0.571), oxygen saturation (0.942), electrical conductivity (0.385) and transparency (0.620) showed negative correlation. Similar results had been reported by Anandakumar & Thajuddin, 2013. Analysis of Variance (ANOVA) Analysis of variance (ANOVA) showed that physico-chemical parameters including air temperature (F=2.56, P=0.185), water temperature (F= 1.25, P=0.327), dissolved oxygen (F=1.21, P= 0.334), oxygen saturation (F=0.09, P=0.778), transparency (F=1.62, P=0.272), ph (F=0.32, P=0.600), turbidity (F=10.87, P=0.030) and salinity (F= 2.83, P=0.168) were statistically non significant. Electrical conductivity was statistically significant (F=5019.92, P=0.00). Seasonal Occurrence The tintinnids seemed to show seasonal occurrence. The dominance of T. wangi and T, sinensis was also reported by Davies & Ugwumba (2013) in Niger delta. During study period, three species of tintinnids belonging to one genus Tintinnopsis have been identified. The most abundant species of tintinnids were found in the order of T. sinensis, T. wangi and T. subpistillum. The tintinnids started appearing in the start of December and disappeared at the end of February. Tintinnids population was high in December and low in February. Diversity Indices Shannon- Weaver index ranged 0.888 to 0.435. It showed low diversity of tintinnids. These results were supported by Simpson index of dominance, Simpson index of diversity and Simpson reciprocal index. Species evenness was lower in February (0.396) and high in December (0.809). It showed even distribution in December. Species richness ranged 0.1-0.32. It showed very small food chain. Table I: Tintinnids isolated from Safari Zoo Lake (December 2013 to February 2014) Month December January February Species Mean ± SEM R% Mean ± SEM R% Mean ± SEM R% Tintinnopsis wangi 10.5 ± 1.707 45.6 6.5± 3.20 61.9 0.25 ± 0.25 50 Tintinnopsis sinensis 11 ± 1.290 47.8 3 ± 1.75 28.57 0.25 ± 0.25 50 Tintinnopsis subpistillum 1.5 ± 1.5 6.52 1 ± 0.57 9.52 0 ± 0 0 Total 23 SEM 10.5 SEM 0.5 SEM R% = relative percentage of species
282 S. HAYEE ET AL BIOLOGIA (PAKISTAN) Table II: Physico-chemical parameters of water (Mean ± SEM) (December 2013 to February 2014) Parameter December January February Air Temp.( c) 18.4 SEM 24.1 SEM 23.5 SEM Water Temp.( c) 14.06 ± 0.202 19.91± 0.495 23.11±0.710 O. S. (mg/l) 12.5 SEM 13.4 SEM 13.5 SEM Conductivity (µs/cm) 532.8 ± 2.78 526.5±1.22 538.3±0.92 D.O. Water (mg/l) 3.82 ± 0.13 3.25 ± 0.26 4.89 ± 0.68 Transparency (Inch) 1.87 ± 0.23 3.75 ± 0.32 2.9 ± 0.158 ph 7.6 SEM 7.37 SEM 7.4 SEM Turbidity (FTU) 189 64 156 Salinity 0.2 ± 0 0.2 ± 0 0.2 ± 0 Table III: Variation of Diversity Indices, Species Richness and Species Evenness. Month Shannon- Weaver index (H) Simpson index of Dominance (D) Simpson index of Diversity (1-D) Simpson Reciprocal index (1/D) Species Evenness (E) Species Richness (SR) DEC 0.8887 0.4413 0.5586 2.2655 0.809 0.1991 JAN 0.8787 0.4739 0.5260 2.1100 0.7998 0.2160 FEB 0.4355 0.2505 0.7494 3.9909 0.3964 0.3218 Fig., 3: Relative representation of species (December 2013 to February 2014) REFERENCES Agatha, S. & Simon, P., 2012. On the nature of tintinnid loricae (Ciliophora: Spirotricha: Tintinnina): a histochemical, enzymatic, EDX and high resolution TEM study. Acta. Protozool., 51(1):1-19. Allan, J.D., 1976. Life history patterns in zooplankton. Am. Nat., 110: 165-180. Anandakumar, N & Thajuddin, N., 2013. Physicochemical properties and seasonal variations in species composition and abundance of micro-zooplankton in the Gulf of Mannar, India. Indian J. Mar. Sci., 42(3): 383-389. Bakker, C. & Phaff, W.J., 1976. Tintinnida from coastal waters of the S.W.-Netherlands I. The genus Tmtinnopsis Stein. Hydrobiologia, 50:101-111. Davies, O.A. & Ugwumba, O.X., 2013. Effects of tide on zooplankton community of a tributary of upper bonny estuary, Niger Delta, Nigeria. Int. J. Sci. Res. Knowl., 1(9): 325-342.
VOL. 60 (2) IMPACT OF PHYSICOCHEMICAL PARAMETERS OF WATER ON TINTINNOPSIS 283 Hada, Y., 1937. The fauna of Akkeshi Bay. 4. The pelagic Ciliata. J. Fac. Sci. Hokkaido Imp. U., Ser. 4, Zoology, 5: 143 216. Hada, Y., 1938. Studies on the Tintinnoinea from the western tropical Pacific. J. Fac. Sci. Hokkaido Imp. U., Ser. 6, Zoology, 6(2): 82 190. Jiang, Y., Xu, H., Zhu, M. & Khaled A.S. Al- Rasheid., 2013. Temporal distributions of microplankton populations and relationships to environmental conditions in Jiaozhou Bay, northern China. J. Mar. Biol., 93(1):13-26. Karayanni, H., Christaki, U., Wambeke, F.V. & Dalby, A.P., 2004. Evaluation of double formalin-lugol s fixation in assessing number and biomass of ciliates: an example of estimations at mesoscale in NE Atlantic. J. Microbiol. Methods. 56: 349-358. Kofoid, C.A. & Campbell, A.S., 1939. Reports on the Scientific Results of the Expedtion to the Eastern Tropical Pacific in Charge of Alexander Agassiz, by the U.S. Fish Commission Steamer Albatross, from October 1904 to March 1905, Lieut. Commander L.N. Garrett, U.S.N., Commanding. XXXVII. The Ciliata: The Tintinnoinea. B. Museum Comp. Zool., 84: 473. Koste, W., 1978. Rotatoria. Die Rädertiere Mitteleuropas. Gebrüder Borntraeger. Berlin. Stuttgart. Bd. I & II. Marshall, S.M., 1969. Order Tintinnida Conseil international pour 1 exploration de la mer. Zooplankton Sheet. pp: 117-127. Melo, X.T., & Medeiros, E.S.F., 2013. Spatial distribution of zooplankton diversity across in temporary pools in semiarid intermittent river. Int. J. biol., 13:1-13. Montagnes, D.J.S. & Lessard, E.J., 1999. Population dynamics of the marine planktonic ciliate Strombidinopsis multiauris: its potential to control phytoplankton blooms. Aquat. Microb. Ecol., 20:167 181. Pierce, R.W. & Turner, J.T., 1993. Global biogeography of marine tintinnids. Mar. Ecol. Prog. Ser. 94: 11 26. Sano, A., 1975. Taxonomy of Tintinnida. Marine Science. 7:170 177. Shannon, C.E. & Weaver, W., 1949. The Mathematical Theory of Communication. University of Illinois Press, Urbana, IL, USA. Simpson, E.H., 1949. Measurement of diversity. Nature. 163: 688. Sulehria, A.Q.K & Malik, M.A., 2013. Diversity indices of pelagic rotifers in Camp Balloki Water Park, Lahore, Pakistan. Turk. J. Zool., 37: 699-705. Sulehria, A.Q.K., Mirza Z.S., Faheem, M. & Zafar, N., 2013. Diversity Indices of epiphytic rotifers of a floodplain. Biologia (Pakistan). 59(1):33-41. Sulehria, A.Q.K. & Malik, M.A., 2012. Population Dynamics of Planktonic Rotifers in Balloki Headworks. Pakistan J. Zool., 44(3):663-669. Takashi, O. & Taniguchi, A. 2003. Standing crop of planktonic ciliates in the East China Sea and their potential grazing impact and contribution to nutrient regeneration. Deep- Sea Res., II. 50: 423-442. Tillmann, U. 2004. Interactions between planktonic microalgae and protozoan grazers. J. Eukaryot. Microbiol., 51: 156 168. Yoo, K.I. & Kim, Y.O., 1990. Taxonomical studies on tintinnids (Protozoa: Ciliata) in Korean coastal waters 2. Yongil Bay. Korean J. Syst. Zool., 6(1): 87 122. Yoo, K.I., Kim, D.Y. & Kim., Y.O., 1988. Taxonomical studies on tintinnids (Protozoa: Ciliata) in Korean coastal waters. 1. Chinhae Bay. Korean J. Syst. Zool., 4(1): 67 90.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 285-288 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Indirect Shoot Induction Responses in Elite Chilli (Capsicum annum L.) Cultivars BILQUEES FATIMA, FAHIM KHADIJA, MONIS HUSSAIN SHAH & *MUHAMMAD USMAN Institute of Horticultural Sciences, University of Agriculture, Faisalabad, Pakistan ABSTRACT Capsicum cultivars Sanam and Nepali were investigated for their in vitro regeneration potential. The regeneration behavior was found to be independent of genotype. Maximum calli (83%) were induced in cotyledon explant on MS medium containing 2,4-D (1 mgl -1 ). No embryogenesis could be observed in calli when sub-cultured on auxin free medium. Highest shoot regeneration potential (53%) was observed in Cotyledon leaf explant induced calli on MS medium containing BAP and Kin (3 mgl -1 + 1 mgl -1 ). The plantlets developed from the regenerated shoots were subjected to root induction in cytokinin free medium and transplanted in soil under green house conditions for further morphogenetic studies. Key words: Indirect shoot, Capsicum annum, BAP, Kin. INTRODUCTION Vegetable seed industry of Pakistan is in its infancy and facing problems like lack of high quality seed production (only ~700 tons/annum) and lack of breeding and biotechnology programs for genetic improvement. Mostly seed is imported (~6000 tons/annum) from USA, Japan, Korea and India of worth US$ 300,000 with 10% annual increase due to rising demand of vegetables. Among vegetables, Chilli is one of the most important cash crop holding 13% of the area under cultivation but contributing only 1.21% of total vegetable production showing / highlighting low yield per hectare (www.faostat.org). During 2009-10, Pakistan was the 3 rd largest country producing 1.86 MMT Chillies and earning huge foreign exchange (Annonymous, 2010). The production statistics show that there is huge potential in the country to enhance its per unit production to earn more. There are only a few open pollinated commercial cultivars available including Sanam, Tatapuri, Gola Peshawari, Faisalabad No. 1, Talhar and Loungi etc. (Khokhar, 2013) whereas seed of most of the exotic hybrids is highly expensive and less adapted to local environmental conditions along with potential threats of introducing new diseases and pests. Chilli cultivars are highly susceptible to viruses like leaf curl virus, mosaic virus and other diseases. The above said problems could be resolved by the development of cultivars with higher yield and more tolerant to diseases using existing indigenous well adapted material through in vitro culture. Tissue culture offers the mass production of virus free plants in many crops and help in rapid propagation of selected plants with desirable characteristics in shortest possible time (Fatima et al., 2007). The development of an efficient micro propagation protocol will also be helpful in the production of disease-free, cost-effective hybrid plants. However, pepper in general and chillies (hot pepper) in particular are highly recalcitrant and difficult to propagate and regenerate in vitro (Prince et al., 1993). Different explants including root, hypocotyl, cotyledon, and shoot tip have been used for in vitro shoot regeneration (Arous et al., 2001; Sanatombi & Sharma, 2007; Kehie et al., 2012). Regeneration protocols could be helpful while dealing Capsicum for genetic improvement through genetic engineering. Therefore, the present study was initiated to observe response of culture conditions, explant types and plant growth regulators for embryogenic callus induction and shoot regeneration in pepper cultivars. Plant Materials MATERIALS AND METHODS Seeds of commercial cultivars Sanam and Nepali were obtained from Ayub Agriculture Research Institute (AARI), Jhang Road Faisalabad and local market. Seed Sterilization and Germination Seeds of both cultivars after surface sterilization with 5% NaOCl solution for 5 min were washed three times with sterile distilled water. Decoated seeds of both the cultivars were cultured on Murashige & Skoog (1962) medium for germination containing 3% sucrose. Explant Culture and Plantlet Regeneration Cultures were incubated in 2500 Lux illumination at 16/8 hrs day/night cycle at 25±1 C. *Corresponding author: m.usman@uaf.edu.pk
286 B. FATIMA ET AL BIOLOGIA (PAKISTAN) The nodal cuttings and shoot tips (3 to 5 mm in length) excised from in vitro raised seedlings were sub-cultured on MSO medium for plant multiplication following Usman et al., (2011). The cotyledon leaf (Cot L), hypocotyl (Hyp) excised from young seedlings and leaf disc (LD) explants excised from in vitro raised seedlings were cultured in MS media containing different levels of 2,4-D (1 mgl -1, 1.5 mgl -1 and 2 mgl -1 ) for callus induction under in vitro culture conditions. The calli induced on 2,4-D were subcultured on medium containing BAP and Kin in combinations (2+0.5 mgl -1, 3+1 mgl -1 and 4+1.5 mgl -1 ) for shoot regeneration. The excised shoots were subjected to root induction on MSO medium and the plants obtained were transferred to the greenhouse after acclimatization for further studies. by regulating endogenous hormone production (Mengxi et al., 2011; Nelakandan & Wang, 2012). Fig., 1: Response of culture conditions for callus induction in Cotyledon leaf, Hypocotyl and leaf disk explants. Experimental Design Experiments were laid out in Completely Randomized Design (CRD) and means were compared using least significant difference (LSD) test. RESULTS AND DISCUSSION Genotypic differences for callus induction and shoot regeneration were found to be insignificantly different to each other in Sanam and Nepali cultivars. Culture conditions markedly affected callus induction and higher callus induction (80% and 70%) was observed in Cotyledon leaf (Cot L) and leaf disc (LD) explants under light compared to dark culture conditions (Fig., 1). Among explants Cot L explants induced more calli and regenerated more shoots compared to hypocotyl and leaf disc explants derived calli. Lower levels of 2,4-D showed better callus induction compared to higher levels in Hyp and LD explants (Fig., 2). Similar response was observed for shoot regeneration as calli induced from Cot L explants regenerated into more number of shoots compared to calli obtained from other explants on MS medium containing BAP and Kin in combinations (Fig., 3). However, this decline in shoot regeneration was insignificant in Cot L explants. Plant regeneration studies in recalcitrant chilli pepper have been genotype dependent (Valadez-Bustos et al., 2009), hence studies were conducted in elite cultivars to explore shoot regeneration potential. In vitro regeneration in Capsicum is reported to be difficult (Ochoa-Alejo & Ramirez-Malagon, 2001). Amongst other environmental factors, variations in the photoperiod also play a key role in altering plant tissue behavior Fig., 2: Response of MS medium containing 2,4-D for callus induction in Cotyledon leaf (Cot L), Hypocotyl (Hyp) and leaf disk (LD) explants under light conditions. Fig., 3: Response of MS medium containing BAP + KIN for callus induction in Cotyledon leaf (Cot L), Hypocotyl (Hyp) and leaf disk (LD) explants under light conditions. The combinations of endogenous hormones produced in the tissue and exogenous hormones supplemented in the medium defined the tissue response (Duclercq et al., 2011). Amongst auxins, 2,4-D has been most widely used to induce in vitro embryogenic calli in a variety of plant species including carrot, onion, cucumber and leafy
VOL. 60 (2) INDIRECT SHOOT INDUCTION RESPONSES IN ELITE CHILLI 287 vegetables (Luthar & Bohanec, 1999; Mashayekhi & Neuman, 2006; Usman et al., 2011; 2014). In vitro callus induction and regeneration could be obtained by using auxins alone or in combination with cytokinin. The growing potential of meristematic cells can be maintained in medium supplemented with 2,4-D that enhances callus formation. Our studies revealed genotype independent response of explants for callus induction on 2,4-D and shoot regeneration on combinations of BAP and Kin. In contrast, Valadez-Bustos et al., (2009) showed genotype dependent behavior of calli induced in four cultivars. Long days enhanced callus induction response in pepper explants compared with dark conditions. Similar results are reported in Dierma erectum (Koetle et al., 2010), spinach (Milojevic et al., 2012) and in leafy vegetables (Usman et al., 2014). Light stimulus might have enhanced the endogenous auxin production leading to higher callogenesis. There are different reports on development of morphologically well-developed shoots in pepper. Hypocotyl explants developed normal adventitious shoot buds while cultured cotyledons resulted into non-elongating rosette shaped shoot buds. A few cotyledon leaf explants in our studies also showed similar rosette type bud development which did not develop further. Combinations of BA + IAA (Valadez-Bustos et al., 2009) and BAP alone (Rizwan et al., 2013) induced shoot regeneration. Higher shoot induction was reported in nodes and shoot tip explants on MS-medium supplemented with higher dose of BAP 8 mgl -1 in MS-medium (Kehie et al., 2012), BAP 0.3 mgl -1 alone and BAP 0.5 mgl -1 and KIN Kin 1.5 mgl -1 promoted shoot induction in cv. Kandhari (Robinson & Maheswari, 2013). In another report, shoots induced on BAP 5 mgl -1 and IAA 0.5 mgl -1 did not grow well and were malformed. Combination of BAP 2 mgl -1 and GA 3 0.2 mgl -1 produced normal shoots with the addition of activated charcoal into MS-medium (Mahmoud & Ghehsareh, 2013). However, the present study implicates different age of explants and callus induction on 2,4-D and higher shoot induction on BAP + Kin which grew further. Rooting was induced on MSO medium. Further studies are suggested to induce direct regeneration in different explants expensive chilli hybrids. Conclusion Callogenesis and shoot induction responses were found to be independent of genotype. Light conditions enhanced both morphogenic responses compared with dark conditions. Cot L explant induced more calli at low levels of 2,4-D and higher shoot induction at BAP and Kin compared to other explants types. Such studies could enhance our understanding towards the process of indirect shoot induction that may be useful for transformation of important biomolecules in adapted hot pepper cultivars. REFERENCES Arous, S., Boussaid, M. & Marrakchi, M., 2001. Plant regeneration from zygotic embryo hypocotyls of Tunisian chili (Capsicum annuum L.). J. Appl. Hortic., 3: 17-22. Duclercq, J., Sangwan-Norreel, B., Catterou M. & Sangwan, R.S., 2011. Denovo shoot organogenesis: from art to science. Trends Plant Sci., doi:10.1016/j.tplants.2011.08.004 Anonymous, (2010). Statistic database. http://faostat.org Fatima, B., Usman, M., Ashraf, T., Waseem, R. & Ali, M.A., 2007. In vitro shoot regeneration from cotyledon leaf and hypocotyls explants in Dahlia cultivars. Pak. J. Agri. Sci. 44(2): 312-316. Kehie, M., Kumaria, S. & Tandon, P., 2012. In vitro plantlet regeneration from nodal segments and shoot tips of Capsicum chinense Jacq. cv. Naga King Chili. Biotech., 2: 31-35. Khokhar, K.M., 2013. Present status and prospects of chillies in Pakistan. (http://www.agricorner.com). Koetle, M.J., Finnie, J.F. & Van Staden J., 2010. In vitro regeneration in Dierama erectum Hilliard. Plant Cell, Tiss. Org. Cult., 103: 23-31. Luthar, Z. & Bohanec, B., 1999. Induction of direct somatic organogenesis in onion (Allium cepa L.) using a two-step flower or ovary culture. Plant Cell Rep., 18: 797-802. Mahmoud, O. & Ghehsareh N.M., 2013. The effect of plant growth regulators and different type of explants on organogenesis of pepper (Capsicum annuum L.) in in vitro. Tech. J. Engin. App. Sci., 3(3): 271-278-272. Mashayekhi, K. & Neumann, K.H., 2006. Effect of boron on somatic embryogenesis of Daucus carota. Plant Cell, Tiss. Org. Cult., 84: 279-283. Mengxi, L., Zhigang. X., Yang Y. & Yijie, F., 2011. Effects of different spectral lights on Oncidium PLBs induction, proliferation, and plant regeneration. Plant Cell, Tiss. Org. Cult., 106: 1-10.
288 B. FATIMA ET AL BIOLOGIA (PAKISTAN) Milojevic, J., Tubic, L., Pavlovic, S., Mitic, N., Calic, D., Vinterhalter, B. & Zdravkovic-Korac, S., 2012. Long days promote somatic embryogenesis in spinach. Sci. Hortic., 142: 32-37. Murashige, T. & Skoog, F., 1962. A revised medium for rapid growth and bioassays with tobacco cultures. Physiol. Plant, 15: 473-497. Ochoa-Alejo, N. & Ramirez-Malagon R., 2001. In vitro chili pepper biotechnology. In Vitro Cell. Dev. Biol.-Plant, 37: 701-729. Prince, J.P., Pochard, E. & Tanksley S.D., 1993. Conservation of a molecular linkage map of pepper and comparison of synteny with tomato. Genome, 36: 404-417. Rizwan, M., Sharma, R., Soni, P., Gupta, N.K. & Singh, G., 2013. Regeneration protocol for chilli (Capsicum annuum L.) variety Mathania. J. Cell Tissue Res., 13(1): 3513-3517. Robinson, J.P. & Maheswari, M., 2013. In vitro multiple shoot induction from nodal explants of Capsicum annum L. of kandhari variety. Int. J. Curr. Microbiol., App. Sci., 2(6): 57-63. Sanatombi, K. & Sharma, G.J., 2007. Micropropagation of Capsicum frutescens L. using axillary shosot explants. Sci. Hortic., 113: 96-99. Usman, M., Noureen, S., Fatima, B. & Zaman, Q., 2014. Long days foster callogenesis in spinach and lettuce cultivars. J. Anim. Plant Sci., 24(2): 585-591. Usman, M., Hussain, Z. & Fatima, B., 2011. Somatic embryogenesis and shoot regeneration induced in cucumber leaves. Pak. J. Bot., 43(2): 1283-1293. Valadez-Bustos, M.G., Aguado-Santacruz, G.A., Carrillo-Castañeda, G., Aguilar-Rincon, V.H., Espitia-Rangel, E., Montes- Hernandez, S. & Robledo-Paz, A., 2009. In vitro propagation and agronomic performance of regenerated chilli pepper (Capsicum spp.) plants from commercially important genotypes. In Vitro Cell Dev. Biol- Plant., 45: 650-658.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 289-293 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Supplementation of Mannan-Oligosaccharides (MOS) in Four Close-Bred Parent Flocks of Japanese Quail Breeders and Its Subsequent Effects on Chick Weight 1 MUHAMMAD ANWAR IQBAL 1, NABILA ROOHI 1, MUHAMMAD AKRAM 2 & OMAIMA KHAN 1 1 Department of Zoology, University of the Punjab, Lahore, Pakistan 2 Department of Poultry Production, University of Veterinary and Animal Science, Lahore, Pakistan. ABSTRACT In the present study, twelve week old Japanese quail breeders (n=960) of four close-bred flocks (CBF) were randomly divided into four treatment groups (240 birds/group), comprised of 12 replicates having 20 birds each (15 females and 5 males). Birds were fed with three levels of Mannan-oligosaccharides (MOS) (0.25%, 0.5% and 1%) and a control group for 15 weeks. Eggs were hatched after five week interval. Results showed that chick weight was significantly (p 0.0001) higher in MOS supplemented groups compared to control. No significant differences were observed in the chick weight among strains of close-bred flock (CBF). A significant (p 0.0001) difference in chick weights was observed in interaction of CBF and MOS levels. The highest chick weight was recorded in flocks of Kaleem and Major, fed with 0.5% MOS, while, lowest chick weight was of control group of Sadat and Kaleem flocks. It is concluded that 0.50% MOS supplementation is the best one to increase chick weight and chicks of Kaleem and Major flocks were heavier compared to other flocks. Key words: Mannan-oligosaccharides, Japanese quail, Chick weight, Close-bred flocks INTRODUCTION Antibiotics are being used since past 50 years to control diseases and enhance the production performance of poultry birds, but this sub-therapeutic use of antibiotics in livestock and poultry production is under severe scientific and public scrutiny, as antibiotic growth promoters (AGP) are linked with the development of pathogenic bacteria which are antibiotic-resistant. These pathogenic bacteria create many health problems (Smith et al., 2003). As a result, the European Union banned sub-therapeutic usage of AGP in animal production in 2006 (Burch, 2006). Due to impending ban of AGP in livestock and poultry feed, it was compulsory for poultry industry to develop alternatives of AGP. The prebiotics and probiotics seem to be alternate candidates for AGP (Cavazzoni et al., 1998). Prebiotics are considered as an alternative to antibiotics. Prebiotics are the feed ingredients that are not digested by host digestive enzymes instead are fermented by beneficial bacteria and, therefore, are beneficial for host (Gibson & Roberfroid, 1995). Oligosaccharides fall under this category and are believed to affect the gut health of host (Ferket, 2004). Mannan-oligosaccharides (MOS) extracted from yeast cell wall, are not hydrolyzed by the host enzymes and are fermented by intestinal microbiota (Flickinger & Fahey, 2002). Mannan-oligosaccharides provide competitive binding sites for pathogens with mannose-specific type-1 fimbriae such as Salmonella and E. coli and decrease their attachment with intestinal wall and are ultimately excreted from the gut (Newman, 1994; Ferket et al., 2002). The MOS is commercially available as Bio- Mos and is being used in diets of animals and has shown some positive influence on performance of poultry and other farm animals (Rosen, 2007a; Rosen, 2007b). Various studies have been conducted to test the effects of Bio-Mos on the performance of poultry birds. Parks et al. (2001) studied MOS effects on male turkeys and found that Bio-Mos improved the performance of birds. Fritts & Waldrop (2003) and Sims et al. (2004) reported similar findings. It has been reported that MOS supplementation has some positive effects on fertility, hatchability and hatching chick weights. Abd-El-Samee et al. (2012) reported that diet containing chromium yeast (Cr) + MOS improved the egg fertility and hatching chick weight, whereas, hatchability was improved significantly in the group supplemented with Zinc alone or in combination with 1.0 g of MOS/kg of feed. In another study, Güçlü (2011) reported that prebiotics slightly increase the percentage of fertility and hatchability. Very little data is available regarding growthpromoting effects of MOS in subsequent hatching *Corresponding author: anwariqbalk@yahoo.com
290 M. A. IQBAL ET AL BIOLOGIA (PAKISTAN) chick weight of four close-bred flocks (CBF) of Japanese quail breeders. Keeping in view the existing knowledge, it is hypothesized that MOS supplementation can enhance weight of subsequent progeny of chick. MATERIALS AND METHODS Experimental Birds and Feeding A trial was conducted on 960 birds (12 weeks old) of four close-bred flocks (CBF) of Japanese quail breeders namely, Major, Kaleem, Sadat and Zahid, maintained at Avian Research and Training (ART) Centre, University of Veterinary & Animal Sciences (UVAS), Lahore, Pakistan. Each strain group consisting of 240 birds and was divided in four supplemental groups (A, B, C and D). Each feeding group (n=60) was further replicated into three groups (n=20) randomly (15 female + 5 male). The birds were placed in multi-deck cages for 15 weeks and fed a corn-based basal diet prepared according to NRC (1994) standards. Birds of group A, B, and C were provided basal diet supplemented with 0.25%, 0.5%, and 1.0% MOS respectively, whereas, birds of group D were fed only basal diet (control group). Birds could feed and drink ad-libitum throughout the experimental period. Quails were exposed to 16 hrs lighting program. Hatching Chick Weight Twenty five eggs from each replicate (total 1200) were collected during the last three days of 17 th, 22 th and 27 th week of experiment and sent to the hatchery for hatching. The eggs were incubated for a period of 17 days and at completion of hatching, chick weight was recorded using digital balance. Statistical Analysis Data were analyzed according to Completely Randomized Design (CRD) under factorial arrangement using General Linear Model (GLM) procedures. Means were separated out using Duncan s Multiple Range (DMR) (Duncan, 1955) test with the help of SAS 9.1 for windows. RESULTS AND DISCUSSION The present study was conducted to investigate the effect of Mannan-oligosaccharide supplementation on subsequent chick weight of Japanese quail at different age levels, i.e., at 17 th, 22 th and 27 th week. Results revealed that chick weight (g) was significantly (p 0.0001) higher in MOS supplemented groups compared to control group. At 17 th week, significantly higher chick weight (g) (7.57 ± 0.01) was recorded from eggs of birds fed with 0.50% MOS (group B) compared to other groups (7.46 ± 0.01, 7.53 ± 0.01, 7.45 ± 0.01). Similar results were recorded at 22 th and 27 th week of age. At 22 th week, the highest chick weight (g) (8.13 ± 0.01) was of B group followed by other groups (8.06 ± 0.02, 7.99 ± 0.02, 7.91 ± 0.01) respectively (Table 1). At 27 th week, chick weight (g) was significantly higher (8.87 ± 0.02) in B group compared to other groups and chicks of 17 th and 22 th week of age. Results showed a tendency of higher chick weight (g) with increasing age of birds that may be due to increase in egg size and egg weight with age. These findings are in agreement with findings of Nowasczewski et al. (2010) and Zita et al. (2013), who observed significant effect of age on egg weight. In present study, chick weight was not different significantly among close-bred flocks (CBF) of Japanese quail which was in accordance with findings of Vali et al. (2006), who observed no significant difference in Japanese quail strains, however, findings of Ali & Anjum (2014) were in contrast with our results in which they reported that egg weight was significantly differing in seven different strains of chicken that might result in higher chick weight. A significant (p 0.0001) difference in chick weights was observed during interaction of CBS and MOS levels. The highest chick weight (8.85 ± 0.02, 8.85 ± 0.02) was recorded in flocks of Kaleem and Major, fed with 0.5% MOS supplemented diet, while, lowest (8.59 ± 0.03, 8.60± 0.03) was of control group of Sadat and Kaleem flocks. In the present study, chick weight was significantly (p 0.0001) higher in MOS supplemented groups as compared to control at all three stages of experiment which were in
BIOLOGIA (PAKISTAN) 2014, 60 (2), 291-293 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Table I: Hatching chick weight (g) of four close-bred flocks of Japanese quail breeders fed with different MOS levels. CBF MOS Levels % 17 th week 22 th week 27 th week CBF Major 7.50 ± 0.02 8.03 ± 0.03 8.73 ± 0.03 Kaleem 7.50 ± 0.01 8.02 ± 0.03 8.71 ± 0.03 Sadat 7.49 ± 0.02 8.00 ± 0.01 8.74 ± 0.04 Zahid 7.53 ± 0.02 8.04 ± 0.03 8.71 ± 0.03 MOS Levels % 0.25 7.46 ± 0.01 c 8.06 ± 0.02 b 8.70 ± 0.01 b 0.50 7.57 ± 0.01 a 8.13 ± 0.01 a 8.87 ± 0.02 a 1.00 7.53 ± 0.01 b 7.99 ± 0.02 c 8.71 ± 0.02 b 0.00 7.45 ± 0.01 c 7.91 ± 0.01 d 8.61 ± 0.01 c CBF MOS Levels % Major 0.25 7.46 ± 0.01 ef 8.06 ± 0.03 bcd 8.71 ± 0.01 cd 0.50 7.56 ± 0.01 b 8.15 ± 0.00 a 8.85 ± 0.03 a 1.00 7.52 ± 0.01 bc 7.97 ± 0.02 efg 8.74 ± 0.01 bc 0.00 7.44 ± 0.01 ef 7.92 ± 0.01 fg 8.61 ± 0.02 de Kaleem 0.25 7.46 ± 0.01 ef 8.08 ± 0.03 bcd 8.70 ± 0.02 cde 0.50 7.54 ± 0.02 bc 8.13 ± 0.01 ab 8.85 ± 0.02 a 1.00 7.52 ± 0.01 bcd 7.94 ± 0.02 fg 8.68 ± 0.03 cde 0.00 7.46 ± 0.01 ef 7.93 ± 0.01 fg 8.60 ± 0.03 e Sadat 0.25 7.47 ± 0.01 def 8.03 ± 0.01 de 8.71 ± 0.03 cd 0.50 7.55 ± 0.03 b 8.11 ± 0.01 abc 8.92 ± 0.03 a 1.00 7.53 ± 0.02 bc 7.98 ± 0.01 ef 8.71 ± 0.03 cd 0.00 7.41 ± 0.02 f 7.89 ± 0.00 g 8.59 ± 0.03 e Zahid 0.25 7.45 ± 0.02 ef 8.07 ± 0.02 bcd 8.67 ± 0.03 cde 0.50 7.62 ± 0.01 a 8.12 ± 0.01 abc 8.83 ± 0.04 ab 1.00 7.55 ± 0.01 b 8.05 ± 0.02 cd 8.69 ± 0.02 cde 0.00 7.48 ± 0.01 cde 7.90 ± 0.01 g 8.63 ± 0.02 de Different alphabets on means ± SEM in column show significant differences at P 0.05 CBF= close-bred flocks, MOS= Mannan-oligosaccharides. a= highly significant value among CBF and in treatment groups followed by other alphabets. The order of highly significant values is a> b>c>d. accordance to the findings of Abd-El-Samee et al. (2012), who reported that diet containing chromium yeast + MOS improved the egg fertility and hatching chick weight. King ori (2011) reported that hatching weight depends on egg size. A positive correlation of eggs weight and hatchability was observed by
292 M. A. IQBAL ET AL BIOLOGIA (PAKISTAN) Senapati et al. (1996). In another study, Abiola (1999) and Abiola et al. (2008) also observed similar correlation in egg size and hatching weight. This increase in chick weight might be due to increase of egg size by MOS supplementation, which contained larger quantity of yolk (Williams, 1994). Heavy chicks had the ability to show best growth performance and resistance to optimal environmental factors. Conclusion It was concluded that MOS had the potential to enhance the growth performance of poultry birds and diet supplemented with 0.50% MOS had given the best results to increase hatching chick weight compared to other treatment groups and control, however, it did not affect the chick weight among close-bred flocks. The chicks, of Kaleem and Major flocks, were heavier as compared to other flocks. Acknowledgment Experimental birds and research facility at Avian Research and Training (ART) centre was provided by Department of Poultry Production, UVAS, Lahore, Pakistan. REFERENCES Abd-El-Samee, D.L., El-Wardany, I., Ali, N.G. & Abo-El-Azab, O. M., 2012. Egg quality, Fertility and Hatchability of laying quails fed diets supplemented with Organic inc, Chromium Yeast or mannanoligosaccharides. Int. J. Poult. Sci., 3: 221-224. Abiola, S.S., 1999. Effects of turning frequency of hen's egg in electric table-type incubator on weight losses, hatchability and mortality. Nig. Agr. J., 30: 77-82. Abiola, S.S., Meshioye, O.O., Oyerinde, B.O. & Bamgbose, M. A., 2008. Effect of egg size on hatchability of broiler chicks. Arch. Zootec., 57: 83-86. Ali, A. & Anjum, R., 2014. Evaluation of egg quality traits among different breeds / strains of chicken locally available in Pakistan. Sci. J. Anim. Sci., 3:27-34. Burch, D., 2006. Anticipated effects of the withdrawal of antibiotic growth promoters (AGPs) from pigs in the European Union available at: http://www.octagonservices.co.uk/articles/withdrawalagp.htm. Accessed Aug.2006. Cavazzoni, V., Adami, A. & Castrovilli, C., 1998. Performance of broiler chickens supplemented with bacillus coagulans as probiotics. Brit. Poult. Sci., 39: 526-529. Duncan, D.B. 1955. Multiple range and multiple F tests. Biometrics, 11: 1-42. Ferket, P.R., 2004. Alternatives to antibiotics in poultry production: Responses, practical experience and recommendations. Pages 56 67 in Re-imaging the feed industry. Proc. Alltech s 20th Annu. Symp. (T. P. Lyons and K. A. Jacques, eds). Nottingham Univ. Press, UK. Ferket, P.R., Parks, C.W. & Grimes, J.L., 2002. Benefits of Dietary Antibiotic and Mannanoligosaccharide Supplementation for Poultry. Proc Multi-State Poultry Meeting. Indianapolis, Indiana. Flickinger, E.A. & Fahey, G.C., 2002. Pet food and feed applications of fructans and other oligosaccharides. Br. J. Nutr., 87: 297-300. Fritts, C.A. & Waldroup, P.W., 2003. Evaluation of Bio-Mos mannan-oligosaccharide as a replacement for growth promoting antibiotics in diets for turkeys. Int. J. Poult. Sci., 2: 19-22. Gibson, G.R. & Roberfroid, M.B., 1995. Dietary modulation of the human colonic microbiotica: Introducing the concept of prebiotica. J. Clin. Nutr., 125: 1404 1412. Guclu, B.K., 2011. Effects of probiotic and prebiotic (mannanoligosaccharide) supplementation on performance, egg quality and hatchability in quail breeders. Ankara Üniv. Vet. Fak. Derg., 58: 27-32. King'ori, A.M., 2011. Review of the factors that influence egg fertility and hatchability in poultry. Int. J. Poult. Sci., 10: 483-492. Newman, K., 1994. Mannan-oligosaccharides, natural polymers with significant impact on the gastrointestinal microflora and the immune system. pp: 167 174 in Biotechnology in the feed industry. Proc. Alltech s10 th Annu. Symp. T. P.Lyons and K. A. Jacques, ed. Nottingham Univ. Press, UK. Nowaczewski, S., Kontecka, H., Rosiñski, A., Koberling, S. and Koronowski, P., 2010. Eggs quality of Japanese quail depending on layer age and storage time. Folia biol. (Kraków). 58: 201-207.
VOL. 60 (2) SUPPLEMENTATION OF MANNAN-OLIGOSACCHARIDES (MOS) 293 Parks, C.W., Grimes, J.L., Ferket, P.R. & Faırchıld, A. S., 2001. The effect of Mannanoligosaccharides, bambermycins and virginiamycin on performance of large white male market turkeys. Poult. Sci., 80: 718-723. Rosen, G.D., 2007a. Holo-analysis of the efficacy of Bio- Mos in broiler nutrition. Br. Poult. Sci., 48: 21-26. Rosen, G.D., 2007b. Holo-analysis of the efficacy of Bio- Mos in turkey nutrition. Br. Poult. Sci., 48: 27-32. Senapati, P.K., Madal, K.G.D. & Chatterjee, A.K., 1996. Relationship between egg weight, shape index, fertility and hatchability of Japanese quail eggs. Environ. Ecol. Stat., 14: 574-577. Sims, M.D., Dawson, K.A., Newman, K.E., Spring, P. & Hooge, D. M., 2004. Effects of Mannan-oligosaccharide, bacitracin methylene disalicyclate or both on live performance and intestinal microbiology of turkeys. Poult. Sci., 83: 1148 1154. Smith, D.L., Johnson, J.A., Harris, A.D., Furuno, J.P., Perencevich, E.N. & Morris, J.G., 2003. Assessing risks for a pre-emergent pathogen: Virginiamycin use and the emergence of streptogramin resistance in Enterococcus faecium. Lancet Infect. Dis., 3: 241 249. Vali, N., Edriss, M.A. & Moshtaghi, H., 2006. Comparison of Egg Weight between Two Quail Strains. Int J Poult Sci., 5: 398-400. Williams, T.D., 1994. Intraspecific variation in egg size and egg composition in birds: Effects on offspring fitness. Biol. Rev., 68: 35-59. Zita, L., Ledvinka, Z. & Klesalova, L., 2013. The effect of the age of Japanese quails on certain egg quality traits and their relationships. Veterinarski Arhiv. 83: 223-232.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 295-297 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Cockroaches (Periplaneta americana L. and Blattella germanica) as Potential Vectors of Nosocomial Infections in Hospitals of Lahore, Pakistan HAFSA MEMONA 1, FARKHANDA MANZOOR 1, & AFTAB AHMAD ANJUM 2 1 Department of Zoology, Lahore College for Women University, Lahore, Pakistan 2 Department of Microbiology, University of Veterinary and Animal Sciences, Lahore, Pakistan ABSTRACT Cockroaches are termed as one of the common place pest because of its wide distribution in human dwelling localities including houses, hospitals, food industries and kitchens. Its wide distribution in hospitals can be related to poor sanitary conditions, unhygienic environment, plenty of food sources and moist shady places. Their foraging behavior make them ideal vector for spreading pathogenic microbes. Worldly 7-73% of neonatal mortality is associated with nosocomial infections. Frequency of nosocomial infections is increasing day by day. Previous studies have implicated cockroaches as potential carriers of microorganisms in different parts of the world. This study was carried out to evaluate causal relationship between nosocomial infection causative agents and microbial fauna of cockroaches. Clinical samples were collected from those patients who admitted in hospitals and caught fever or any site-specific infections after 48 hours of admission into ICU and surgical wards. The collected samples were grown onto selective culture media and isolated bacteria were identified by using biochemical tests. Cockroaches were aseptically trapped from ICU and surgical wards. Microbial screening was done for cockroaches by growing saline suspension onto selective and differential media and bacterial isolates were identified by chemical tests. Pseudomonas aeruginosa (P. aeruginosa), Escherichia coli (E. coli), Staphylococcus aureus (S. aureus), Klebsiella pneumoniae (K. pneumoniae), Shigella, Salmonella and Enterococcus spp., were more prevalent isolates in all samples. Bacterial presence in clinical samples of suspected patients and on cockroach s body parts revealed their close relationship. Thus, cockroaches are probably playing a key role as vector for spreading nosocomial infections in ICU and strict environmental cleaning standard operating procedures (SOPs) should be adopted to reduce the risk of infection of this vector. Key words: Nosocomial infections, cockroaches, pathogenic bacteria, HAIs, hospitals, Pakistan INTRODUCTION Of the total 4500 species of cockroaches in the world, human inhabitation is infested with almost 30 species. However, three species of cockroaches are considered as most common pests of human dwellings. These species include: the American cockroach (Periplaneta americana L.), Oriental cockroach (Blatta orientalis) and German cockroach (Blattella germanica) (Hojat, 1996). American cockroaches are more abundant as compared to Oriental cockroaches and German cockroaches in Pakistan. Cockroaches are medically important as many illnesses and health problems have been associated with them. They carry viral and bacterial pathogens on their bodies in their faeces which can cause food poisoning, diarrhea and dysentery. Cockroaches isolated from hospitals and residential areas carry medically important microorganisms (Mlso et al., 2005). Hospital s environment is always assumed a huge reservoir of pathogenic microorganisms, nevertheless, they are found everywhere in this world. However, in the developed countries nosocomial infection ratio is from 5 to 10% while in developing countries above 25% of hospitalized patients (Lee, 1995). Recent studies indicated that hospital acquired infections (HAI) could be a major cause of illness and death in people who were exposed to hospital environment most of the time. Some studies have also reported that cockroaches found in hospitals are playing important role in deteriorating hospital environment and patient s health by imposing stress, infections, anxiety, asthma, allergy in persons who have deficient immunity. Cockroaches have been found in hospital vicinity inside intensive therapy zone, medical wards, surgical wards and canteen and medical store (Sabra & Abdel-Fattah, 2012). Hospital admitted patients are potentially exposed to environmental infections through several body passages such as open wounds, respiratory tract, urinary tract and intravenous catheters. Methicillin resistant S. aureus (MRSA) is also one of the supreme causes of nosocomial infections in hospitals. 40% to 70% hospital associated infections *Corresponding author: doc_farkhanda@yahoo.com
296 H. MEMONA ET AL BIOLOGIA (PAKISTAN) are chiefly caused by S. aureus in intensive care units (ICUs) in which MRSA is a major cause of HAIs. Health workers and medical staff are more likely to contract MRSA infections. These infections will ultimately lead to severe illness and deaths of medical staff and workers working on pathogenic microorganisms (Mahmood et al., 2010). Akhtar (2010) carried out research to determine the frequency of causative organisms of nosocomial infections and rate of nosocomial infections at the eight-bed medical ICU (MICU) of The Holy Family Hospital in Rawalpindi, from May 2007 to April 2008. RTIs (47.95%) and UTIs (25.3%) were the commonest infections in these patients and this is in agreement with other studies from Pakistan (Wahid et al., 2005; Shaikh et al., 2008). There are very few published reports on the epidemiology of Hospital associated infections (HAIs) in ICU patients from Pakistan. Therefore, this study was designed to find any connection between microorganisms present on, medical ICU patients acquiring nosocomial infections and, cockroaches associated with the same environment. MATERIALS AND METHODS This research was conducted at ICU and Surgical Wards of the Punjab Institute of Cardiology (PIC), Lahore. 30 Cockroaches were collected from hospital by sticky traps and external microbes were isolated and identified by standard microbial screening methods. The patients were observed for fever or any infections appearing during 48 hours of hospital admission. 20 Clinical samples (sputum, pus and epidermal swabs) were collected from suspected patients and were processed at microbiology laboratory for identification by selective media, colonial morphology, Gram staining, biochemical tests like catalase, coagulase and oxidase test. RESULTS Out of 30 collected cockroaches, American cockroaches were more prevalent and harbored more bacteria as compared to German cockroaches. Eleven different bacterial species were isolated from cockroaches external body which included E. coli, Enterococcus spp, Bacillus cereus, Proteus spp., K. pneumoniae, P. aeruginosa, S. epidermidis, Enterobacter spp., S. aureus, Salmonella spp. and Shigella spp. All cockroaches were infested with E. coli (100%), S. aureus (95%) and Bacillus cereus (92%) (Fig., 1). Remaining bacterial isolates were randomly present on different cockroaches. S. epidermidis (17%) was found in only 5 cockroaches showing its lower occurrence in cockroaches. P. americana is more infested as compared to B. germanica and B. orientalis due to its habitat and behavior. Patient s clinical samples demonstrate that most frequent site of infection was respiratory tract as more bacteria isolates were observed in sputum as compared to wounds and skin rashes. K. pneumonia (100%), P. aeruginosa (95%), and E. coli (100%) were the commonest organisms isolated from respiratory tract samples (sputum). Most RTIs were associated with mechanical ventilation as it is a major factor of RTIs in ICU. Isolation rate of other Gram-negative bacteria including S. aureus (90%) was relatively low in sputum but observed in wounds and skin rashes. Gram negative bacterial isolates were relatively higher in number than Gram positive bacterial isolates in both types of samples. Fig., 1: MSA plates showing growth of S. aureus isolated from external body of cockroach and wound sample. DISCUSSION The present research indicated that Gramnegative bacteria viz., P. aeruginosa, S. aureus, K. pneumoniae and E. coli were the commonest organisms isolated from both cockroaches and clinical samples. This study is in agreement with previous studies from Pakistan (Rizvi et al., 2007; Izhar et al., 2001). In another study carried out at Hyderabad, the frequency of Respiratory Tract Infections and Urinary Tract Infections were 30.1% and 39.1% respectively (Shaikh et al., 2008). This difference could possibly be due to the difference in antibiotic prescribing practices and variations in
VOL. 60 (2) COCKROACHES AS POTENTIAL VECTORS OF NOSOCOMIAL INFECTIONS 297 sample collection, culture and susceptibility testing practices. Another study was conducted in Rawalpindi hospital revealed that all collected cockroaches carry S. aureus and E. coli on their external body surface (Mlso et al., 2005). Indoor sanitary condition has been significantly correlated with infestation of cockroaches. Cockroaches are most probably exposed to the patient s fecal matter as this is confirmed by the presence of E. coli. Cockroaches are also associated with many outbreaks of gastro-enteritis, food poisoning and dysentery (Devrajani et al., 2009). The present study suggests that infestation of cockroaches in hospitals is a public health problem. They have potential to cause outbreaks of infectious and lethal diseases in hospitals and nursing homes. The abundance of cockroach population in hospitals indicates the unhygienic conditions. The best approach would be to improve and implement optimal infection prevention practices in ICUs of low resource countries. One third of these HAIs can be prevented by optimal infection prevention practices. Pest route of infection should be checked to reduce the risk. Acknowledgement We pay deepest gratitude to the personnel of PIC, Lahore and Urban Pest Management Team who facilitated our field work. Particular thanks to Higher Education Commission, Pakistan for financial funding for this research. REFERENCES Akhtar, N., 2010. Hospital Acquired Infections in a Medical Intensive Care Unit. J. Coll. Physicians Surg. Pak., 20(6): 386-390. Devrajani, B.R., Shah, S.Z., Devrajani, T. & Ali Qureshi, G., 2009. Nosocomial infections in medical ward (four months descriptive study in a tertiary care hospital). World J. Med. Sci., 4(1): 13-17. Hojat, H., 1996. Insects: A Guide to Collecting and Identification. 3 rd ed. Amir kabir Press, Tehran. 376 pp. Izhar, M., Khan, S. & Naqvi, A., 2001. Anti-microbial resistance among gram-negative bacteria prevalent in intensive care units. Pak. J. Surg., 17: 23-26. Lee, D.K., 1995. Distribution and seasonal abundance of cockroaches in urban general hospital. Korean J. Entomol., 25(1):57-67. Mahmood K., Tahir T., Jameel T., Ziauddin A. & Aslam H.F., 2010. Incidence of methicillinresistant Staphylococcus aureus (MRSA) causing nosocomial infection in a tertiary care hospital. Annals., 16(2): 91-96. Mlso, W.R., Qureshi, A.H., Khan, I.A. & Hussain, S., 2005. Frequency of different species of cockroaches in tertiary care hospital and their role in transmission of bacterial pathogens. Pak. J. Med. Res., 44(4): 143-148. Rizvi, M.F., Hasan, Y., Memon, A.R., Abdullah, M. & Saleem, S., 2007. Pattern of nosocomial infection in two intensive care units of a tertiary care hospital in Karachi. J. Coll. Physicians Surg. Pak., 17: 136-139. Sabra, S.H.M. & Abdel-Fattah, M.M., 2012. Epidemiological and microbiological profile of nosocomial infection in Taif hospitals, KSA (2010-2011). World J. Med. Sci., 7: 1-9. Shaikh, J.M., Devrajani, B.R., Shah, S.Z., Akhund, T. & Ishrat, B., 2008. Frequency, pattern and etiology of nosocomial infections in intensive care unit: an experience at tertiary care hospital. J. Ayub. Med. Coll. Abbottabad., 20: 37-40. Wahid, F., Masood, N. & Jafri, A., 2005. Nosocomial pneumonia in mechanically ventilated patients. Pak. Armed Forces Med. J., 3: 25-28.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 299-303 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Assessment of Transfer of Copper and Cobalt from Soil to Forage in Relation to the Dietary Allowance for Livestock HAZOOR AHMAD SHAD 4, ZAFAR IQBAL KHAN 1, KAFEEL AHMAD 1, ABRAR HUSSAIN 1, ZILE HUMA 1, ASMA ZAFAR 1, ZAFAR HAYAT 2, ABID EJAZ 1, ZAHARA BIBI 1, MUNEEBA SHAH 1, SYED HAMMAD RAZA 1, & ALIREZA SEIDAVI 3 1 Department of Biological Sciences, University of Sargodha, Sargodha, Pakistan 2 Department of Botany, Government College University Faisalabad, Pakistan 3 Department of Animal Science, Rasht Branch, Islamic Azad University, Rasht, Iran 4 Department of Chemistry, University of Sargodha, Sargodha, Pakistan ABSTRACT The current investigation was carried out to assess the influence of harvesting period on the transformation of copper and cobalt from soil to forage. Soil and pasture harvestings were obtained six times after an interval of 30 days. The results exhibited that the maximum level of soil Cu was observed at the 1 st period and the minimum at the 6 th period of harvesting. Connote levels of soil Cu speckled from 1.85 4.90 mg/kg at various intervals of harvesting periods. The uppermost value of forage Cu was found at the 1 st and the lowest at the 6 th period. Harvest varied from 8.84 18.24 mg/kg throughout the investigation at all harvesting periods. Mean levels of soil Co differed from 0.042 0.065 mg/kg at diverse harvesting times. Forage Co concentration was the highest at the 6 th period and the lowest at the 2 nd period throughout the study. The concentration of Co both in soil and forage were at severe deficient levels signifying the need of soil amendment with Co containing fertilizers to improve the Co stuffing of the pasture soil and, in turn, availability of Co to pasture from soil for grazing ruminants. Both, Co and Cu, contents were in both soil and forages although were sufficient for growing forages and for ruminants, but at some instances these concentrations were at severe marginal level, from which the deficiency of this element in animals may be anticipated. Therefore, soil amendment, and supplementation of livestock should be practiced continually as a prophylactic measure to safe guard the livestock from any potential hazard of deficiency caused by these elements at the farm. Key words: Animal, Cobalt, Copper, Forage, Plant, Soil. INTRODUCTION Production of ruminants in various countries of the world is conducted and monitored under the rotational pastoral system. Under this pastoral management livestock mostly depends on sown and wild varieties of forage plants both in the improved and native pastures (Khan et al., 2006; Vargas & McDowell, 1997). Variation in the quantity of minerals in soil and in forage is a major motive to reduce the production of ruminant in such areas. It has also been investigated that in these ruminants, number of health problems especially due to metabolism, are also caused by the variation of the mineral quantities in the soil and forage (Khan et al., 2006; McDowell & Arthington, 2005). Intakes of various minerals in excessive amount can have deleterious effects on the health of ruminants and often non-specific signs of mineral imbalances of marginal levels can not be noticed by the farmers or livestock owners and these signs can not be interpreted easily because of the possibility of involvement of various types of parasites in the digestive tract of ruminants as imbalance in minerals may predispose the livestock to different diseases (McDowell, 1997; McDowell & Arthington, 2005). The complicated continuum of soil, plant, and ruminant system involved in the nutrition of the animals affects the mineral uptake of animals as a result of seasonal changes, parallels to changes in mineral contents in the dietary sources consumed by the ruminants (Khan et al., 2006; Smith & Loneragon, 1997). Soil and forage analyses are often considered to be the diagnostic tools for measuring the requirements of animals for minerals in different season and at various stages of plant growth. This mapping technique is routinely employed because of its ease and low cost of soil and forage analyses as compared to complicated and very costly technique of tissue and fluid collection and processing for analyses. The livestock has low production potential and its major cause is under nutrition and grazing ruminants do not receive mineral supplements, or if supplemented, then with out any previous knowledge of mineral concentration in the forages consumed by the animals. This practice of provision imbalance mineral supplementation results in various symptoms of deficiencies and toxicities due to the lack of appropriate mineral mixture. In Pakistan, where mineral levels of various forage species and other dietary sources are un known, and are highly different due to season, location, *Corresponding author: zikhan11@gmail.com
300 H. A. SHAD ET AL BIOLOGIA (PAKISTAN) sampling periods, and forage species as well their developmental and growth stages. Therefore, it is imperative to analyze the soil and forage samples for mineral profile in different regions to appraise the requirement of ruminants for obtaining the maximum productivity of livestock. Keeping this in view, the current study was carried out in Sargodha at a rural livestock farm, to assess the copper and cobalt levels in the soil and forage plants in order to recommend supplements of mineral mixture are specific as a prophylactic measure to prevent deficiency or toxicity in ruminants. MATERIALS AND METHODS The recent investigation was done at Rural Livestock Farm nearly Silanwali, District Sargodha, situated in the northeast of Pakistan. Sargodha is well known for its citrus production and has many different types of industries. Forages and livestock are affected by different types of seasons. Sargodha also has these four seasons. The dominant and main improved species of forage was Brassica campestris in the pasture. Soils are loamy in nature and mainly alkaline. The soil and forage samples were collected concurrently after interval of 30 days. Samples were air and oven dried ground and digested and subjected to wet digestion with HNO 3 and HClO 4 acids (3:1) and copper and cobalt concentration in soil and forage samples were determined by using Atomic Absorption Spectrophotometer Perkin-Elmer AAS-5000 (Perkin- Elmer Corp., 1980). The data thus collected were statistically analyzed by using SPSS version 17. The significance differences among mean values were worked out at 0.001, 0.01 and 0.05 probability levels as recommended by Steel & Torrie (1980). consumed by the ruminants at the pasture. Almost similar levels of soil Cu have previously been described by Gune et al. (2004) in Kenya and Khan et al. (2006) in Pakistan. The Cu concentration is lesser from the values in soil as reported by Kadovic et al. (2011) in the Spanish region. Whereas, soil Cu values found during present investigation were higher than the values found earlier by Shallari et al. (1998). Plant analysis continues to develop as a significant managing tool as interpretive databases for a variety of crops, stages of growth, and indicator tissue are developed. Soil Cu values investigated by Bhat et al. (2011) in India were lower than values reported in present investigations. The conclusion of the current inquiry for Cu level in soil exhibited enormous variations which can be attributed to the rainfall happening periodically in this area during various times of the year. In the present investigation soil Cu level above the reference value may reflect the presence of organic matter in the soil, on which Cu availability is highly dependent (Khan et al., 2006). Based on the present findings, it is recommended that soil amendment with Cu containing fertilizers is essential to increase the soil Cu levels as in some harvesting periods, the level of soil Cu was at marginal deficient which may be expected to lower level and unavailable the forage crops at any time of the year. RESULTS AND DISCUSSION Soil-Cu Soil Cu depicted a significant effect of harvesting times on its levels for the duration of the present investigation. The uppermost amount of soil Cu was observed at the 1 st harvest and the lowest being at the 6 th time of harvesting. Connote amounts of soil Cu dappled from 1.85 4.90 mg/kg at diverse harvesting intervals. In reality, unswerving trend of augment or decline in soil Cu levels were established in this investigation (Fig. 1). For the growth of forage crops Rhue & Kidder (1983) recognized values of 1 mg/kg but in present studies, the values of soil copper level was larger than the reported values. These soil Cu levels observed in present investigation were in a large amount and far-off enough for the requirements of plant species Fig., 1: Effect of different sampling periods on soil Cu concentrations. Forage-Cu A significant influence of harvesting intervals was observed on Cu levels of forage species. The maximum value of forage Cu was observed at the 1 st harvesting time and the minimum values were observed at the 6 th period throughout all the harvesting periods. Mean values of forage Cu ranged from 8.84 18.24 mg/kg at various harvesting intervals. There was a gradual
VOL. 60 (2) ASSESSMENT OF TRANSFER OF COPPER AND COBALT FROM SOIL 301 drop off in forage Cu level in the current study (Fig., 2). The values reported in our studies was similar to that of Khan et al. (2006, 2011), but was less than reported by others (Ahmad et al., 2010; Khan et al., 2009). The critical values of forage Cu are 10 mg/kg as suggested by NRC (1984) but values in these investigations were higher as compared to critical value of forage Cu. So there is no anticipation of any toxicosis but deficiency of Cu in livestock grazing in these pastures may be expected. There was a synergism between Cu and Zn, so due to high Zn in forage may possible raised the level of Cu in the forage. In this study forage Cu were severely to moderate deficient levels which may cause some reproductive problems in animals during any time of the season. Therefore supplementation of animals with specifically tailored mixture may continually be provided to animals round the year to prevent any deficiency symptoms. Soil-Co Analysis of variance of data for soil Co showed a non-significant influence of harvesting times on its amount and speckled at various harvesting times through out this investigation. The uppermost level of soil Co was observed at the 6 th interval and the lower most level at the 5 th harvesting time. Connote levels of soil Co differed from 0.042 0.065 mg/kg at various harvesting times. There was a irregular decrease up to 4 th and followed by sudden decrease at 5 th harvesting and then again increased at the last harvesting time in soil Co in this during this study (Fig. 3). In the present investigation the soil Co values were far-off below the decisive value for soil Co (0.1 mg/kg) established by McDowell et al. (1984) for the requirements of forage species. The soil Co levels were lower than those previously reported by various researchers (Gune, 2004; Bhat et al., 2011). The higher soil Co values were already reported by Khan et al. (2011) and Kumaresan et al. (2010), but almost similar Soil Co value was reported by Khan et al. (2006).Based on our findings, there is warranted need of soil amendment with fertilizers containing Co to enhance soil Co level and its availability to forage crop in relation the requirements of grazing livestock. Fig., 2: Effect of different sampling periods on shoot Cu concentrations Fig., 3: Effect of different sampling periods on soil Cu concentrations. Forage-Co A non-significant influence of harvesting periods on the Co levels was observed on forage shoot Co levels all through the present investigation. Forage Co levels were maximum at the 6th harvesting periods and minimum at the 2 nd interval during this investigation (Fig., 4). Shoot Co varied from 0.125 0.162 mg/kg. There was an incoherent difference in shoot Co levels at various harvesting periods. The forage Co levels were lower than the values already reported and recommended, i.e., 0.11 mg/kg by NRC (1984). The forage Co was higher than the critical level and considered to be sufficient for the requirement of ruminants grazing
302 H. A. SHAD ET AL BIOLOGIA (PAKISTAN) there in the pasture at rural livestock farm, indicating no urgent need of supplementation to livestock, which may no pose a potential threat of its toxicity as its tolerance range is higher for grazing ruminants (McDowell & Arthington, 2005) therein. The forage Co values were higher than the concentration reported by ( McDwell et al., 1997; Espinoza et al., 1991; Khan, 2005), and lower than those forage Co values reported Abd-ul-Rahman et al. (1998), but Khan et al. (2006) found similar forage Cobalt concentration in his studies in an animal ranch in Pakistan. In our study, forage Co concentration seemed to be sufficient for all forms of life at different developmental stages of animals as Co is sufficient to maintain growth of animals (McDowell & Arthington, 2005). Based on the results of the current exploration there seems to be no warranted need of Co supplementation to livestock grazing at the pasture. Fig., 4: Effect of different sampling periods on shoot Co concentrations. Conclusion Soil and plant examination can be significant to fast a meticulous considerate of the factors upsetting livestock physical condition and productivity at paddock. Forage Co concentration was the highest at some sampling periods and lowest at other sampling periods showing fluctuation inconsistently. Co showed deficiency in both soil and forage along with copper indicating the improvement of pastureland of that particular are with fertilizers containing these elements in highly available forms for optimization of livestock at studied farm. REFERENCES Abd-ul-Rahman, M.M., Kincaid, R.L. & Elzubeir, E.A., 1998. Mineral deficiencies in grazing dairy cattle in Kordofan and Darfur regions in western Sudan. Tropic. Anim. Health and Produc., 30: 123 135. Ahmed, K., Ejaz, A., Khan, Z.I., Gondal, S., Fardous, A., Hussain, A., Sher, M., Valeem, E.E. & Ullah, S., 2010. Evaluation of dynamics of Iron and Manganese from Pasture to Buffaloes: A case study at rural Livestock farms. Pak. J. Bot., 42(5): 3415 3421. Aubert, H. & Pinta, G., 1977. Trace Elements in Soils. Elsevier Scientific: New York. Bhat, M.S., Shaheen-Zaman, M, & Muhee, S., 2011. Mineral inter-relationship among soil, forage and dairy cattle in Kashmir, India. Vet World, 4: 550 553. Espinoza, J.E., McDowell, L.R., Wilkinson, N.S., Conrad, J.H. & Martin, F.G., 1991. Monthly variation of forage and soil minerals in Central Florida. II. Trace Minerals. Commun. Soil Sci. Plant Anal., 22: 1137 1149. Gune, A., Alpaslan, M. & Inal, A., 2004. Plant growth and fertilizer. Ankara Univ. Agriculture Pub. No: 1539, Ankara, Turkey (in Turkish). Kadovic, R., Belanovic, S., Obratov, P., Bjedov, I. & Nada, D., 2011. Assessment of heavy metal content in soil and grasslands in national park of the lake plateau of the N. P. Durmitor Montenegro. African. J. Biotech., 10 (24): 5337 5345. Khan, Z.I., Ashraf, M. & Hussain, A., 2006. Seasonal variation of trace elements in a semi arid pasture. Commun. Soil Sci. Plant Anal., 37: 1471 1484. Khan, Z.I., Ashraf, M., Ahmad, K., Ahmad, N., Danish, M. & Valeem, E.E., 2009. Evaluation of mineral composition of forages for grazing ruminants in Pakistan. Pak. J. Bot., 41(5): 2465 2476. Khan, Z.I., Ashraf, M., AL-Qurainy, Ahmad, K., Gondal, S. & Fardous, A., 2011. Studies on the transfer of Copper from soil to pastures at different sampling periods: A case study
VOL. 60 (2) ASSESSMENT OF TRANSFER OF COPPER AND COBALT FROM SOIL 303 of a semiarid region (Sargodha) in Pakistan. Biol. Trace Ele. Res., 141: 126 130. Khan, Z.I., Hussain, A., Ashraf, M., Valeem, E.E. & Javed, I., 2005. Evaluation of variation of soil and forage minerals in pasture in a semiarid region of Pakistan. Pak. J. Bot., 37(4): 921 931. Kumaresan, A., Bujarbaruah, K.M., Pathak, K.A., Brajendra, & Ramesh, T., 2010. Soil- plantanimal continuum in relation to macro and micro mineral status of dairy cattle in subtropical hill agro ecosystem. Trop. Anim. Health Prod., 42: 569 577. McDowell, L.R. & Arthington, J.D., 2005. Minerals for grazing ruminants in tropical regions. 5th Ed. University of Florida, Gainesville. 86 pp. McDowell, L.R., 1997. Minerals for Grazing Ruminants in Tropical Regions. Extension Bulletin., Anim. Sci. Dept. Centre for Trop. Agric., Univ. Florida. 81 pp. McDowell, L.R., Conrad, J.H. & Ellis, G.L., 1984. Mineral deficiencies and imbalances, and their diagnosis. In: Symposium on Herbivore Nutrition in Sub-Tropics and Tropics-Problems and Prospects. (Eds.): F.M.C. Gilchrist and R.I. Mackie. Craighall, South Africa. pp: 67 88. NRC, 1984. Nutrient Requirements of Beef Cattle. 6 th Revised Ed. Nutrient Requirements of Domestic Animals, No. 4. National Academy of Science, National Research Council, Washington DC. Rhue, R.D. & Kidder, G., 1983. Analytical procedures used by the IFAS extension soil laboratory and the interpretation of results. Soil Sci. Dept., Univ. Florida, Gainesville, p 1. Shallari, S., Schwartz, C., Hasko, A. & Morel, J.L., 1998. Heavy metals in soils and plants of serpentine and industrial sites of Albania. Sci. Total Environ., 209: 133 142. Smith, F.W. & Loneragon, J.F., 1997. Interpretation of plant analysis: concepts and principles. In Plant Analysis. An Interpretation Manual. 2nd Edn. (Eds.): D. J. Reuter and J.B. Robinson. pp: 3 33. Steel, R.G.D. & Torrie. J.H., 1980. Principles and procedures of statistics, A Biometrical approach (2 nd Ed.). McGraw Hill Book Co. Inc., New York, pp: 336-354. Vargas, E. & McDowell, L.R., 1997. Mineral Deficiencies of Cattle in Central America and the Carbean, Emphasizing Cost Rica. Proc. Int. Conf. Liv. pp: 99-114.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 305-307 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Toxicity and Avoidance Behaviour of Coccinella septempunctata (Coleoptera: Coccinellidae) Against Deltamethrin *HAFIZ MUHAMMAD TAHIR, RABIA YAQOOB, USMAN AKHTAR, KAFEEL AHMED, MARIA SHARIF, RIDA WAKEEL, ANIQA ZAFFAR, MARIA GHAFFAR & MUHAMMAD MAHBOOB Department of Biological Sciences, University of Sargodha, Sargodha, Pakistan ABSTRACT In the present study we conducted residual bioassay tests to evaluate the susceptibility of Coccinella septempunctata to the recommended field dose of deltamethrin (i.e., 50mL of insecticide dissolved in 200mL). We also studied the insecticide avoidance behaviour of C. septempunctata. Studied population was found susceptible to the recommended dose of deltamethrin as we observed 100% mortality after 24 hours of insecticide exposure. Results of Fisher exact test revealed a significant difference in mortality at different time intervals. C. septempunctata learned to avoid deltamethrin treated leaf surface after their repeated exposure to the same insecticide. Key words: beetles, Coccinella septempunctata, Deltamathrin, Avoidance behaviour INTRODUCTION Seven spotted ladybird beetle Coccinella septempunctata is a common and best known natural predator of many pest species of various crops (Solangi et al., 2007). These Coccinellids feed upon various soft bodied insects like thrips, aphids, mealy bugs, psyllids, insect eggs and larvae etc. (Rafi et al., 2005). Lady bird beetle also consumes fungal spores, nectar and pollen as alternative food source (Ali et al., 2009). Approximately 90% of ladybird species are thought to be beneficial as they feed specifically on hemipteran and homopteran pests (Swaminathan et al., 2010). Now days, integration of various insecticides (pyrithroids mostly) along with natural enemies or other biological control agents are in practice for the effective control of insect pests (Radcliffe et al., 2009). Excessive use of insecticides not only has deleterious effects on beneficial insects but also cause resistance among insect pests, either behavioural or physiological (Hostetler & Brenner, 1994). So before recommending an insecticide for Integrated Pest Management (IPM) programme, it is important to understand its effects on behaviour and life expectancy of beneficial insects. Insecticides having least toxic effects on natural predators should be integrated with biological control (Johnson & Tabashnik, 1999). MATERIALS AND METHODS Adults of seven spotted ladybird beetle C. septempunctata were collected from agricultural fields in vicinity of University of Sargodha. For testing the toxicity of deltamethrin to C. septempunctata, residual bioassays were performed against recommended field dose of deltamathrin (50mL of insecticide dissolved in 200 ml of water). Insecticide solution was sprayed on plant leaves with the help of sprayer. After letting the insecticide air dry, 15 insects were released on leaves for one hour in glass jar (12cm long and 4cm wide). Mouth of each glass jar was covered with mesh cloth. After one hour of exposure, insects were shifted to clean jars and post treatment mortality was observed after every four hour till 24 hours. Mortality at different time intervals was compared using Fisher Exact test. Control group was exposed to the plant leave treated with distilled water. Bioassay tests were replicated thrice. To check whether or not C. septempunctata to avoid selected insecticide after repeated exposure of same insect to the insecticide, a plant leave was cut into circular shape and divided into two halves from the centre. One half was impregnated in deltamethrin preparations (80 times dilution of recommended field dose) while other one in distilled water. Both parts of leave were air dried, stick back together and labeled as treated and untreated. Plant leave was placed in a glass petri *Corresponding author: hafiztahirpk1@yahoo.com
306 H. M. TAHIR ET AL BIOLOGIA (PAKISTAN) plate (4cm wide and 1.5 cm high) and one C. septempunctata was released onto it. Glass plate was covered with the lid. Time spent by the insect on insecticide or water treated part was noted for 40 minutes. After 30 minutes of rest same insect was again placed onto the same glass plate containing plant leaf. Again time spent by this insect on water or insecticide treated leaf was recorded. This activity was repeated eight times for the same insect and the experiment was repeated with 10 insects. RESULTS AND DISCUSSION It is depicted from results shown in Fig., 1 that C. septempunctata population is susceptible to recommended field dose of deltamethrin as 100% insects were died during 24 hours of exposure. When mortality rate of C. septempunctata was compared at different time intervals we observed statistically significant difference (P < 0.05). Previously ladybird beetle C. undecimpunctata has been found susceptible to recommended field doses of cypermathrin, aldicarb, thiamethoxam, deltamethrin and abamectin (Ahmed et al., 2011; Youn et al., 2003). Two species of ladybird viz., C. sexmaculatus and Thea cincta were found susceptible to different pyrithroids and malathion (Damayanthe & Karunaratne, 2005). Fig., 1: Mortality of C. septempunctata post 1hour exposure of deltamethrin (field dose). Bars in the figures are representing standard errors. Results of present study showed that C. septempunctata is able to detect presence of insecticide. In behavioural response test, we observed that with the passage of time, insects learned to avoid deltamethrin treated part of leaf and spent more time on non-treated part. We also observed marked change in time spent by the insects on treated and untreated surfaces (Fig., 2). Furthermore, we also observed during our study that although we diluted the insecticide 80 times but still it affected the locomotion of this insect. Similar results were reported by Romero et al. (2009) and Spindola et al. (2013) who studied behaviour of bed bugs and predatory ladybird beetle, Eriopis connexa respectively, against deltamethrin treated surfaces in a two-choice experiment. According to their findings resistant strains of E. connexa avoided insecticide treated surfaces while susceptible one were highly irritable when released to pyrithroid sprayed plants. Rose et al. (2005) has also reported preference of Hylobius abietis for untreated plants over pyrethroid treated plants. It is concluded that recommended dose of deltamethrin is deadly to C. septempunctata. It is suggested that effects of this insecticide on other beneficial arthropods should be studies before recommending this insecticide in IPM programme. Fig., 2: Behavioural response of C. septempunctata towards deltamathrin treated surface. Bars in the figures are representing standard errors. REFERENCES Ahmad, M., Rafiq. M., Arif, M.I. & Sayyed, A.H., 2011. Toxicity of Some Commonly Used Insecticides Against Coccinella undecimpunctata (Coleoptera: Coccinellidae). Pak. J. Zool., 43(6): 1161-1165. Ali, A., Rizvi, P.Q. & Pathak, M., 2009. Reproductive performance of Coccinella transversalis Fabricius (Coleoptera: Coccinellidae) on different aphid species, Biosystematica, 3: 37-41. Damayanthe, B.T. & Karunaratne, S.H.P.P., 2005. Biochemical characterization of insecticide resistance in insect pests of vegetables and predatory ladybird beetle. J. Natur. Sci. Foundation Sri Lanka, 33(2): 115-122. Hostetler, M.E. Brenner, R.J., 1994. Behavioral and physiological resistance to insecticides in the German cockroach (Dictyoptera:
VOL. 60 (2) BEHAVIOUR OF COCCINELLA SEPTEMPUNCTATA AGAINST DELTAMETHRIN 307 Blattellidae): an experimental reevaluation. J. Econ. Entomol., 87(4):885-93. Johnson, M.W. & Tabashnik, B.T., 1999. Enhanced bio-logical control through pesticide selectivity. In: Handbook of biological control. eds. T. S. Bellows and T. W. Fisher, pp: 297-317. Radcliffe, E.B., William D., Hutchison, W.D. & Cancelado, R. E., 2009. Integrated Pest Management: Concepts, Tactics, Strategies and Case Studies. Cambridge University Press, New York. Rafi, M.A., Irshad, M. & Inayatullah, M., 2005. Predatory Ladybird beetles of Pakistan. National Insect Museum & Insect Pest Informatics. IPM Programme. Rohani Press, Islamabad, Pakistan. 105 pp. Romero, A., Potter, M.F. & Haynes, K.F., 2009. Behavioural Responses of the Bed Bug to Insecticide Residues. J. Med. Entomol., 46(1): 51-57. Rose, D., Leather, S.R. & Matthews, G.A., 2005. Recognition and avoidance of insecticide treated Scots Pine (Pinussylvestris) by Hylobiusabietis (Coleoptera: Curculionidae): implications for pest management strategies. Agri. Forest Entomol., 7: 187 191. Solangi, B.K., Abdul Ghani Lanjar, A.B., and Mohammad Khan Lohar, M.K., 2007. Comparative toxicity of some insecticides on 4th instar grub of Coccinella septempunctata L. under laboratory conditions. Sarhad J. Agric., 23: 4 (article number). Spindola, F., Silva-Torres, C.S.A., Rodrigues, A.R.S. & Torres, J.B., 2013. Survival and behavioural responses of the predatory ladybird beetle, Eriopis connexa populations susceptible and resistant to a pyrethroid insecticide. Bull. Entomol. Res., 103(4):485-494. Swaminathan, R., Jat, H. & Hussain, T., 2010. Side effects of a few botanicals on the aphidophagous coccinellids. J. Biopest., 3: 81-84. Youn, Y.N., Seo, M.J., Shin, J. G., Jang C. & Yu. Y.M., 2003. Toxicity of greenhouse pesticides to multicolored Asian lady beetles, Harmonia axyridis (Coleoptera: Coccinellidae). J. Biol. Cont. 28(2): 164-170.
BIOLOGIA (PAKISTAN) 2014, 60 (2), 309-312 PKISSN 0006 3096 (Print) ISSN 2313 206X (On-Line) Phenotypic Response of Mungbean Germplasm Against Urdbean Leaf Crinkle Virus Disease MUHAMMAD AHMAD ZESHAN, SAFDAR ALI, MUHAMMAD ASLAM KHAN, SHAHBAZ TALIB SAHI & MUHAMMAD ATIQ Department of Plant Pathology, University of Agriculture, Faisalabad, Pakistan ABSTRACT Mungbean (Vigna radiata L.) is regarded as a quality pulse. Urdbean leaf crinkle virus (ULCV) causes huge losses in mungbean. Eleven varieties and lines of Mungbean were screened under field conditions to identify resistant source against ULCVD. None of the varieties and lines was found to be highly resistant against ULCVD. Four entries: NM-2006, Azri-2006, M-6 and M-97001 appeared to be resistant. The remaining seven varieties and lines showed varying degree of susceptibility to ULCVD. For the management of ULCVD, use of resistant source is an environmental friendly approach. Key words: Phenotypic, ULCV, resistance, mungbean, evaluation INTRODUCTION Mungbean (Vigna radiata L.) belongs to family Fabaceae and is regarded as a quality pulse. It provides a balanced diet, digests easily and produces less flatulence. It is also a good source of protein, phosphoric acid and lysine. It can also be used as green manure because its green fodder is very nutritive. It improves soil fertility by fixing atmospheric nitrogen (Duffus & Slaughter, 1980). It is attacked by Mungbean Yellow Mosaic Virus (MYMV) and ULCV which induce considerable losses. Among these Urdbean Leaf Crinkle Virus Disease (ULCVD) is an important viral disease which is most serious in case of susceptible germplasm and favourable environmental conditions (Binyamin et al., 2011). In Pakistan, ULCVD has been a devastating disease because of its high incidences from 40 to 100% recorded in the field and yield losses have been recorded up to 70% (Anonymous, 2013). The diseased plants show extreme crinkling, curling, crumpling, rigidity of leaves, stunting and malformation. ULCV is an unclassified virus with narrow host range (Ashfaq et al., 2007). ULCV is transmitted through seeds (Ahmad et al., 1997). Whitefly (B. tabaci) and two aphid species can also transmit ULCV (Beniwal & Bharathan, 1980). In order to manage ULCVD, breeders and plant pathologists use different methods to ensure the production of virus free mungbean germplasm. It is not an eco-friendly approach to use chemicals against insect vectors (Siebert et al., 2012). This study was conducted to screen mungbean germplasm for the source of resistance against ULCVD. Plant Material MATERIALS AND METHODS In order to evaluate mungbean germplasm against ULCVD, eleven cultivars (varieties and lines) NM-2006, AZRI-2006, M-6, M-97001, M- 98004, M-07007, M-07002, LM-4, JM-3, GM-2 and FM-1 were obtained from Ayub Agricultural Research Institute, (AARI) Faisalabad. Mungbean Disease Screening Nursery Under Field Conditions To identify resistant source in mungbean varieties and lines for resistance against ULCVD, mungbean germplasm was grown under field conditions. For the assurance of virus source in the field, the highly susceptible line KM-5 was used as spreader. The spreader was sown in a row after every three rows of varieties and lines to be evaluated for resistance. The experiment was conducted in augmented design. Data Recording The disease severity of ULCV infected plants showing disease symptoms were determined by inspecting each row of the plants phenotypically. The data of infected plants was recorded weekly starting from the appearance of first disease symptom till the end of the season. All the varieties *Corresponding author: ahmd_1566@yahoo.com
310 M. A. ZESHAN ET AL BIOLOGIA (PAKISTAN) and lines were classified into different levels of resistance and susceptibility by recording disease severity on the basis of the following rating scale by (Bashir et al., 2004). Points Reaction Group Reaction Grade 0 Highly Resistant (HR) (0% infection, all Plants free of symptoms) 1 Resistant (R) (1-10% Plants infected with ULCV) 2 Moderately Resistant (MR) (11-20% Plants infected with ULCV) 3 Moderately Susceptible (MS) (21-30% Plants infected with ULCV) 4 Susceptible (S) (31-40% Plants infected with ULCV) 5 Highly Susceptible (HS) (More than 40% Plants infected with ULCV) I II III IV V VI Three plants were selected from each row at random and data of disease severity were recorded which was calculated as follows: Disease Severity = Infectivity Assay No. of infected leaves Total leaves 100 For confirmation of the virus an infectivity assay was performed as described by (Pullaiah et al., 1998). In this experiment, different varieties were sown in ten pots in greenhouse. Five pots were inoculated mechanically with virus sap while remaining five were kept as control. In control plants only distilled water was sprayed. For mechanical transmission of the virus, young leaves from virus infected plants were ground in pestle and mortar to crush the cells and release the virus in the sap in distilled water. The sap was applied to the leaves of young plants dusted previously with an abrasive such as Carborundum to aid in wounding of the cells. The sap was applied by rubbing the leaves gently with cheese cloth. In order to achieve the successful inoculation, all the pots were covered to protect them from insect vectors. The symptoms were observed after 3 to 7 days for the confirmation of the virus and compared to untreated controls. RESULTS AND DISCUSSION Screening of Mungbean Varieties/Lines Against Urdbean Leaf Crinkle Virus Under Field Conditions The disease severity was observed based on symptoms which were firstly observed on spreader KM-5. The plants grown in pots for infectivity assay produced similar symptoms after mechanical inoculation. The symptoms started by crinkling, twisting, crumpling of leaves. The disease severity data on mungbean cultivars against ULCVD was recorded at 7 days intervals (Table I). No variety or line was highly resistant against ULCVD. All the varieties and lines exhibited varying level of resistance or susceptibility. NM-2006 and M-6 showed 7.54%, 8.07% disease severity, respectively, and were classified as resistant in the reaction group of 1 to 10% infection. Azri-2006 and M-97001 were classified as moderately resistant as these exhibited 16.72% and 15.09% disease severity, respectively. M-98004, M-07007 and M- 07002 showed 26.44%, 25.18% and 28.18% disease severity, respectively, and were ranked as moderately susceptible in the category of 21 to 30% infection. LM-4, JM-3, GM-2 and FM-1 gave 33.75%, 33.66%, 32.10% and 38.76% plant infection, respectively, and were classed as
VOL 60(2) RESPONSE OF MUNGBEAN GERMPLASM AGAINST ULCVD 311 susceptible in the category of 31 to 40% infection. No variety exhibited more than 38.76% disease severity. Viral diseases pose a great threat to legume production in Pakistan. ULCVD affects vegetative parts of the plant and thus contributes to low yield. The susceptible germplasm and favourable environmental conditions are important components of disease development. For the long term management of viral diseases, use of resistant varieties is an efficient method (Tomas et al., 2011). Under field conditions ULCV is the most devastating disease, therefore different varieties/lines were evaluated to identify resistant source for future utilization in breeding programs. Out of eleven varieties/lines of mungbean only two were found as Table I: Response of mungbean varieties/lines to urdbean leaf crinkle virus (ULCV) under natural conditions Sr. No. Variety/Line Disease severity Severity rating index Host Reaction 1 NM-2006 7.54 II Resistant 2 Azri-2006 16.72 III Moderately Resistant 3 M-6 8.07 II Resistant 4 M-97001 15.09 IV Moderately Resistant 5 M-98004 26.44 IV Moderately Susceptible 6 M-07007 25.18 IV Moderately Susceptible 7 M-07002 28.18 IV Moderately Susceptible 8 LM-4 33.75 V Susceptible 9 JM-3 33.66 V Susceptible 10 GM-2 32.10 V Susceptible 11 FM-1 38.76 V Susceptible resistant remaining varieties/lines showed different response of resistance and susceptibility. These findings can be strengthened as (Gafoor et al., 1992) after screening of forty nine test lines against ULCVD found that lines AARI M-1 and AARI M-35 were immune and highly resistant, respectively. Under natural conditions 112 mungbean genotypes were evaluated for resistance against (MYMV) and (ULCV). Twenty eight entries were resistant against MYMV and ULCV and their yield was higher as compared to susceptible varieties. A high yielding line (NCM-201) was resistant to both viruses (Gafoor et al., 1992). In order to find the resistant source 132 breeding lines/cultivars were checked against MYMV and ULCV under field conditions, 53 urdbean varieties/lines showed resistance to MYMV and 26 varieties/lines were resistant against ULCV (Bashir & Zubair, 2002). It is evident from the results that none of the varieties and lines were immune or highly resistant against this devastating viral disease. Two varieties were resistant and remaining two were moderately resistant against ULCVD which can be used in the breeding programme. Breeding of resistant varieties is an easy, cheaper and eco-friendly approach for the management of ULCVD instead of pesticide usage against the vectors of the virus. Use of resistant varieties may result in a safer environment. Moderately resistant varieties or lines can be recommended to the farmers for cultivation with the use of treatments. Susceptible and highly susceptible varieties and lines can be used for the development of model which can predict the disease.
312 M. A. ZESHAN ET AL BIOLOGIA (PAKISTAN) REFERENCES Ahmad, Z., Bashir, M. & Mtsueda, M., 1997. Evaluation of legume germplasm for seed borne viruses in Harmonizing Agricultural Productivity and Conservation of Biodiversity, Breeding and Ecology Proc. 8 th SABRAO J. Cong. Annu. Meeting Korean. Breeding Soc. Seoul. Korea. pp: 117-120. Anonymous, 2013. Economic survey of Pakistan, finance and economic affairs division. Islamabad. pp: 12-15. Ashfaq, M., Khan, M.A., Mughal, S.M., Javed, N., Mukhtar, T. & Bashir, M., 2007. Evaluation of urdbean germplasm for resistance against urdbean leaf crinkle virus. Pak. J. Bot., 39(6): 2103-2111. Bashir, M. & Zubair, M., 2002. Identification of resistance in urdbean (Vigna mungo) against two different viral diseases. Pak. J. Bot., 34(1): 49-51. Bashir, M., Ahmad, Z. & Ghafoor, A., 2004. Sources of genetic resistance in mungbean and black gram against urdbean leaf crinkle virus (ULCV). Pak. J. Bot., 37(1): 47-51. Beniwal, S.P.S. & Bharathan, N., 1980. Beetle transmission of urdbean leaf crinkle virus. Indian Phytopathol., 33: 600-601. Binyamin, R., Khan, M.A., Ahmad, N. & Ali, S., 2011. Relationship of epidemiological factors with urdbean leaf crinkle virus disease and its management using plant extracts. Int. J. Agric. Biol., 13: 411-414. Duffus, C.M. & Slaughter, J.C., 1980. Seeds and their Use. Wiley and Sons, Chichester, New York. pp: 60-64. Gafoor, A., Zubair, M., Malik, B.A. & Iqbal, S.M., 1992. Evaluation of selected germplasm of mungbean. Pak. J. Bot., 24(10): 112-118. Pullaiah, N., Reddy, T.B., Moses, G.J., Reddy, B. M. & Reddy, D. R., 1988. Inheritance of resistance to yellow mosaic virus. Ind. J. Genet. Plant Breed. 58(3): 349-352. Siebert, M.W., Thomas, J.D., Nolting, S.P., Leonard, B.R., Gore, J., Catchot, A., Lorenz, G.M., Stewart, S.D., Cook, D.R., Walton, L.C., Lassiter, R.B., Haygood, R.A. & Siebert, J.D., 2012. Field Evaluations of Sulfoxaflor, a Novel Insecticide, Against Tarnished Plant Bug (Hemiptera: Miridae) in Cotton. J. Cotton Sci., 16: 129-143. Tomas, D.M., Cañizares, M.C., Abad, J., Muñoz, R.F. & Moriones, E., 2011. Resistance to Tomato yellow leaf curl virus accumulation in the tomato wild relative Solanum habrochaites Associated with the C4 Viral Protein. MPMI., 24(7): 849-861.