MICROARRAY. Measures Gene Expression. Global - Genome wide scale entire genome -30,000 genes. Relative expression levels between two groups
|
|
- Rodney Stafford
- 7 years ago
- Views:
Transcription
1 MICROARRAY Measures Gene Expression Global - Genome wide scale entire genome -30,000 genes Relative expression levels between two groups Treatment Control
2 Key components Array Immobilised target Labeled probes (extracted mrna > cdna-*) Detection system scanner Normalisation Data-analysis ratio generation fold change
3 Two distinct platforms Single Channel test either treatment or control eg: Affymetrix Two Channel contains both treatment and control Fundamentally operate by the same principle
4 Overview Extracted mrna 2 channel Labeled probes Target array Detection system
5 Immobilised sequences Complementary to specific probe / gene ARRAY binding site / target chip Millions binding sites for each gene
6 Hybridisation Array target Labelled probe (mrna, labelled cdna) Add labelled probe and cover Hybridise overnight in humid environment Scan Wash - remove unbound probe so only specifically bound labelled probe remains
7 Hybridisation The labelled cdna will bind specifically to complementary target sequences (nucleotides) Increased transcript = more binding = increased signal
8 Critical steps in the generation & analysis of data Array Cy3: nm Cy3: 532nm Excitation Emission Cy5: 635nm Gene Pix Cy5: nm Overlay Images Single channel > only one signal / slide
9 Automatic spot-finding Automatic spot finding algorithms are common Grids must be aligned with spots so that the software knows exactly what area of the slide to read the signal for any specific sequence
10 Results Once spots are aligned, software generates quantitative numerical results For each spot - represents a specific gene generate signal intensity (pixel count) cdna/mrna binding > signal RAW DATA OUTPUT FILES.CEL files Affymetrix Must be processed
11 Normalisation First step in analysis Standardise data from a number of microarrays into common scale Allows meaningful comparisons between slides Correct for technical variability
12 NO NORMALISATION NORMALISED GENE T1 C1 ra*o log2 RATIO N C1 (x1.34) T1 N C1 ra*o log2 RATIO A B C D E F AV SIG Average signal intensity/ratio should be same across arrays
13 Ratio generation log2 transformation gene treatment control RATIO RATIO (log base 2) A no change 0 B UP 2x 1 C DOWN 2x -1 D E UP 4x DOWN 4x 2-2 RATIO RATIO LOG Symmetrical representation of up / down regulated genes
14 Fold change calculation Colomns of normalised microarray Probe ID link to gene ID Signal value (natural or log2 scale) natural pixel intensity (divide: treatment / control) log2 pixel intensity (subtract: treatment control) Present/ Absent call is gene expressed? P-value (spot signal signif diff to background or non-specific sequence)
15 Microarray public repositories storage site hundreds microarray experiments free public access publication > requirement to allow public access Computational Tools mass analysis information beyond fold change
16 CO-EXPRESSION ANALYSIS WHY? cellular response, not mediated by the action of one gene/protein rather requires coordinated action of many 100s -1000s proteins cell coordinates expression of functionally related genes expression of genes involved in specific development stage specific stress responses coordinated expressed at same time
17 co-expression analysis - identify genes/proteins that function in a common cellular response Use unknown gene as driver gene If co-expressed with genes known to function in well defined process (eg pathogen defence), unknown genes may also Well known gene as driver gene (eg drought response) Identify other co-expressed genes that function in pathway
18 Arabidopsis co-expression tool Expression correlation analysis identify co-expressed genes Read : Frequently asked questions Pearson correlation coefficient Measures the strength and direction of a linear relationship between the X and Y variables
19 Uses microarray hybridization signal intensities to calculate a Pearson correlation coefficient (r value) Range +1.0 perfect positive to -1.0 perfect negative Gene A Gene B Gene C
20 scale-invariant measure of expression similarity that determines the strength and direction of the linear relationship between the reference gene (GOI) and all other Arabidopsis on the selected array Intensity independent Based on trend
21 Correlation analysis performed using over 100 microarray experiments Identify truly co-expressed genes under common transcription regulatory control Single experiment activate multiple regulatory networks Over 100 experiments co-expression likely indicates co-regulation
22 Gene of Interest = PR-2 ID = AT3G57260 Need Probe ID ID exchanger AtGenome1(8k) ATH (22k) Input = _at
23 Genevestigator Use to identify experiments where gene/s are differentially expressed
24 ARABIDOPSIS Nottingham Arabidopsis Stock Centre's microarray database (NASCArrays) MULTIPLE ORGANISMS Array Express Gene Expression Omnibus (GEO)
25 Some experiments on multiple sites Some only on one site OPTION download raw and normailised / processed data Procedure different for each site Important information experiment ID matching slides (essential) platform probe IDs (essential) experimental details associated publications
26 NASCARRAYS Cyclohexamide- NASCARRAYS-189 Search by ID or term Slides in this Experiment * Download available.cel and.chp files * Add all of these slides to the Slide Selection * Download all of the ATH1 chip data for this experiment
27 Array Express Processed data = normalised
28 GEO Series Matrix File(s)
29 Presentation of results Present as Figures Excel graphs individual genes or few genes
30 HEAT MAPS Illustrate results for Many genes over multiple experiments
31 HEAT MAPS DOWNLOAD TIGR MultiExperiment Viewer (TMEV)
Analysis of gene expression data. Ulf Leser and Philippe Thomas
Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:
More informationMicroarray Technology
Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except
More informationREAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
More informationMeasuring gene expression (Microarrays) Ulf Leser
Measuring gene expression (Microarrays) Ulf Leser This Lecture Gene expression Microarrays Idea Technologies Problems Quality control Normalization Analysis next week! 2 http://learn.genetics.utah.edu/content/molecules/transcribe/
More informationMolecular Genetics: Challenges for Statistical Practice. J.K. Lindsey
Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray
More informationLecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
More informationExiqon Array Software Manual. Quick guide to data extraction from mircury LNA microrna Arrays
Exiqon Array Software Manual Quick guide to data extraction from mircury LNA microrna Arrays March 2010 Table of contents Introduction Overview...................................................... 3 ImaGene
More information1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM)
1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites, microrna target prediction
More informationIntroduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
More informationFrequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
More informationMeDIP-chip service report
MeDIP-chip service report Wednesday, 20 August, 2008 Sample source: Cells from University of *** Customer: ****** Organization: University of *** Contents of this service report General information and
More informationAn Introduction to Microarray Data Analysis
Chapter An Introduction to Microarray Data Analysis M. Madan Babu Abstract This chapter aims to provide an introduction to the analysis of gene expression data obtained using microarray experiments. It
More informationPREDA S4-classes. Francesco Ferrari October 13, 2015
PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.
More informationCluster software and Java TreeView
Cluster software and Java TreeView To download the software: http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm http://bonsai.hgc.jp/~mdehoon/software/cluster/manual/treeview.html Cluster 3.0
More informationREAL TIME PCR SYBR GREEN
REAL TIME PCR SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM QUANTITATION
More informationMultiExperiment Viewer Quickstart Guide
MultiExperiment Viewer Quickstart Guide Table of Contents: I. Preface - 2 II. Installing MeV - 2 III. Opening a Data Set - 2 IV. Filtering - 6 V. Clustering a. HCL - 8 b. K-means - 11 VI. Modules a. T-test
More informationAnalysis of Illumina Gene Expression Microarray Data
Analysis of Illumina Gene Expression Microarray Data Asta Laiho, Msc. Tech. Bioinformatics research engineer The Finnish DNA Microarray Centre Turku Centre for Biotechnology, Finland The Finnish DNA Microarray
More informationQuantitative proteomics background
Proteomics data analysis seminar Quantitative proteomics and transcriptomics of anaerobic and aerobic yeast cultures reveals post transcriptional regulation of key cellular processes de Groot, M., Daran
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationCorrelation of microarray and quantitative real-time PCR results. Elisa Wurmbach Mount Sinai School of Medicine New York
Correlation of microarray and quantitative real-time PCR results Elisa Wurmbach Mount Sinai School of Medicine New York Microarray techniques Oligo-array: Affymetrix, Codelink, spotted oligo-arrays (60-70mers)
More informationData Acquisition. DNA microarrays. The functional genomics pipeline. Experimental design affects outcome data analysis
Data Acquisition DNA microarrays The functional genomics pipeline Experimental design affects outcome data analysis Data acquisition microarray processing Data preprocessing scaling/normalization/filtering
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationMiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
More informationReal-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
More informationBasic Analysis of Microarray Data
Basic Analysis of Microarray Data A User Guide and Tutorial Scott A. Ness, Ph.D. Co-Director, Keck-UNM Genomics Resource and Dept. of Molecular Genetics and Microbiology University of New Mexico HSC Tel.
More informationRT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist Samuel.Rulli@QIAGEN.com Pathway Focused Research from Sample Prep to Data Analysis! -2-
More informationStep-by-Step Guide to Basic Expression Analysis and Normalization
Step-by-Step Guide to Basic Expression Analysis and Normalization Page 1 Introduction This document shows you how to perform a basic analysis and normalization of your data. A full review of this document
More informationTutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationModule 3: Correlation and Covariance
Using Statistical Data to Make Decisions Module 3: Correlation and Covariance Tom Ilvento Dr. Mugdim Pašiƒ University of Delaware Sarajevo Graduate School of Business O ften our interest in data analysis
More informationRow Quantile Normalisation of Microarrays
Row Quantile Normalisation of Microarrays W. B. Langdon Departments of Mathematical Sciences and Biological Sciences University of Essex, CO4 3SQ Technical Report CES-484 ISSN: 1744-8050 23 June 2008 Abstract
More information2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number
application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000
More informationQPCR Applications using Stratagene s Mx Real-Time PCR Platform
QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist Dan.Schoeffner@Stratagene.com Tech. Services 800-894-1304 Polymerase Chain Reaction Melt
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More informationEssentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
More informationTechnical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR
Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of
More informationEECS 556 Image Processing W 09. Interpolation. Interpolation techniques B splines
EECS 556 Image Processing W 09 Interpolation Interpolation techniques B splines What is image processing? Image processing is the application of 2D signal processing methods to images Image representation
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationBBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
More informationMaterials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling
Application Note Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profi ling Yasmin Beazer-Barclay, Doug Sinon, Christopher Morehouse, Mark Porter, and Mike Kuziora
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationUsing Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More information1-7 2-8 3-9 4-10 5-11 6-12 7-13 8-14 9-15. Corresponding position of sirna GS
A C GS Target transcript 5ʼ- - 3ʼ 3ʼ- 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1-5ʼ 10-16 11-17 12-18 13-19 14-20 15-21 sivim-270 3ʼUTR 1-7 2-8 3-9 4-10 5-11 6-12 7-13 8-14 9-15 Corresponding
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationIntroduction to Proteomics
Introduction to Proteomics Åsa Wheelock, Ph.D. Division of Respiratory Medicine & Karolinska Biomics Center asa.wheelock@ki.se In: Systems Biology and the Omics Cascade, Karolinska Institutet, June 9-13,
More informationReal-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
More informationOriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationmicrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
More informationMicroarray Data Analysis. A step by step analysis using BRB-Array Tools
Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.
More informationOverview. Essential Questions. Grade 4 Mathematics, Quarter 4, Unit 4.1 Dividing Whole Numbers With Remainders
Dividing Whole Numbers With Remainders Overview Number of instruction days: 7 9 (1 day = 90 minutes) Content to Be Learned Solve for whole-number quotients with remainders of up to four-digit dividends
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationA role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan
More informationGene expression analysis. Ulf Leser and Karin Zimmermann
Gene expression analysis Ulf Leser and Karin Zimmermann Ulf Leser: Bioinformatics, Wintersemester 2010/2011 1 Last lecture What are microarrays? - Biomolecular devices measuring the transcriptome of a
More informationALLEN Mouse Brain Atlas
TECHNICAL WHITE PAPER: QUALITY CONTROL STANDARDS FOR HIGH-THROUGHPUT RNA IN SITU HYBRIDIZATION DATA GENERATION Consistent data quality and internal reproducibility are critical concerns for high-throughput
More informationT cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationData, Measurements, Features
Data, Measurements, Features Middle East Technical University Dep. of Computer Engineering 2009 compiled by V. Atalay What do you think of when someone says Data? We might abstract the idea that data are
More informationSingle Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
More informationMultiQuant Software 2.0 for Targeted Protein / Peptide Quantification
MultiQuant Software 2.0 for Targeted Protein / Peptide Quantification Gold Standard for Quantitative Data Processing Because of the sensitivity, selectivity, speed and throughput at which MRM assays can
More informationWeb-based Tools for the Analysis of DNA Microarrays. End of Project Report. Authors: P. Geeleher 1,2, A. Golden 3, J. Hinde 2 and D. G.
Web-based Tools for the Analysis of DNA Microarrays End of Project Report Project 5236 Authors: P. Geeleher 1,2, A. Golden 3, J. Hinde 2 and D. G. Morris 1 1 Teagasc, Animal Reproduction Department, Mellows
More informationMolecule Shapes. support@ingenuity.com www.ingenuity.com 1
IPA 8 Legend This legend provides a key of the main features of Network Explorer and Canonical Pathways, including molecule shapes and colors as well as relationship labels and types. For a high-resolution
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationDiscovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent
More informationHidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
More informationSpectrophotometry and the Beer-Lambert Law: An Important Analytical Technique in Chemistry
Spectrophotometry and the Beer-Lambert Law: An Important Analytical Technique in Chemistry Jon H. Hardesty, PhD and Bassam Attili, PhD Collin College Department of Chemistry Introduction: In the last lab
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationGene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationEXPERIMENT 11 UV/VIS Spectroscopy and Spectrophotometry: Spectrophotometric Analysis of Potassium Permanganate Solutions.
EXPERIMENT 11 UV/VIS Spectroscopy and Spectrophotometry: Spectrophotometric Analysis of Potassium Permanganate Solutions. Outcomes After completing this experiment, the student should be able to: 1. Prepare
More informationIntegrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
More informationDeveloping an interactive webbased learning. environment for bioinformatics. Master thesis. Daniel Løkken Rustad UNIVERSITY OF OSLO
UNIVERSITY OF OSLO Department of Informatics Developing an interactive webbased learning environment for bioinformatics Master thesis Daniel Løkken Rustad 27th July 2005 Preface Preface This thesis is
More informationusing ms based proteomics
quantification using ms based proteomics lennart martens Computational Omics and Systems Biology Group Department of Medical Protein Research, VIB Department of Biochemistry, Ghent University Ghent, Belgium
More informationAnalytical Test Method Validation Report Template
Analytical Test Method Validation Report Template 1. Purpose The purpose of this Validation Summary Report is to summarize the finding of the validation of test method Determination of, following Validation
More informationIntroduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
More informationUNIVERSITY OF BOLTON SCHOOL OF ENGINEERING MS SYSTEMS ENGINEERING AND ENGINEERING MANAGEMENT SEMESTER 1 EXAMINATION 2015/2016 INTELLIGENT SYSTEMS
TW72 UNIVERSITY OF BOLTON SCHOOL OF ENGINEERING MS SYSTEMS ENGINEERING AND ENGINEERING MANAGEMENT SEMESTER 1 EXAMINATION 2015/2016 INTELLIGENT SYSTEMS MODULE NO: EEM7010 Date: Monday 11 th January 2016
More informationScanning and Measuring Autoradiograms with a Document Scanner
Scanning and Measuring Autoradiograms with a Document Scanner By Bruce Venning (Phoretix International Ltd / England) Many scientists are now using standard commercial document scanners to capture images
More informationComparative genomic hybridization Because arrays are more than just a tool for expression analysis
Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationAGILENT S BIOINFORMATICS ANALYSIS SOFTWARE
ACCELERATING PROGRESS IS IN OUR GENES AGILENT S BIOINFORMATICS ANALYSIS SOFTWARE GENESPRING GENE EXPRESSION (GX) MASS PROFILER PROFESSIONAL (MPP) PATHWAY ARCHITECT (PA) See Deeper. Reach Further. BIOINFORMATICS
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationSmartFlare RNA Detection Probes: Principles, protocols and troubleshooting
Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,
More informationReal-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
More informationSoftware and Methods for the Analysis of Affymetrix GeneChip Data. Rafael A Irizarry Department of Biostatistics Johns Hopkins University
Software and Methods for the Analysis of Affymetrix GeneChip Data Rafael A Irizarry Department of Biostatistics Johns Hopkins University Outline Overview Bioconductor Project Examples 1: Gene Annotation
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationSupplemental Material. Methods
Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.
More informationObjectives. Materials
Activity 4 Objectives Understand what a slope field represents in terms of Create a slope field for a given differential equation Materials TI-84 Plus / TI-83 Plus Graph paper Introduction One of the ways
More informationProtease Peptide Microarrays Ready-to-use microarrays for protease profiling
Protocol Protease Peptide Microarrays Ready-to-use microarrays for protease profiling Contact us: InfoLine: +49-30-97893-117 Order per fax: +49-30-97893-299 Or e-mail: peptide@jpt.com www: www.jpt.com
More informationHow To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
More informationBIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, bjgrant@med.umich.edu) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
More informationComparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
More informationTranslation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
More informationGSR Microarrays Project Management System
GSR Microarrays Project Management System A User s Guide GSR Microarrays Vanderbilt University MRBIII, Room 9274 465 21 st Avenue South Nashville, TN 37232 microarray@vanderbilt.edu (615) 936-3003 www.gsr.vanderbilt.edu
More informationSupplementary Information
Supplementary Information S1: Degree Distribution of TFs in the E.coli TRN and CRN based on Operons 1000 TRN Number of TFs 100 10 y = 619.55x -1.4163 R 2 = 0.8346 1 1 10 100 1000 Degree of TFs CRN 100
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More informationBiotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
More informationStep by Step Guide to Importing Genetic Data into JMP Genomics
Step by Step Guide to Importing Genetic Data into JMP Genomics Page 1 Introduction Data for genetic analyses can exist in a variety of formats. Before this data can be analyzed it must imported into one
More information