A Patient Counseling Guide for Reproductive Genetics. Educational content provided by

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "A Patient Counseling Guide for Reproductive Genetics. Educational content provided by"

Transcription

1 A Patient Counseling Guide for Reproductive Educational content provided by

2 Table of contents This Counseling Guide is intended to offer health care providers basic information on genetic counseling and is for general educational purposes only. The guide is not intended to be used to substitute for the exercise of the health care provider s professional judgment in providing professional services. 2

3 3

4 Cells, chromosomes, and DNA Human Nucleus DNA Base pairs A T G C Cell US National Library of Medicine. Help Me Understand : Cells and DNA. Published May 30, Accessed June 6,

5 Cells, chromosomes, and DNA The human body is made up of trillions of cells. Inside the nucleus of cells, are structures called chromosomes. s are made up of genes. Genes are individual instructions that tell the body how to develop and function. The four bases of DNA (A,T,G,C) are the building blocks of genes. The order of these bases determines how genes instruct our bodies. Human Nucleus DNA Base pairs A T G C US National Library of Medicine. Help Me Understand : Cells and DNA. Published May 30, Accessed June 6, Cell 5 5

6 Human chromosomes From Mother From Father or Autosomes 22 X X X Y Female Male 23 Sex s Image adapted from Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press;

7 Human chromosomes Humans typically have 23 pairs of chromosomes (for a total of 46 chromosomes). Half of the chromosomes come from the mother and the other half from the father. The first 22 pairs are the same whether you are male or female. These are called autosomes. The last pair of chromosomes are called sex chromosomes. Females typically have two copies of the X chromosome and males typically have one X and one Y chromosome. From Mother From Father or Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Autosomes X X X Y Female Male 23 Sex s 7 7

8 Cell division in primary germ cells (meiosis) Primary germ cell s copied 1st Meiosis 2nd Meiosis Gametes (sperm/egg) 8

9 Cell division in primary germ cells (meiosis) The human gametes are sperm and eggs. Each gamete typically has only one set of chromosomes (23 total). At fertilization/conception, the father s sperm joins with the mother s egg to form a zygote, which becomes an embryo (with 46 chromosomes). Primary germ cell s copied 1st Meiosis 2nd Meiosis Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Gametes (sperm/egg) 9 9

10 Nondisjunction an error in cell division Typical meiosis Nondisjunction Sperm Eggs Fertilization Trisomy Monosomy 10

11 Nondisjunction an error in cell division Aneuploidy: an incorrect number of chromosomes Trisomy: three copies of a specific chromosome Monosomy: one copy of a specific chromosome Aneuploidy can lead to: Failure of an embryo to implant in the uterus Pregnancy loss/miscarriage Birth of a baby with a chromosome condition (eg., trisomy 21, which is also known as Down syndrome) Typical meiosis Nondisjunction Sperm Eggs Fertilization Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Trisomy Monosomy 11 11

12 12

13 Trisomy 21 (Down syndrome) X X 13

14 Trisomy 21 (Down syndrome) Trisomy 21 is the most common chromosome condition in live births. Trisomy 21 occurs in approximately 1 in every 660 live births. Common characteristics of trisomy 21: Intellectual disability Heart problems Low or poor muscle tone Characteristic facial features Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X 14 14

15 Trisomy 18 (Edwards syndrome) X Y 15

16 Trisomy 18 (Edwards syndrome) Trisomy 18 occurs in approximately 1 in every 3,333 live births. Severe chromosome condition; life expectancy usually less than 1 year. Common characteristics of trisomy 18: Intrauterine growth retardation Unusual positioning of the hands and/or feet Severe al and intellectual disabilities Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X Y 16 16

17 Trisomy 13 (Patau syndrome) X X 17

18 Trisomy 13 (Patau syndrome) Trisomy 13 occurs in approximately 1 in every 5,000 live births. Severe chromosome condition; life expectancy usually less than 1 year. Common characteristics of trisomy 13: Heart, brain, kidney abnormalities Incomplete fusion of the lip and/or palate (clefting) Severe al and intellectual disabilities Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X 18 18

19 Monosomy X (Turner syndrome) X 19

20 Monosomy X (Turner syndrome) Monosomy X occurs in 1-1.5% of pregnancies. However, most (~99%) of these pregnancies do not survive to term. Monosomy X occurs in approximately 1 in every 2,000 female live births Common characteristics of monosomy X: Heart defects Shorter than average height Delayed puberty Infertility Hook EB, Warburton D. Hum Genet. 2014;133(4): Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X 20 20

21 47,XXX (Triple X syndrome) X X X 21

22 47,XXX (Triple X syndrome) 47,XXX occurs in approximately 1 in every 1,000 female live births. Many females with 47,XXX do not have any visible characteristics. Variable characteristics of 47,XXX: Taller than average height Learning difficulties, speech, and language delays Delayed of motor skills Behavioral and emotional difficulties Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X X 22 22

23 47,XXY (Klinefelter syndrome) X X Y 23

24 47,XXY (Klinefelter syndrome) Klinefelter syndrome occurs in approximately 1 in every 500 male live births. Many males with 47,XXY do not have any visible characteristics. Variable characteristics of Klinefelter syndrome: Speech and/or learning difficulties Tall stature Small testes Infertility Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X X Y 24 24

25 47,XYY (Jacobs syndrome) X Y Y 25

26 47,XYY (Jacobs syndrome) 47,XYY occurs in approximately 1 in every 840 male live births. Many males with 47,XYY do not have any visible characteristics. Variable characteristics of 47,XYY: Delayed of speech and language skills Learning disabilities Autism spectrum disorder Jones KL, Jones MC, del Campo M. Smith s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; X Y Y 26 26

27 deletions and microdeletions Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Normal Deletion Normal Microdeletion 27 27

28 deletions and microdeletions Deletions and mircodeletions are caused by missing pieces of chromosome material. Microdeletions are smaller than deletions and cannot be seen under a microscope. deletions and microdeletions may result in intellectual disability, al disabilities, and/or birth defects. Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Normal Deletion Normal Microdeletion 28 28

29 duplications and microduplications Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Normal Duplication Normal Microduplication 29 29

30 duplications and microduplications Duplications and mircoduplications are caused by extra pieces of chromosome material. Microduplications are smaller than duplications and cannot be seen under a microscope. duplications and microduplications may result in intellectual disability, al disabilities, and/or birth defects. Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Telomere Telomere Telomere Normal Duplication Normal Microduplication Telomere 30 30

31 translocation: Reciprocal Balanced translocation carrier parent Non-carrier parent Possible gametes from carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Non-carrier Balanced translocation carrier Partial trisomy + partial monosomy Partial trisomy + partial monosomy 31

32 translocation: Reciprocal A reciprocal translocation is the result of two chromosomes exchanging segments. Reciprocal translocations are present in approximately 1 in 500 individuals. Most individuals who carry a reciprocal translocation do not have any visible characteristics. Carriers of a reciprocal translocation may be at risk for: Infertility Recurrent pregnancy loss Balanced translocation carrier parent Babies with birth defects and/or intellectual disabilities Possible gametes from carrier parent Non-carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Non-carrier Balanced translocation carrier Partial trisomy + partial monosomy Partial trisomy + partial monosomy 32 32

33 translocation: Robertsonian Balanced translocation carrier parent Non-carrier parent Possible gametes from carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Non-carrier Translocation carrier Trisomy Monosomy Trisomy Monosomy 33

34 translocation: Robertsonian A Robertsonian translocation happens when two certain chromosomes (13, 14, 15, 21, 22) join together. Robertsonian translocations are present in approximately 1 in every 1,000 individuals. Most individuals who carry a Robertsonian translocation do not have any visible characteristics. Carriers of a Robertsonian translocation may be at risk for: Infertility Recurrent pregnancy loss Babies with birth defects and/or intellectual disabilities Possible gametes from carrier parent Balanced translocation carrier parent Non-carrier parent Gamete from non-carrier parent Fertilization Possible zygotes Gardner RJM, Sutherland GR, Schaffer LG. Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; Non-carrier Translocation carrier Trisomy Monosomy Trisomy Monosomy 34 34

35 Mosaicism (an error in cell division causing cells with a genetic change) Fertilization Embryo Somatic cell division (mitosis) Mosaic Normal cells Cells with genetic change Adapted from: Campbell IM, Shaw CA, Stankiewicz P, Lupski JR. Somatic mosaicism: implications for disease and transmission genetics. Trends Genet. 2015;31(7):

36 Mosaicism (an error in cell division causing cells with a genetic change) Mosaicism is the presence of two or more cell lines with different genetic make-ups. It is caused by an error during cell division (mitosis). The proportion of each cell line is variable. The clinical impact of mosaicism on an individual varies depending on the number and type of cells affected. Fertilization Embryo Somatic cell division (mitosis) Mosaic Normal cells Cells with genetic change U.S. National Library of Medicine. Medical Encyclopedia: Mosaicism. Updated May 3, Accessed June 3,

37 37

38 Autosomal dominant Parents mutation normal Affected Unaffected Children Affected (50%) Unaffected (50%) 38

39 Autosomal dominant With autosomal dominant, only one copy of a mutated gene is necessary for the condition to be present. An affected parent has the following reproductive risks per pregnancy: 50% chance to have a fetus affected with the condition 50% chance to have a fetus without the condition (unaffected) Males and females are at equal risk Parents mutation normal Affected Unaffected Children US National Library of Medicine. Help Me Understand : Inheriting Genetic Conditions. Published June 6, Accessed June 7, Affected (50%) Unaffected (50%) 39 39

40 Autosomal recessive Parents mutation mutation normal normal Carrier Carrier Children Affected (25%) Carrier (50%) Unaffected non-carrier (25%) 40

41 Autosomal recessive With autosomal recessive, two copies of a mutated gene are necessary for the condition to be present. Individuals with only one copy of a mutated gene are called carriers and are typically unaffected. If both parents are carriers of the same condition, they have the following reproductive risks per pregnancy: 25% chance to have a fetus affected with the condition 50% chance to have a fetus who is a carrier of the condition 25% chance to have a fetus without the condition and a non-carrier (unaffected noncarrier) Males and females are at equal risk Parents Children mutation normal Carrier mutation normal Carrier US National Library of Medicine. Help Me Understand : Inheriting Genetic Conditions. Published June 6, Accessed June 7, Affected (25%) Carrier (50%) Unaffected non-carrier (25%) 41 41

42 X-linked recessive Parents mutation normal X Y X X Unaffected Carrier Children X Y X X X X X Y Unaffected (25%) Unaffected non-carrier (25%) Carrier (25%) Affected (25%) 42

43 X-linked recessive X-linked involves a mutated gene that occurs on the X chromosome. Males who have a mutated gene on their X chromosome are affected with the condition. Females who have a mutated gene on one of their two X chromosomes are called carriers of the condition. Female carriers are typically unaffected; however, some female carriers may display characteristics of the condition. Females who carry an X-linked recessive condition have the following reproductive risks per pregnancy: 25% chance of having a son who is not affected with the condition 25% chance of having a daughter Parents who is not a carrier of the condition 25% chance of having a daughter who is a carrier of the condition 25% chance of having a son who Unaffected Carrier Children is affected with the condition mutation normal X Y X X US National Library of Medicine. Your guide to understanding genetic : What are the different ways in which a genetic condition can be inherited? Published May 31, Accessed June 3, X Y X X X X X Y Unaffected (25%) Unaffected non-carrier (25%) Carrier (25%) Affected (25%) 43 43

44 44

45 In vitro fertilization (IVF) Uterus Ovary 1 Ovarian stimulation and egg retrieval 3 Embryo transfer 2 Fertilization 45

46 In vitro fertilization (IVF) There are 3 main steps in an IVF cycle: 1. Ovarian stimulation and egg retrieval 2. Fertilization sperm and egg are combined in the laboratory to form an embryo 3. Embryo transfer into the uterus or frozen for future use Uterus Ovary 1 Ovarian stimulation and egg retrieval 3 Embryo transfer 2 Fertilization 46 46

47 Percentage of embryos with a chromosome abnormality (aneuploidy) increases with maternal age 90 % of Embryos With Aneuploidy < >42 Maternal Age Harton GL, et al. Fertil Steril. 2013;100(6):

48 Percentage of embryos with a chromosome abnormality (aneuploidy) increases with maternal age Aneuploid embryos can occur in women of all ages, but the risk increases with maternal age. Risks associated with an aneuploid embryo: Implantation failure Miscarriage Babies born with birth defects/intellectual disabilities 90 % of Embryos With Aneuploidy Harton GL, et al. Fertil Steril. 2013;100(6): Scott RT Jr., et al. Fertil Steril. 2012;97(4): < >42 Maternal Age Harton GL, et al. Fertil Steril. 2013;100(6):

49 Stages of embryo 2-cell stage 8-cell stage (cleavage stage) Blastocyst (100+ cells) Inner cell mass Outer layer (Trophectoderm) Fertilization Day 2 Day 3 Day 5 49

50 Stages of embryo Following egg retrieval, fertilization occurs in the laboratory. Cell division occurs in the days following fertilization. By day 5, a blastocyst has formed with an outer layer and an inner cell mass. 2-cell stage 8-cell stage (cleavage stage) Blastocyst (100+ cells) Inner cell mass Outer layer (Trophectoderm) Fertilization Day 2 Day 3 Day 5 Harton GL, et al. Fertil Steril. 2013;100(6):

51 51

52 Embryo unlikely to have aneuploidy Embryo likely to have aneuploidy Embryo Biopsy Screening Embryo Transfer 52

53 PGS process: 1. Embryo Biopsy: One or more cells from each embryo is removed for screening 2. Screening: Biopsied cells are screened for aneuploidy (too many or too few chromosomes) 3. Embryo Transfer: Embryos that are unlikely to have aneuploidy are available for transfer into the uterus or can be frozen for future use Potential benefits: Increased implantation, pregnancy, and live birth rates Decreased miscarriage rates Selection of most viable embryo for single embryo transfer Limitations: PGS only screens for aneuploidy PGS does not screen for other PGS is not 100% accurate Forman EJ, et al. Fertil Steril. 2013;100(1): Scott RT Jr, et al. Fertil Steril. 2013;100(3): Harton GL, et al. Fertil Steril. 2013;100(6): Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5): Embryo unlikely to have aneuploidy Embryo likely to have aneuploidy Embryo Biopsy Screening Embryo Transfer 53 53

54 54

55 Embryo likely to be unaffected Embryo likely to be affected Embryo Biopsy Genetic Testing Embryo Transfer 55

56 PGD process: 1. Embryo Biopsy: One or more cells from each embryo is removed for testing 2. Genetic Testing: Biopsied cells are tested for the inherited condition of interest 3. Embryo Transfer: Embryos that are likely to be unaffected with the condition are available for transfer to the uterus or can be frozen for future use Benefits: Reduced risk of having a baby with an inherited condition Limitations: PGD does not test for all possible PGD is not 100% accurate Embryo likely to be unaffected Embryo likely to be affected Practice Committee of Society for Assisted Reproductive Technology; Practice Committee of American Society for Reproductive Medicine. Fertil Steril. 2008;90(5 Suppl):S Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5): Embryo Biopsy Genetic Testing Embryo Transfer 56 56

57 and diagnostic 57

58 * Patient counseled and elects prenatal testing NO YES Serum screening cfdna screening Diagnostic 10 0/7 weeks /7 weeks of pregnancy 10 weeks of pregnancy until delivery CVS/Amniocentesis CVS: weeks of pregnancy Amniocentesis: typically weeks of pregnancy YES Is the result positive for a chromosome condition? Is the result positive for a chromosome condition? YES Offer further counseling testing NO NO Patient and provider to discuss next steps Patient and provider to discuss next steps Patient and provider to discuss next steps ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e122. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. *Typical in USA but may differ by country. 58

59 * Prenatal aneuploidy screening assesses a woman s risk of carrying a fetus with certain chromosome. If a screening result is positive, further counseling and diagnostic testing should be offered Diagnostic testing can provide definitive information about: Certain genetic Patient counseled and elects prenatal testing NO YES Serum screening cfdna screening Diagnostic 10 0/7 weeks /7 weeks of pregnancy 10 weeks of pregnancy until delivery CVS/Amniocentesis CVS: weeks of pregnancy Amniocentesis: typically weeks of pregnancy YES Is the result positive for a chromosome condition? Is the result positive for a chromosome condition? YES Offer further counseling testing ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e122. ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. *Typical in USA but may differ by country. NO Patient and provider to discuss next steps NO Patient and provider to discuss next steps Patient and provider to discuss next steps 59 59

60 Cell-free DNA (cfdna) screening Unaffected pregnancy Affected pregnancy CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Maternal cfdna Fetal cfdna Maternal blood draw and isolation of cfdna Sequencing of cfdna Analysis via counting 60

61 Cell-free DNA (cfdna) screening cfdna screening process: 1. Blood is drawn from pregnant woman s arm at 10 weeks of gestation or greater. cfdna is isolated from the maternal blood in the laboratory. 2. cfdna is sequenced to determine chromosome of origin 3. Sequenced cfdna is counted to screen for chromosome Benefits: High detection rates for tested Very low false positive rates Fewer patients will need to have follow-up diagnostic testing compared with serum screening Limitations: Not diagnostic (false positives and false negatives can occur) In some instances, results may represent a maternal, rather than fetal, condition Maternal cfdna Fetal cfdna CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Unaffected pregnancy Affected pregnancy Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3): ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e Maternal blood draw and isolation of cfdna Sequencing of cfdna Analysis via counting 61 61

62 Classification of cfdna screening results Negative cfdna results Positive cfdna results True negatives True positives False positives and false negatives 62

63 Classification of cfdna screening results True positive: a positive result, and the fetus has the condition False positive: a positive result, but the fetus does not have the condition True negative: a negative result, and the fetus does not have the condition False negative: a negative result, but the fetus has the condition Negative cfdna results Positive cfdna results True negatives True positives False positives and false negatives 63 63

64 cfdna: Negative results Negative cfdna results Fetuses who have the condition (false negatives) 64

65 cfdna: Negative results The chance that the fetus does not have the condition is greater than 99%. False negatives do occur rarely The results apply only to the tested. No additional screening tests for aneuploidy should be offered as this will increase the potential for a false positive result. Negative cfdna results ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e137. Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3): Fetuses who have the condition (false negatives) 65 65

66 cfdna: Positive results No additional risk factors present Additional risk factor(s) present All positive cfdna results Fetuses who have the condition 66

67 cfdna: Positive results A positive result means the fetus has an increased chance of having a chromosome condition. The overall chance for the condition depends on a combination of the cfdna result and any additional risk factors, including: Maternal age Ultrasound results Serum screening results Family history of chromosome condition Further counseling and diagnostic testing should be offered. No additional risk factors present All positive cfdna results Additional risk factor(s) present Fetuses who have the condition ACOG Practice Bulletins Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123 e

68 Diagnostic testing: chorionic villus sampling (CVS) Placenta Ultrasound probe Placenta Ultrasound probe Chorionic villi Chorionic villi Transcervical CVS Transabdominal CVS 68

69 Diagnostic testing: chorionic villus sampling (CVS) Can determine, with as much certainty as is possible, whether a chromosome condition is present. Additional genetic testing can be performed if indicated Involves testing of cells collected from the placenta. Typically performed between 10 weeks and 13 weeks of pregnancy Has a risk of miscarriage. Placenta Ultrasound probe Placenta Ultrasound probe Chorionic villi Chorionic villi Transcervical CVS Transabdominal CVS ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e

70 Diagnostic testing: Amniocentesis Ultrasound probe Amniotic fluid Uterine wall 70

71 Diagnostic testing: Amniocentesis Can determine, with as much certainty as is possible, whether a chromosome condition is present. Additional genetic testing can be performed if indicated Involves testing of fetal cells collected from fluid surrounding the fetus (amniotic fluid). Typically performed between 15 weeks and 20 weeks of pregnancy Has a risk of miscarriage. Ultrasound probe Amniotic fluid Uterine wall ACOG Practice Bulletins Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108 e

72 Types of fetal chromosomal mosaicism Normal cells Chromosomally abnormal cells Generalized mosaicism Confined placental mosaicism Fetal mosaicism Kalousek DK. Pediatr Pathol. 1990;10(1-2): Kalousek DK. Pediatr Pathol. 1990;10(1-2):

73 Types of fetal chromosomal mosaicism Generalized mosaicism: presence of two or more chromosomally different cell lines in both the placenta and the fetus. Can lead to a false positive or a false negative cfdna result Confined placental mosaicism: presence of two or more chromosomally different cell lines in the placenta, but not the fetus. Can lead to a false positive cfdna result Fetal mosaicism: presence of two or more chromosomally different cell lines that are present in the fetus, but not the placenta. Can lead to a false negative cfdna result Normal cells Chromosomally abnormal cells Generalized mosaicism Confined placental mosaicism Fetal mosaicism Grati FR. J Clin Med. 2014;3(3): Van Opstal D, et al. PLoS One. 2016;11(1):e Kalousek DK. Pediatr Pathol. 1990;10(1-2):

74 This Counseling Guide is intended to offer health care providers basic information on genetic counseling and is for general educational purposes only. The guide is not intended to be used to substitute for the exercise of the health care provider s professional judgment in providing professional services Illumina, Inc. All rights reserved.

Each person normally has 23 pairs of chromosomes, or 46 in all. We inherit one chromosome per pair from our mother and one from our father.

Each person normally has 23 pairs of chromosomes, or 46 in all. We inherit one chromosome per pair from our mother and one from our father. AP Psychology 2.2 Behavioral Genetics Article Chromosomal Abnormalities About 1 in 150 babies is born with a chromosomal abnormality (1, 2). These are caused by errors in the number or structure of chromosomes.

More information

A test your patients can trust.

A test your patients can trust. A test your patients can trust. A simple, safe, and accurate non-invasive prenatal test for early risk assessment of Down syndrome and other conditions. informaseq Prenatal Test Simple, safe, and accurate

More information

Basic Human Genetics: Reproductive Health and Chromosome Abnormalities

Basic Human Genetics: Reproductive Health and Chromosome Abnormalities Basic Human Genetics: Reproductive Health and Chromosome Abnormalities Professor Hanan Hamamy Department of Genetic Medicine and Development Geneva University Switzerland Training Course in Sexual and

More information

LEUKODYSTROPHY GENETICS AND REPRODUCTIVE OPTIONS FOR AFFECTED FAMILIES. Leila Jamal, ScM Kennedy Krieger Institute, Baltimore MD

LEUKODYSTROPHY GENETICS AND REPRODUCTIVE OPTIONS FOR AFFECTED FAMILIES. Leila Jamal, ScM Kennedy Krieger Institute, Baltimore MD LEUKODYSTROPHY GENETICS AND REPRODUCTIVE OPTIONS FOR AFFECTED FAMILIES Leila Jamal, ScM Kennedy Krieger Institute, Baltimore MD 2 Outline Genetics 101: Basic Concepts and Myth Busting Inheritance Patterns

More information

your questions answered the reassurance of knowing A guide for parents-to-be on noninvasive prenatal testing.

your questions answered the reassurance of knowing A guide for parents-to-be on noninvasive prenatal testing. your questions answered the reassurance of knowing A guide for parents-to-be on noninvasive prenatal testing. Accurate answers about your baby s health simply, safely, sooner. What is the verifi Prenatal

More information

Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome.

Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Define the terms karyotype, autosomal and sex chromosomes. Explain how many of

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

A test your patients can trust. A company you know and trust.

A test your patients can trust. A company you know and trust. A test your patients can trust. A company you know and trust. informaseq Prenatal Test an advanced, non-invasive, prenatal screening for T21, T18, and T13 chromosomal aneuploidies using next generation

More information

Preimplantation Genetic Diagnosis (PGD) in Western Australia

Preimplantation Genetic Diagnosis (PGD) in Western Australia Preimplantation Genetic Diagnosis (PGD) in Western Australia Human somatic cells have 46 chromosomes each, made up of the 23 chromosomes provided by the egg and the sperm cell from each parent. Each chromosome

More information

Preimplantation Genetic Diagnosis (PGD) for Fanconi Anemia and HLA matching

Preimplantation Genetic Diagnosis (PGD) for Fanconi Anemia and HLA matching Preimplantation Genetic Diagnosis (PGD) for Fanconi Anemia and HLA matching Andria G. Besser, BEd, MS, CGC Licensed Genetic Counselor Reproductive Genetics Institute Chicago, IL Outline PGD overview In

More information

Prenatal Testing Special tests for your baby during pregnancy

Prenatal Testing Special tests for your baby during pregnancy English April 2006 [OTH-7750] There are a number of different prenatal (before birth) tests to check the development of your baby. Each test has advantages and disadvantages. This information is for people

More information

Consent to Perform Preimplantation Genetic Screening (PGS) using. Comparative Genomic Hybridization (acgh) or Next Generation Sequencing (NGS)

Consent to Perform Preimplantation Genetic Screening (PGS) using. Comparative Genomic Hybridization (acgh) or Next Generation Sequencing (NGS) Consent to Perform Preimplantation Genetic Screening (PGS) using Array Comparative Genomic Hybridization (acgh ) or Next Generation Sequencing (NGS) Purpose The purpose of Preimplantation Genetic Screening

More information

4.2 Meiosis. Meiosis is a reduction division. Assessment statements. The process of meiosis

4.2 Meiosis. Meiosis is a reduction division. Assessment statements. The process of meiosis 4.2 Meiosis Assessment statements State that meiosis is a reduction division of a diploid nucleus to form haploid nuclei. Define homologous chromosomes. Outline the process of meiosis, including pairing

More information

REI Pearls: Pitfalls of Genetic Testing in Miscarriage

REI Pearls: Pitfalls of Genetic Testing in Miscarriage The Skinny: Genetic testing of miscarriage tissue is controversial and some people question if testing is helpful or not. This summary will: 1) outline the arguments for and against genetic testing; 2)

More information

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Genetic Mutations Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes. Agenda Warm UP: What is a mutation? Body cell? Gamete? Notes on Mutations Karyotype Web Activity

More information

Balanced. translocations. rarechromo.org. Support and Information

Balanced. translocations. rarechromo.org. Support and Information Support and Information Rare Chromosome Disorder Support Group, G1, The Stables, Station Rd West, Oxted, Surrey. RH8 9EE Tel: +44(0)1883 723356 info@rarechromo.org I www.rarechromo.org Balanced Unique

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

Carol Ludowese, MS, CGC Certified Genetic Counselor HDSA Center of Excellence at Hennepin County Medical Center Minneapolis, Minnesota

Carol Ludowese, MS, CGC Certified Genetic Counselor HDSA Center of Excellence at Hennepin County Medical Center Minneapolis, Minnesota Carol Ludowese, MS, CGC Certified Genetic Counselor HDSA Center of Excellence at Hennepin County Medical Center Minneapolis, Minnesota The information provided by speakers in workshops, forums, sharing/networking

More information

In - Vitro Fertilization Handbook

In - Vitro Fertilization Handbook In - Vitro Fertilization Handbook William F. Ziegler, D.O. Medical Director Scott Kratka, ELD, TS Embryology Laboratory Director Lauren F. Lucas, P.A.-C, M.S. Physician Assistant Frances Cerniak, R.N.

More information

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes. 1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome

More information

Genetics and Pregnancy Loss

Genetics and Pregnancy Loss Genetics and Pregnancy Loss Dorothy Warburton Genetics and Development (in Pediatrics) Columbia University, New York Estimates of Pregnancy Loss from Conception 1000 fertilized eggs (27% are lost) 728

More information

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Chromosomes, Mapping, and the Meiosis Inheritance Connection Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory

More information

Non-Invasive Prenatal Testing (NIPT) Factsheet

Non-Invasive Prenatal Testing (NIPT) Factsheet Introduction NIPT, which analyzes cell-free fetal DNA circulating in maternal blood, is a new option in the prenatal screening and testing paradigm for trisomy 21 and a few other fetal chromosomal aneuploidies.

More information

National Down Syndrome Society

National Down Syndrome Society National Down Syndrome Society The national advocate for the value, acceptance and inclusion of people with Down syndrome What is Down Syndrome? Down syndrome is the most commonly occurring chromosomal

More information

Trisomy 13 (also called Patau s syndrome or T13)

Trisomy 13 (also called Patau s syndrome or T13) Screening Programmes Fetal Anomaly Trisomy 13 (also called Patau s syndrome or T13) Information for parents Publication date: April 2012 Review date: April 2013 Version 2 117 Information sheet to help

More information

UNIT 13 (OPTION) Genetic Abnormalities

UNIT 13 (OPTION) Genetic Abnormalities Unit 13 Genetic Abnormailities 1 UNIT 13 (OPTION) Genetic Abnormalities Originally developed by: Hildur Helgedottir RN, MN Revised (2000) by: Marlene Reimer RN, PhD, CCN (C) Associate Professor Faculty

More information

Preimplantation genetic diagnosis new method of screening of 24 chromosomes with the Array CGH method...2

Preimplantation genetic diagnosis new method of screening of 24 chromosomes with the Array CGH method...2 August 2012 content 8 Preimplantation genetic diagnosis new method of screening of 24 chromosomes with the Array CGH method...2 Maintaining fertility new opportunities in GENNET...3 Hysteroscopy without

More information

CHROMOSOMES AND INHERITANCE

CHROMOSOMES AND INHERITANCE SECTION 12-1 REVIEW CHROMOSOMES AND INHERITANCE VOCABULARY REVIEW Distinguish between the terms in each of the following pairs of terms. 1. sex chromosome, autosome 2. germ-cell mutation, somatic-cell

More information

Sex for the purposes of this class refers to 4 components

Sex for the purposes of this class refers to 4 components Sex for the purposes of this class refers to 4 components Gonadal sex Gonads or where gametes are produced by meiosis Somatic sex Somatic cells are cells that undergo mitosis. They can be divided into

More information

What Is Genetic Counseling? Helping individuals and families understand how genetics affects their health and lives

What Is Genetic Counseling? Helping individuals and families understand how genetics affects their health and lives What Is Genetic Counseling? Helping individuals and families understand how genetics affects their health and lives What does the career involve? Explore family histories to identify risks Reducing risks

More information

Assisted Reproductive Technologies at IGO

Assisted Reproductive Technologies at IGO 9339 Genesee Avenue, Suite 220 San Diego, CA 92121 858 455 7520 Assisted Reproductive Technologies at IGO Although IGO no longer operates an IVF laboratory or program as such, we work closely with area

More information

A Guide to Prenatal Genetic Testing

A Guide to Prenatal Genetic Testing Patient Education Page 29 A Guide to Prenatal Genetic Testing This section describes prenatal tests that give information about your baby s health. It is your choice whether or not to have these tests

More information

Medical Policy Preimplantation Genetic Testing

Medical Policy Preimplantation Genetic Testing Medical Policy Preimplantation Genetic Testing Table of Contents Policy: Commercial Coding Information Information Pertaining to All Policies Policy: Medicare Description References Authorization Information

More information

First Trimester Screening for Down Syndrome

First Trimester Screening for Down Syndrome First Trimester Screening for Down Syndrome What is first trimester risk assessment for Down syndrome? First trimester screening for Down syndrome, also known as nuchal translucency screening, is a test

More information

Preimplantation Genetic Diagnosis. Evaluation for single gene disorders

Preimplantation Genetic Diagnosis. Evaluation for single gene disorders Preimplantation Genetic Diagnosis Evaluation for single gene disorders What is Preimplantation Genetic Diagnosis? Preimplantation genetic diagnosis or PGD is a technology that allows genetic testing of

More information

The Developing Person Through the Life Span 8e by Kathleen Stassen Berger

The Developing Person Through the Life Span 8e by Kathleen Stassen Berger The Developing Person Through the Life Span 8e by Kathleen Stassen Berger Chapter 3 Heredity and Environment PowerPoint Slides developed by Martin Wolfger and Michael James Ivy Tech Community College-Bloomington

More information

Genetic methods for assessing embryo viability and improving IVF treatment

Genetic methods for assessing embryo viability and improving IVF treatment Genetic methods for assessing embryo viability and improving IVF treatment Prof. Dagan Wells, PhD, FRCPath Reprogenetics UK Points for discussion Diagnosis of inherited disorders in preimplantation embryos

More information

Fact Sheet 14 EPIGENETICS

Fact Sheet 14 EPIGENETICS This fact sheet describes epigenetics which refers to factors that can influence the way our genes are expressed in the cells of our body. In summary Epigenetics is a phenomenon that affects the way cells

More information

1. PRENATAL DIAGNOSIS OF CHROMOSOMAL DISORDERS - molecular aspects

1. PRENATAL DIAGNOSIS OF CHROMOSOMAL DISORDERS - molecular aspects 1. PRENATAL DIAGNOSIS OF CHROMOSOMAL DISORDERS - molecular aspects Ana Stavljenić-Rukavina Zagreb University School of Medicine, Croatia The standard measures for population health outcomes is based on

More information

*Please consult the online schedule for this course for the definitive date and time for this lecture.

*Please consult the online schedule for this course for the definitive date and time for this lecture. CHROMOSOMES AND DISEASE Date: September 29, 2005 * Time: 8:00 am- 8:50 am * Room: G-202 Biomolecular Building Lecturer: Jim Evans 4200A Biomolecular Building jpevans@med.unc.edu Office Hours: by appointment

More information

Obstetrical Ultrasound and Prenatal Diagnostic Center

Obstetrical Ultrasound and Prenatal Diagnostic Center Obstetrical Ultrasound and Prenatal Diagnostic Center Prenatal Diagnosis: Options and Opportunities Learn about various screening options including Early Risk Assessment (ERA), now available to women of

More information

Prenatal screening and diagnostic tests

Prenatal screening and diagnostic tests Prenatal screening and diagnostic tests Contents Introduction 3 First trimester routine tests in the mother 3 Testing for health conditions in the baby 4 Why would you have a prenatal test? 6 What are

More information

Chapter 8: Variation in Chromosome Structure and Number

Chapter 8: Variation in Chromosome Structure and Number Chapter 8: Variation in Chromosome Structure and Number Student Learning Objectives Upon completion of this chapter you should be able to: 1. Know the principles and terminology associated with variations

More information

Reproductive System & Development: Practice Questions #1

Reproductive System & Development: Practice Questions #1 Reproductive System & Development: Practice Questions #1 1. Which two glands in the diagram produce gametes? A. glands A and B B. glands B and E C. glands C and F D. glands E and F 2. Base your answer

More information

Preimplantation genetic screening (PGS)

Preimplantation genetic screening (PGS) Preimplantation genetic screening (PGS) Dagan Wells Reprogenetics UK In vitro fertilization (IVF) A highly successful medical intervention Infertility treatment revolutionized Estimated that >5 million

More information

FERTILITY AND AGE. Introduction. Fertility in the later 30's and 40's. Am I fertile?

FERTILITY AND AGE. Introduction. Fertility in the later 30's and 40's. Am I fertile? FERTILITY AND AGE Introduction Delaying pregnancy is a common choice for women in today's society. The number of women in their late 30s and 40s attempting pregnancy and having babies has increased in

More information

Heredity - Patterns of Inheritance

Heredity - Patterns of Inheritance Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes

More information

About The Causes of Hearing Loss

About The Causes of Hearing Loss About 1 in 500 infants is born with or develops hearing loss during early childhood. Hearing loss has many causes: some are genetic (that is, caused by a baby s genes) or non-genetic (such as certain infections

More information

Robertsonian Translocations

Robertsonian Translocations Robertsonian Translocations rarechromo.org Robertsonian translocations A Robertsonian translocation is an unusual type of chromosome rearrangement caused by two particular chromosomes joining together.

More information

RECURRENT PREGNANCY LOSS DR.RAJALAKSHMI SRINIVASAN SPECIALIST GYNECOLOGIST ZULEKHA HOSPITAL DUBAI

RECURRENT PREGNANCY LOSS DR.RAJALAKSHMI SRINIVASAN SPECIALIST GYNECOLOGIST ZULEKHA HOSPITAL DUBAI RECURRENT PREGNANCY LOSS DR.RAJALAKSHMI SRINIVASAN SPECIALIST GYNECOLOGIST ZULEKHA HOSPITAL DUBAI RECURRENT PREGNANCY LOSS -RM Clinically recognized consecutive or non consecutive pregnancy losses before

More information

Pre-implantation Genetic Diagnosis (PGD)

Pre-implantation Genetic Diagnosis (PGD) Saint Mary s Hospital Department of Genetic Medicine Saint Mary s Hospital Pre-implantation Genetic Diagnosis (PGD) Information For Patients What is PGD? Pre-implantation genetic diagnosis (PGD) is a specialised

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.

More information

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. 11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for

More information

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:

Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction: Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose

More information

Ehlers-Danlos Syndrome Fertility Issues. Objectives

Ehlers-Danlos Syndrome Fertility Issues. Objectives Ehlers-Danlos Syndrome Fertility Issues Baltimore Inner Harbor Independence Day Brad Hurst, M.D. Professor Reproductive Endocrinology Carolinas Medical Center - Charlotte, North Carolina Objectives Determine

More information

Science 10-Biology Activity 15 The Development of the Human Embryo

Science 10-Biology Activity 15 The Development of the Human Embryo Science 10-Biology Activity 15 The Development of the Human Embryo 10 Name Due Date Show Me Hand In Correct and Hand In Again By NOTE: This worksheet is based on material from pages 379-380 in Science

More information

Genetic Counseling: A Profession in the Making. Jessica Hooks, MS Genetic Counselor University of South Carolina

Genetic Counseling: A Profession in the Making. Jessica Hooks, MS Genetic Counselor University of South Carolina Genetic Counseling: A Profession in the Making Jessica Hooks, MS Genetic Counselor University of South Carolina Definition the process of helping people understand and adapt to the medical, psychological

More information

FREQUENTLY ASKED QUESTIONS ABOUT IVF

FREQUENTLY ASKED QUESTIONS ABOUT IVF FREQUENTLY ASKED QUESTIONS ABOUT IVF Is there something we can do to improve our chances of succes? Even though IVF treatment is a medical process on which you have no influence, there are a number of

More information

X Linked Inheritance

X Linked Inheritance X Linked Inheritance Information for Patients and Families 2 X linked Inheritance The following will give you information about what X linked inheritance means and how X linked conditions are inherited.

More information

Page 1. 1. The production of monoploid cells by spermatogenesis occurs in (1) zygotes (3) ovaries (2) testes (4) meristems

Page 1. 1. The production of monoploid cells by spermatogenesis occurs in (1) zygotes (3) ovaries (2) testes (4) meristems 1. The production of monoploid cells by spermatogenesis occurs in (1) zygotes (3) ovaries (2) testes (4) meristems Base your answers to questions 2 and 3 on the diagram below of the female reproductive

More information

STAGES OF PRENATAL DEVELOPMENT

STAGES OF PRENATAL DEVELOPMENT STAGES OF PRENATAL DEVELOPMENT College of William and Mary Students for Life 2013 Germinal Period From conception to implantation Terms to Know Conception: the first stage in human development in which

More information

Executive summary. Current prenatal screening

Executive summary. Current prenatal screening Executive summary Health Council of the Netherlands. NIPT: dynamics and ethics of prenatal screening. The Hague: Health Council of the Netherlands, 2013; publication no. 2013/34. In recent years, new tests

More information

Stem Cells. Part 1: What is a Stem Cell?

Stem Cells. Part 1: What is a Stem Cell? Stem Cells Part 1: What is a Stem Cell? Stem cells differ from other kinds of cells in the body. When a stem cell divides by mitosis, each new cell has the potential to either remain a stem cell or become

More information

HUMAN FERTILISATION AND EMBRYOLOGY AUTHORITY AND ADVISORY COMMITTEE ON GENETIC TESTING CONSULTATION DOCUMENT ON PREIMPLANTATION GENETIC DIAGNOSIS

HUMAN FERTILISATION AND EMBRYOLOGY AUTHORITY AND ADVISORY COMMITTEE ON GENETIC TESTING CONSULTATION DOCUMENT ON PREIMPLANTATION GENETIC DIAGNOSIS HUMAN FERTILISATION AND EMBRYOLOGY AUTHORITY AND ADVISORY COMMITTEE ON GENETIC TESTING CONSULTATION DOCUMENT ON PREIMPLANTATION GENETIC DIAGNOSIS Introduction 1. This document considers the current and

More information

AGE & FERTILITY: Effective Evaluation & Treatment I. LANE WONG, MD, FACOG. www.hopefertilitycenter.com www.hopeivf.com

AGE & FERTILITY: Effective Evaluation & Treatment I. LANE WONG, MD, FACOG. www.hopefertilitycenter.com www.hopeivf.com Page 1 of 6 AGE & FERTILITY: Effective Evaluation & Treatment I. LANE WONG, MD, FACOG. www.hopefertilitycenter.com www.hopeivf.com Age has a profound effect on female fertility. This is common knowledge,

More information

Fluorescence in situ hybridisation (FISH)

Fluorescence in situ hybridisation (FISH) Fluorescence in situ hybridisation (FISH) rarechromo.org Fluorescence in situ hybridization (FISH) Chromosomes Chromosomes are structures that contain the genetic information (DNA) that tells the body

More information

The genetic screening of preimplantation embryos by comparative genomic hybridisation

The genetic screening of preimplantation embryos by comparative genomic hybridisation Vol. 11, Suppl. 3 51 The genetic screening of preimplantation embryos by comparative genomic hybridisation Maria V Traversa 1, James Marshall, Steven McArthur, Don Leigh Genea, Sydney, Australia Received:

More information

www.njctl.org PSI Biology Mitosis & Meiosis

www.njctl.org PSI Biology Mitosis & Meiosis Mitosis and Meiosis Mitosis Classwork 1. Identify two differences between meiosis and mitosis. 2. Provide an example of a type of cell in the human body that would undergo mitosis. 3. Does cell division

More information

Reproductive Technology. Chapter 21

Reproductive Technology. Chapter 21 Reproductive Technology Chapter 21 Assisted Reproduction When a couple is sub-fertile or infertile they may need Assisted Reproduction to become pregnant: Replace source of gametes Sperm, oocyte or zygote

More information

CELL DIVISION. STAGES OF MITOTIC DIVISION (Diag. C1)

CELL DIVISION. STAGES OF MITOTIC DIVISION (Diag. C1) 1 CELL DIVISION Cell division is the process by which cells replicate in order to replace cell loss, repair tissue damage and reproduce the organism. Two types of cell division are encountered in the Eukaryotic

More information

Age and Fertility. A Guide for Patients PATIENT INFORMATION SERIES

Age and Fertility. A Guide for Patients PATIENT INFORMATION SERIES Age and Fertility A Guide for Patients PATIENT INFORMATION SERIES Published by the American Society for Reproductive Medicine under the direction of the Patient Education Committee and the Publications

More information

Midland Fertility Services Blastocyst Transfer

Midland Fertility Services Blastocyst Transfer Midland Fertility Services Blastocyst Transfer Building futures, transforming lives What is a blastocyst? When a sperm fertilises an egg the resulting embryo develops from the original single cell into

More information

Carrier detection tests and prenatal diagnosis

Carrier detection tests and prenatal diagnosis Carrier detection tests and prenatal diagnosis There are several types of muscular dystrophy and about 50 neuromuscular conditions, all of which fall under the umbrella of the Muscular Dystrophy Campaign.

More information

Preimplantation Genetic Diagnosis (PGD) and Childhood Diagnostic Evaluation

Preimplantation Genetic Diagnosis (PGD) and Childhood Diagnostic Evaluation IG O Preimplantation Genetic Diagnosis (PGD) and Childhood Diagnostic Evaluation KD Carsten Bergmann carsten.bergmann@bioscientia.de carsten.bergmann@uniklinik-freiburg.de Controversies Conference on ADPKD

More information

Noninvasive Prenatal Screening for Fetal Aneuploidies and Microdeletions Using Cell-Free Fetal DNA

Noninvasive Prenatal Screening for Fetal Aneuploidies and Microdeletions Using Cell-Free Fetal DNA MEDICAL POLICY POLICY RELATED POLICIES POLICY GUIDELINES DESCRIPTION SCOPE BENEFIT APPLICATION RATIONALE REFERENCES CODING APPENDIX HISTORY Noninvasive Prenatal Screening for Fetal Aneuploidies and Microdeletions

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female

More information

Preimplantation Genetic Testing in Embryos

Preimplantation Genetic Testing in Embryos MEDICAL POLICY POLICY RELATED POLICIES POLICY GUIDELINES DESCRIPTION SCOPE BENEFIT APPLICATION RATIONALE REFERENCES CODING APPENDIX HISTORY Preimplantation Genetic Testing in Embryos Number 12.04.305 Effective

More information

Assignment Discovery Online Curriculum

Assignment Discovery Online Curriculum Assignment Discovery Online Curriculum Lesson title: In Vitro Fertilization Grade level: 9-12, with adaptation for younger students Subject area: Life Science Duration: Two class periods Objectives: Students

More information

Fertility Research Policy

Fertility Research Policy Fertility Research Policy Rationale and Objective Merck Serono has a strong commitment to deliver innovations in Fertility treatments to help infertile couples achieve their desire to have a baby. Innovations

More information

MCB41: Second Midterm Spring 2009

MCB41: Second Midterm Spring 2009 MCB41: Second Midterm Spring 2009 Before you start, print your name and student identification number (S.I.D) at the top of each page. There are 7 pages including this page. You will have 50 minutes for

More information

Genetics in Family Medicine: The Australian Handbook for General Practitioners Testing and pregnancy

Genetics in Family Medicine: The Australian Handbook for General Practitioners Testing and pregnancy Genetics in Family Medicine: The Australian Handbook for General Practitioners Testing and pregnancy Testing and pregnancy GP s role 3 Counselling before and during pregnancy 3 Collecting the family history

More information

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other?

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other? Marrying a relative Is there an increased chance that a child will have genetic problems if its parents are related to each other? The simple answer to this question is Yes, there is an increased chance.

More information

Von Mäusen und Menschen E - 1

Von Mäusen und Menschen E - 1 Von Mäusen und Menschen E - 1 Mus musculus: Genetic Portrait of the House Mouse E - 3 Outline Mouse genome Mouse life cycle Transgenic protocols Addition of genes by nuclear injection Removal of genes

More information

Consent for Treatment

Consent for Treatment IVF_Consent_Booklet_Web_5.2015_IVFNE:IVFConsentBook.v2 5/28/2015 11:21 AM Page 1 Assisted Reproduction In Vitro Fertilization Intracytoplasmic Sperm Injection Assisted Hatching Embryo Cryopreservation

More information

Patient information on soft markers

Patient information on soft markers Patient information on soft markers Before you read this section remember the following important points. The vast majority of babies with soft markers are normal. Soft markers are frequently seen in healthy

More information

Optional Tests Offered Before and During Pregnancy

Optional Tests Offered Before and During Pregnancy Plano Women s Healthcare Optional Tests Offered Before and During Pregnancy Alpha-Fetoprotein Test (AFP) and Quad Screen These are screening tests that can assess your baby s risk of having such birth

More information

Developing Human Fetus

Developing Human Fetus Period Date LAB. DEVELOPMENT OF A HUMAN FETUS After a human egg is fertilized with human sperm, the most amazing changes happen that allow a baby to develop. This amazing process, called development, normally

More information

Minimum standards for ICSI use, screening, patient information and follow-up in WA fertility clinics. January 2006

Minimum standards for ICSI use, screening, patient information and follow-up in WA fertility clinics. January 2006 Minimum standards for ICSI use, screening, patient information and follow-up in WA fertility clinics January 2006 1. BACKGROUND ICSI has been shown to be effective for male factor infertility and it also

More information

Human Growth and Reproduction

Human Growth and Reproduction Human Growth and Reproduction Sperm reach ovum and cluster around it Only one sperm is allowed to penetrate egg When the sperm penetrates the egg, the egg immediately releases a chemical creating a hard

More information

INFORMED CONSENT AND AUTHORIZATION FOR IN VITRO FERTILIZATION OF PREVIOUSLY CRYOPRESERVED OOCYTES

INFORMED CONSENT AND AUTHORIZATION FOR IN VITRO FERTILIZATION OF PREVIOUSLY CRYOPRESERVED OOCYTES INFORMED CONSENT AND AUTHORIZATION FOR IN VITRO FERTILIZATION OF PREVIOUSLY CRYOPRESERVED OOCYTES We, the undersigned, as patient and partner understand that we will be undergoing one or more procedures

More information

PGS-NGS 360 Preimplantation Genetic Screening

PGS-NGS 360 Preimplantation Genetic Screening Genetic Laboratory PGS-NGS 360 Preimplantation Genetic Screening Innovators in Reproductive Genetics PGS-NGS 360 PGS-NGS 360 is a test for aneuploidy screening of all 24 chromosomes. Primplantation genetic

More information

Information for couples where both partners carry Haemoglobin S (sickle cell)

Information for couples where both partners carry Haemoglobin S (sickle cell) Information for couples where both partners carry Haemoglobin S (sickle cell) Including information on prenatal diagnosis Contacts for prenatal diagnosis centre Couple at risk for Sickle Cell Anaemia Ms

More information

Mitosis, Meiosis and Fertilization 1

Mitosis, Meiosis and Fertilization 1 Mitosis, Meiosis and Fertilization 1 I. Introduction When you fall and scrape the skin off your hands or knees, how does your body make new skin cells to replace the skin cells that were scraped off? How

More information

How to choose an IVF clinic and understand success rates: Questions to ask when choosing an IVF clinic.

How to choose an IVF clinic and understand success rates: Questions to ask when choosing an IVF clinic. Australia s National Infertility Network How to choose an IVF clinic and understand success rates: Questions to ask when choosing an IVF clinic. updated 26 05 2015 20 The information contained here is

More information

Community Hospital North. Clearvista Dr.

Community Hospital North. Clearvista Dr. 100% IVF Refund Program Community Hospital North Clearvista Dr. N Dr. David Carnovale and Dr. Jeffrey Boldt, along with everyone at Community Reproductive Endocrinology, are committed to providing you

More information

GENETIC TESTING AND MARFAN SYNDROME

GENETIC TESTING AND MARFAN SYNDROME GENETIC TESTING AND MARFAN SYNDROME Genetic testing for mutations in fibrillin-1 (FBN1) and other genes has become an important and reliable option to aid in the diagnosis of Marfan syndrome and related

More information

12.1 The Role of DNA in Heredity

12.1 The Role of DNA in Heredity 12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin

More information

Human Chromosomes lab 5

Human Chromosomes lab 5 Human Chromosomes lab 5 Objectives Upon completion of this activity, you should be able to: describe the structure of human chromosomes with reference to size, centromere position, and presence or absence

More information

Assisted reproductive technologies (ART) in Canada: 2011 results from the Canadian ART Register

Assisted reproductive technologies (ART) in Canada: 2011 results from the Canadian ART Register 1 Assisted reproductive technologies (ART) in Canada: 2011 results from the Canadian ART Register Joanne Gunby, M.Sc. CARTR Co-ordinator Email: gunbyj@mcmaster.ca Supported by the IVF Directors Group of

More information

it right? activity (page 4) to highlight ethical issues associated with IVF

it right? activity (page 4) to highlight ethical issues associated with IVF IN VITRO FERTILIZATION I V F In some cases, a sperm is directly injected into an egg IVF: THE MEETING OF SPERM AND EGG IN GLASS Louise Brown, the first test tube baby was born in 1978. Since then, there

More information