Blend Taq / Blend Taq -Plus-
|
|
|
- Francis Clark
- 9 years ago
- Views:
Transcription
1 Instruction manual Blend Taq and Blend Taq -Plus F0938K Blend Taq / Blend Taq -Plus- <Blend Taq > BTQ U 200 reactions <Blend Taq -Plus-> BTQ U 200 reactions Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products [6] Protocol 1. Standard reaction setup 2. Cycling conditions [7] Examples [8] Troubleshooting [9] Related products [10] References Store at -20 C CAUSION All reagents in this kit are intended for research purposes. Do not use for diagnosis or clinical purposes. Please observe general laboratory precaution and utilize safety while using this kit. - Blend Taq is a registered trademark of Toyobo Co., Ltd. in Japan. 1
2 [ 1 ] Introduction Description Blend Taq and Blend Taq -Plus- are highly efficient Taq-based s developed based on the Barns method. 1) This method uses a which lacked exonuclease (proofreading) activity (e.g., Taq ) and a small amount of an archaeal with proofreading activity. Because the proofreading activity repairs misincorporated nucleotide bases causing the termination of the polymerase reaction, PCR with a mixed enzyme solution enables highly efficient amplification. The enzyme solution of Blend Taq -Plus- contains anti-taq antibodies that inhibit polymerase activity, allowing for Hot Start PCR. Blend Taq and Blend Taq -Plus- generate da overhang-ended PCR products. Therefore, the PCR products can be cloned using a standard TA-cloning method. Features -This enzyme is effective for the amplification of various targets from small template amounts. The elongation ability of this enzyme is much greater than that of the normal Taq. -Hot Start technology using anti-taq antibodies results in highly efficient amplification. <Blend Taq (Code No. BTQ-101) does not use hot start> -The PCR error ratio of this enzyme is approximately 3-4 times less than that of Taq. (lacking proofreading activity) missincorporation pausing (lacking proofreading activity) repairing (having proofreading activity) (lacking proofreading activity) Fig. 1. The principles of the Barns technology. [ 2 ] Components <Blend Taq > <Blend Taq -Plus-> The provided reagents include the following components for 200 reactions: Blend Taq (2.5 U/μl) 100 μl 10x PCR Buffer for Blend Taq 1.0 ml 2 mm dntps 1.0 ml Blend Taq -Plus- (2.5 U/μl)* 100 μl 10x PCR Buffer for Blend Taq 1.0 ml 2 mm dntps 1.0 ml *This enzyme solution contains anti-taq antibodies. 1
3 [ 3 ] Quality Testing Quality check was performed by amplifying the human β-globin gene (17.5 kb). [ 4 ] Primer Design [ 5 ] Cloning of PCR products PCR primers should be designed according to general guidelines. For the amplification of a long target ( 6 kb), the melting temperature (Tm) of the primers should be set over 70 C. The PCR products of Blend Taq and Blend Taq -Plus- can be cloned according to a standard TA-cloning method. [ 6 ] Protocol 1. Standard reaction setup The following procedures are designed to be used with the components provided in this kit. Before preparing the reaction mixture, all components should be completely thawed, except for the enzyme solution. Notes: Component Volume Final Concentration 10x Buffer 5 μl 1 x 2 mm dntps* 5 μl 0.2 mm each 10 pmol/μl Primer #1 1 μl 0.2 μm 10 pmol/μl Primer #2 1 μl 0.2 μm Genomic DNA ng/50 μl Template DNA X μl Plasmid DNA 1-50 ng/50 μl cdna 200 ng (RNA equiv.)/50 μl E. coli cells (small amount) PCR grade water Y μl Blend Taq (2.5 U/μl) or 0.5 μl 1.25 U / 50 μl Blend Taq -Plus (2.5 U/μl) Total reaction volume 50 μl * Do not use dntps from other kits or companies. -Thin-wall tubes are recommended for PCR use. A total reaction volume of 50 μl is recommended. -For amplification of a long target ( 10 kb), the final concentration of dntps should be mm. 2
4 2. Cycling conditions The following cycling steps are recommended. (1) Cycling conditions for < 6kb targets. < 3-step cycle > Pre-denaturation 94 C, 2 min Denaturation 94 C, 30 sec. Annealing Tm-[5-10] o C*, 30 sec. Extension 72 C, 1 min/kb *Tm value of the primer minus 5 C-10 C cycles (2) Cycling conditions for 6kb products. < 2-step cycle > Pre-denaturation Denaturation Extension 94 C, 2 min 94 C, 30 sec. 68 C, 1 min/kb cycles Note: If the Tm value of the primer is under 73 C, the 3-step cycle is recommended. Notes: -Extension time should be set at 1min per 1 kb of target length. -For colony-direct PCR, the pre-denaturation step should be set for 4 min. [ 7 ] Examples Example 1.Comparison of the sensitivity of PCR with a Taq-based PCR enzyme. Blend Taq -Plus- Taq-based PCR enzyme (company A) Template: Human Genomic DNA Target: β-globin 3.6 kb Lane 1: 0 ng human genomic DNA Lane 2: 5 ng human genomic DNA Lane 3: 10 ng human genomic DNA Lane 4: 20 ng human genomic DNA Lane 5: 40 ng human genomic DNA 3
5 Example 2.Colony-direct PCR using E. coli cells. 4.5 kb M Template: Small amount of E. coli cells (JM109) from colonies Insert: Transferrin receptor 4.5 kb Vector: pbluescript II PCR cycling condition: Lane 1: Insert (+) Lane 2: Insert (+) Lane 3: Insert (-) Lane 4: Insert (+) 94 4 min sec sec. 30 cycles min. F primer: TCGAGGTCGACGGTATCGAT (20mer GC=55%) R primer: CGCTCTAGAACTAGTGGATC (20mer GC=50%) *The primers are designed on the vector. [ 8 ] Troubleshooting Symptoms Cause Solution Cycling conditions are not optimal Lower annealing temperature increments to a maximum of Tm-5 C. Increase the number of cycles by 2-5 cycles. No PCR product / low yield Primers are not good Check the design and/or quality of primers. Smearing / extra band(s) Too much E. coli cells (Colony direct PCR) Cycling conditions are not optimal Decrease the amount of E. coli cells from colonies. Decrease the number of cycles by 2-5 cycles. [ 9 ] Related products [ 10 ] References Product name Package Code No. Highly efficient cdna synthesis kit 100 rxns FSK-101 ReverTra Ace -α- Highly efficient reverse transcriptase 10,000 U TRT-101 ReverTra Ace RNase inhibitor (Recombinant type) 2,500 U SIN-201 High Speed PCR enzyme 200 U x1 LDP-101 KOD Dash High fidelity PCR enzyme 200 U x1 KOD-201 KOD -Plus- Highly reliable PCR enzyme KOD FX 200 U x1 KFX-101 1) Barns WM, Proc. Natl. Acad. Sci. USA, 91: (1994) 4
6 NOTICE TO PURCHASER: LIMITED LICENSE Use of this product is covered by one or more of the following US patents and corresponding patent claims outside the US: 5,079,352, 5,789,224, 5,618,711, 6,127,155 and claims outside the US corresponding to US Patent No. 4,889,818. The purchase of this product includes a limited, non-transferable immunity from suit under the foregoing patent claims for using only this amount of product for the purchaser s own internal research. No right under any other patent claim (such as the patented Nuclease Process claims in US Patents Nos. 5,210,015 and 5,487,972), no right to perform any patented method, and no right to perform commercial services of any kind, including without limitation reporting the results of purchaser's activities for a fee or other commercial consideration, is conveyed expressly, by implication, or by estoppel. This product is for research use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California 94404, USA. 5
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE.
Instruction manual for KOD FX Neo 1103 F1100K KOD FX Neo KFX-201 200 U 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Quality testing [4] Primer design [5] Cloning of PCR products
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
Herculase Hotstart DNA Polymerase
Herculase Hotstart DNA Polymerase INSTRUCTION MANUAL Catalog #600310 (100 U), #600312 (500 U), and #600314 (1000 U) Revision A.01 For In Vitro Use Only 600310-12 LIMITED PRODUCT WARRANTY This warranty
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
PrimeScript High Fidelity RT-PCR Kit
For Research Use PrimeScript High Fidelity RT-PCR Kit Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Materials Required but not Provided... 4 IV. Storage... 4 V. Fidelity
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
PCR Instruments and Consumables
Index Page GeneAmp PCR Instrument Systems 2 GeneAmp PCR System 9700 Components 3 Accessories and Software for GeneAmp PCR Instrument Systems 4 Disposables 5 PCR Enzymes 7 GeneAmp PCR Kits 12 RNA PCR Kits
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
Highly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
DyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
PfuTurbo DNA Polymerase
PfuTurbo DNA Polymerase Instruction Manual Catalog #600250, #600252, #600254 and #600256 Revision E.0 For Research Use Only. Not for use in diagnostic procedures. 600250-12 LIMITED PRODUCT WARRANTY This
Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput
amplification tech note 5362 Fast PCR: General Considerations for Minimizing Run Times and Maximizing Throughput Daniel Sullivan, Babette Fahey, and David Titus, Bio-Rad Laboratories, Inc., Waltham, MA
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
POLYMERASES & AMPLIFICATION. OneTaq RT-PCR Kit. Instruction Manual. NEB #E5310S 30 reactions
POLYMERASES & AMPLIFICATION OneTaq RT-PCR Kit Instruction Manual NEB #E5310S 30 reactions ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered Medical
PCR Reagents. The Highest Level of PCR Performance. PCR Enzymes RT-PCR Reagents QPCR and QRT-PCR Reagents dntps
A m p l i f i c a t i o n PCR Reagents The Highest Level of PCR Performance PCR Enzymes RT-PCR Reagents QPCR and QRT-PCR Reagents dntps Stratagene Has Yo High-Fidelity Application General Cloning TA/UA
Real-Time Quantitative PCR Instruments and Consumables
Index Page Sequence Detection Systems 2 Sequence Detection Systems Accessories and Softwares 3 Sequence Detection PCR Reagent Kits 4 Sequence Detection PCR Reagents 9 Sequence Detection Systems Disposables
biotechrabbit Product Catalog
biotechrabbit Product Catalog 2014 2015 biotechrabbit GmbH Neuendorfstr. 24a 16761 Hennigsdorf, Germany [email protected] www.biotechrabbit.com Office: +49 3302 20754 1 0 Fax: +49 3302 20754 1 1 Commercial
High-Capacity cdna Reverse Transcription Kits For 200 and 1000 Reactions
High-Capacity cdna Reverse Transcription Kits For 200 and 1000 Reactions Protocol Copyright 2006,. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this
MagExtractor -Genome-
Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
QIAGEN OneStep RT-PCR Handbook
October 2012 QIAGEN OneStep RT-PCR Handbook For fast and highly sensitive one-step RT-PCR Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
PCR & DNA Sequencing. PCR= Polymerase Chain Reaction. PCR applications
PCR= Polymerase Chain Reaction PCR & DNA Sequencing Biology 224 Instructor: Tom Peavy March 20, 2006 DNA photocopier integral tool for molecular biologists work horse versatile (many applications) not
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
Řekněte si o vzorky zdarma!
strana 1 z 6 Ceník platí v souladu s Obchodními podmínkami LAB MARK od 15.10.2015 Core Reagents for Molecular Biology www.bioline.com Řekněte si o vzorky zdarma! PCR ENZYME & MIXES DNA Polymerases - For
amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye
amplification tech note 6047 Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye Liz Jordan and Richard Kurtz, Gene Expression Division, io-rad
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR
Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR Overview Genomic DNA (gdna) and plasmids containing cloned target sequences are commonly used as standards
Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit
USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Taq PCR Handbook. Sample & Assay Technologies. Taq DNA Polymerase Taq PCR Core Kit Taq PCR Master Mix Kit
Third Second Edition December October 2010 2005 Taq PCR Handbook Taq DNA Polymerase Taq PCR Core Kit Taq PCR Master Mix Kit For standard and specialized PCR applications with minimal optimization Sample
SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit
USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid
Troubleshooting the Single-step PCR Site-directed Mutagenesis Procedure Intended to Create a Non-functional rop Gene in the pbr322 Plasmid Lina Jew Department of Microbiology & Immunology, University of
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
MMLV High Performance Reverse Transcriptase
MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).
Profiling of microrna in Blood Serum/Plasma. Guidelines for the mircury LNA TM Universal RT microrna PCR System
Profiling of microrna in Blood Serum/Plasma Guidelines for the mircury LNA TM Universal RT microrna PCR System Table of Contents 2 Introduction.....................................................................................
Absolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
PfuTurbo C x Hotstart DNA Polymerase
PfuTurbo C x Hotstart DNA Polymerase Instruction Manual Catalog #600410, #600412, and #600414 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 600410-12 LIMITED PRODUCT WARRANTY
SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual
Toll Free: 866-252-7771 752A Lincoln Blvd. Phone: 732-469-7771 Fax: 732-469-7782 Middlesex, NJ 08846 Web: www.purebiotechllc.com SOLIDscript Solid Phase cdna Synthesis Kit Instruction Manual Product: SOLIDscript
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
Megaplex Pools For microrna Expression Analysis
Megaplex Pools For microrna Expression Analysis Protocol Copyright 2008, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
PCR* Kits For DNA Ladder Assay (Cat. #: APO-DNA1)
PCR* Kits For DNA Ladder Assay (Cat. #: APO-DNA1) INSTRUCTION MANUAL *The Polymerase Chain Reaction (PCR) process is covered by patents owned by Hoffman-LaRoche. Use of the PCR process requires a license.
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
5PCR, real-time PCR, reverse transcription, and cloning
5PCR, real-time PCR, reverse transcription, and cloning 166 www.qiagen.com QIAGEN Product Guide 2007 PCR, real-time PCR, reverse transcription, and cloning 5 5.1 PCR and RT-PCR www.qiagen.com/pg/pcr Selection
PNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
