1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?

Transcription

1 EGFR downstream pathways KRAS domande frequenti ed importanti. Luca Mazzucchelli Istituto cantonale di patologia Locarno )'"* )-# %& # +%,!"# '( "#$ Anti-EGFR monoclonal antibodies (MoAbs) Cetuximab and Panitumumab recognize the extracellular domain of EGFR, lead to receptor internalization and degradation, and therefore block EGFR and its downstream cascade activation. Inhibition of cell proliferation, invasion, metastasis and neoangiogenesis 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? Ciardiello et al, N Engl J Med 2008 Ciardiello et al, N Engl J Med 2008,/ #,/ # &114) &114)11 1

2 # 0. Genotypic classification of CRCs by K-Ras status Wild Type Mutated Study Patients KRAS mutations Moroni et al Di Fiore et al Frattini et al Benvenuti et al Khambata-Ford et al Karapetis et al Lievre et al De Roock et al Amado et al Van Cutsem et al Bokemeyer et al !. % 444% 6 44'4'' * #. ; % 9 72.$ 2. %09 7. )$5 % '4%',& 3$%< 557;08 "# "4, "# "4, =>&$?%!%@ =>&$?%!%@ 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? KRAS G13D mutation (8%) has no effect on EGFR targeted therapies KRAS codon 61 (2%) induces resistence to anti-egfr therapies (Lancet Oncology 2010) 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? 2

3 #%<. 2"4,!%9 Study Patients KRAS mutations? $?57)$%%)5 Wild Type Mutated Method Moroni et al Sequencing Di Fiore et al Sequencing Frattini et al Sequencing Benvenuti et al Sequencing Khambata-Ford et al Sequencing Karapetis et al Sequencing Lievre et al Allele-specific PCR De Roock et al Allele-specific PCR Amado et al Allele-specific PCR Van Cutsem et al Melt-curve analysis Bokemeyer et al Melt-curve analysis Sensitivity (mut/wt; %) !"'A(><0#%<. 9.!") Sensitivity of 0.01% ttggagctggtggcgtaggca wt sequence K-Ras cod 12 5' 3' ttggagctgatgacgtaggca mutated sequence ttggacctggtggcgtaggca wt sequence Mismatched primers introduce a BstNI (in red, for cod 12) or BglI (for cod 13) restriction sites 1 PCR 5' ttggagctgatgacgtaggca 3' The presence of KRAS12 or 13 mutation prevent the formation of mutated sequence BstNI or BglI restriction sites High sensitive KRAS mutation detection methods, such as ME-PCR (sensitivity of 0.01%), have never been used for the assessment of KRAS predictive role 1 DIGESTION 2 PCR 2 DIGESTION 1 digestion with BstNI or BglI restriction enzymes 2 PCR with mismatched primers 2 digestion with BstNI or BglI restriction enzymes 3% poliacrillamide gel electrophoresis and sequencing RESULTS KRAS mutations by ME-PCR 32 mcrc patients wild-type for KRAS and BRAF as detected by DS RESULTS KRAS analysis by ME-PCR in primary tumor and metastasis KRAS wt mut 25/32 (78%) 7/32 (22%) Responders 11 0 Non responders 14 7 PRIMARY TUMOUR METASTASIS DS ME-PCR 1 PT colon WT G12D M lung G12D G12D M brain G12D G12D 2 PT colon WT G12V M LN G12V G12V Anti-EGFR therapy MUT 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? WT Tumor progression MUT WT ME-PCR seems to increase the detection rate of NR patients Additional prospective studies, and cost-benefit analyses are needed to clarify this issue In primary tumor there could be KRAS mutated minor clones KRAS mutated minor clones detected only by ME-PCR in primary tumor may acquire relevance in the metastatic process 3

4 > Primary tumor Metastasis Patient 1 KRAS wt KRAS mut 3. Bisogna analizzare il tumore primitivo o le metastasi? Patient 2 Primary tumor KRAS mut Metastasis KRAS wt ). 0 9 =@ ( B $-?$55 1=@ D D$"?$55 C 9$?)$ "4 $ $; ; 1 1 1; 3. Bisogna analizzare il tumore primitivo o le metastasi?!$+?$5 %$?($; ; 1=;@ 1;=83@ Perform KRAS testing on metastais/recidive, if possible %! $?)$55; =)'E!ED*@ ;1=@ '$?($ 1=@ Pre-treatment Small biopsy Biopsy not always available Not representative of the entire tumour specimen Post-treatment Chemoradiation could alterate the tumor molecular profile Few tumoral cells 4. Prima o dopo terapia neoadiuvante? 4

5 AIM To compare KRAS gene status between pre and post-treatment specimens of LARC patients by using two techniques with different sensitivity (direct sequencing and ME-PCR) RESULTS KRAS mutations #%< / KRAS mutations Patients and methods 61 patients with LARC treated with Neo-Adjuvant Chemo-Radiation were analyzed for KRAS mutations by direct sequencing and ME-PCR Direct sequencing ME-PCR Pre-treated biopsies 24/61 (39%) 28/61 (46%) Post-treated specimens 13/61 (21%) 24/61 (39%) Prima o dopo terapia neoadiuvante? The use of high sensitive techniques enhances the detection of KRAS mutations in pts with LARC treated with NCRT 5. Should we test for BRAF? On pre-treatment biopsy, direct sequencing can be routinely used while post-treated specimens must be investigated only by means of high sensitive methodologies "4,!%9 113 patients with metastatic CRC treated with Cetuximab or Panitumumab 79 patients mut KRAS 34/113 (30%) mut BRAF 11/79 (14%) +%,68" 68 patients '+%,68" 9 9 =>*F!F!$?(;780@ 5

6 +%, <9. 9 +%,68" 9<9.. =>*F!F!$?(;780@ ASCO 2010, Abstract Should we test for BRAF? BRAF is an adverse prognostic factor Patients with BRAF mutations may benefit from other target therapies BRAFmutation is significantly associated with a low response rate 6. So what? To date, KRAS is the only validated biomarker predictive of efficacy of anti-egfr agents; use of all other biomarkers is promising but still at a preliminary stage Quadruple negative patients Lancet Oncology 2010 (Sartore Bianchi et al, PLOS-One 2009) 6

7 Objective response Disease control Progression free survival 6. So what? Overall survival BRAF, NRAS PIK3CA ex 20 are significantly associated with a low response rate Objective response rates could be improved by additional genotyping of BRAF, NRAS, PIk3C ex 20 in KRAS wt population Istitutto cantonale di patologia, Locarno IOSI, Bellinzona Collaborazioni Candiolo, Milano, Basilea Milo Frattini Vittoria Martin Elena Zanellato Martina Nucifora Alice Riva Davide Romanelli Sara Banfi Antonella Camponovo Morena Ghisletta Paola Galli 7