1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?

Size: px
Start display at page:

Download "1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?"

Transcription

1 EGFR downstream pathways KRAS domande frequenti ed importanti. Luca Mazzucchelli Istituto cantonale di patologia Locarno )'"* )-# %& # +%,!"# '( "#$ Anti-EGFR monoclonal antibodies (MoAbs) Cetuximab and Panitumumab recognize the extracellular domain of EGFR, lead to receptor internalization and degradation, and therefore block EGFR and its downstream cascade activation. Inhibition of cell proliferation, invasion, metastasis and neoangiogenesis 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? Ciardiello et al, N Engl J Med 2008 Ciardiello et al, N Engl J Med 2008,/ #,/ # &114) &114)11 1

2 # 0. Genotypic classification of CRCs by K-Ras status Wild Type Mutated Study Patients KRAS mutations Moroni et al Di Fiore et al Frattini et al Benvenuti et al Khambata-Ford et al Karapetis et al Lievre et al De Roock et al Amado et al Van Cutsem et al Bokemeyer et al !. % 444% 6 44'4'' * #. ; % 9 72.$ 2. %09 7. )$5 % '4%',& 3$%< 557;08 "# "4, "# "4, 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? KRAS G13D mutation (8%) has no effect on EGFR targeted therapies KRAS codon 61 (2%) induces resistence to anti-egfr therapies (Lancet Oncology 2010) 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? 2

3 #%<. 2"4,!%9 Study Patients KRAS mutations? $?57)$%%)5 Wild Type Mutated Method Moroni et al Sequencing Di Fiore et al Sequencing Frattini et al Sequencing Benvenuti et al Sequencing Khambata-Ford et al Sequencing Karapetis et al Sequencing Lievre et al Allele-specific PCR De Roock et al Allele-specific PCR Amado et al Allele-specific PCR Van Cutsem et al Melt-curve analysis Bokemeyer et al Melt-curve analysis Sensitivity (mut/wt; %) !"'A(><0#%<. 9.!") Sensitivity of 0.01% ttggagctggtggcgtaggca wt sequence K-Ras cod 12 5' 3' ttggagctgatgacgtaggca mutated sequence ttggacctggtggcgtaggca wt sequence Mismatched primers introduce a BstNI (in red, for cod 12) or BglI (for cod 13) restriction sites 1 PCR 5' ttggagctgatgacgtaggca 3' The presence of KRAS12 or 13 mutation prevent the formation of mutated sequence BstNI or BglI restriction sites High sensitive KRAS mutation detection methods, such as ME-PCR (sensitivity of 0.01%), have never been used for the assessment of KRAS predictive role 1 DIGESTION 2 PCR 2 DIGESTION 1 digestion with BstNI or BglI restriction enzymes 2 PCR with mismatched primers 2 digestion with BstNI or BglI restriction enzymes 3% poliacrillamide gel electrophoresis and sequencing RESULTS KRAS mutations by ME-PCR 32 mcrc patients wild-type for KRAS and BRAF as detected by DS RESULTS KRAS analysis by ME-PCR in primary tumor and metastasis KRAS wt mut 25/32 (78%) 7/32 (22%) Responders 11 0 Non responders 14 7 PRIMARY TUMOUR METASTASIS DS ME-PCR 1 PT colon WT G12D M lung G12D G12D M brain G12D G12D 2 PT colon WT G12V M LN G12V G12V Anti-EGFR therapy MUT 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? WT Tumor progression MUT WT ME-PCR seems to increase the detection rate of NR patients Additional prospective studies, and cost-benefit analyses are needed to clarify this issue In primary tumor there could be KRAS mutated minor clones KRAS mutated minor clones detected only by ME-PCR in primary tumor may acquire relevance in the metastatic process 3

4 > Primary tumor Metastasis Patient 1 KRAS wt KRAS mut 3. Bisogna analizzare il tumore primitivo o le metastasi? Patient 2 Primary tumor KRAS mut Metastasis KRAS wt ). 0 9 ( B $-?$55 D D$"?$55 C 9$?)$ "4 $ $; ; 1 1 1; 3. Bisogna analizzare il tumore primitivo o le metastasi?!$+?$5 %$?($; ; Perform KRAS testing on metastais/recidive, if possible %! $?)$55; '$?($ Pre-treatment Small biopsy Biopsy not always available Not representative of the entire tumour specimen Post-treatment Chemoradiation could alterate the tumor molecular profile Few tumoral cells 4. Prima o dopo terapia neoadiuvante? 4

5 AIM To compare KRAS gene status between pre and post-treatment specimens of LARC patients by using two techniques with different sensitivity (direct sequencing and ME-PCR) RESULTS KRAS mutations #%< / KRAS mutations Patients and methods 61 patients with LARC treated with Neo-Adjuvant Chemo-Radiation were analyzed for KRAS mutations by direct sequencing and ME-PCR Direct sequencing ME-PCR Pre-treated biopsies 24/61 (39%) 28/61 (46%) Post-treated specimens 13/61 (21%) 24/61 (39%) Prima o dopo terapia neoadiuvante? The use of high sensitive techniques enhances the detection of KRAS mutations in pts with LARC treated with NCRT 5. Should we test for BRAF? On pre-treatment biopsy, direct sequencing can be routinely used while post-treated specimens must be investigated only by means of high sensitive methodologies "4,!%9 113 patients with metastatic CRC treated with Cetuximab or Panitumumab 79 patients mut KRAS 34/113 (30%) mut BRAF 11/79 (14%) +%,68" 68 patients '+%,68" 9 9 5

6 +%, <9. 9 +%,68" 9<9.. ASCO 2010, Abstract Should we test for BRAF? BRAF is an adverse prognostic factor Patients with BRAF mutations may benefit from other target therapies BRAFmutation is significantly associated with a low response rate 6. So what? To date, KRAS is the only validated biomarker predictive of efficacy of anti-egfr agents; use of all other biomarkers is promising but still at a preliminary stage Quadruple negative patients Lancet Oncology 2010 (Sartore Bianchi et al, PLOS-One 2009) 6

7 Objective response Disease control Progression free survival 6. So what? Overall survival BRAF, NRAS PIK3CA ex 20 are significantly associated with a low response rate Objective response rates could be improved by additional genotyping of BRAF, NRAS, PIk3C ex 20 in KRAS wt population Istitutto cantonale di patologia, Locarno IOSI, Bellinzona Collaborazioni Candiolo, Milano, Basilea Milo Frattini Vittoria Martin Elena Zanellato Martina Nucifora Alice Riva Davide Romanelli Sara Banfi Antonella Camponovo Morena Ghisletta Paola Galli 7

!! "# - ' - ) * $ ( ISTITUTO TUMORI MILANO

!! # - ' - ) * $ ( ISTITUTO TUMORI MILANO "!! "# "#'( "# " ) * +, +, - ' - ( STTUTO TUMOR MLANO 1 " "!"# #./01- - -( # * ' ( ' ( ) ' +, #--!. * ) #!"# #!"# STTUTO TUMOR MLANO!"# ' *+*+++,"--!. * ' ( 1 ## ) -!/!00 STTUTO TUMOR MLANO #582#32:5825#24)592

More information

quali sottogruppi biologici di elezione?

quali sottogruppi biologici di elezione? Roma, 10 maggio 2013 Meccanismi molecolari di resistenza alle terapie anti-egfr nella neoplasia colorettale metastatica: quali sottogruppi biologici di elezione? Andrea Sartore Bianchi Oncologia Clinica

More information

Come è cambiata la storia naturale della malattia

Come è cambiata la storia naturale della malattia Malattia Metastatica del Carcinoma del Grosso Intestino Tecniche e terapie Innovative Come è cambiata la storia naturale della malattia Antonio Frassoldati Oncologia Clinica - Ferrara 29 ottobre 2011 Colorectal

More information

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Medical Policy An independent licensee of the Blue Cross Blue Shield Association KRAS, NRAS, and BRAF Mutation Analysis in Page 1 of 17 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: KRAS, NRAS, and BRAF Mutation Analysis in Professional Institutional

More information

Overall survival in metasta0c colorectal cancer and cost of treament

Overall survival in metasta0c colorectal cancer and cost of treament Overall survival in metasta0c colorectal cancer and cost of treament months 20 ~ 24 $ (8 weeks of treatment) 6-8 12-14 BSC 5FU FOLFOX FOLFIRI FOLFOX/ FOLFIRI + cetuximab- bevacizumab Mayo Clinic LV5FU2

More information

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions

More information

Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient

Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient Cetuximab (Erbitux) Policy Number: Original Effective Date: MM.04.005 05/10/2005 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s)

More information

Targeted Therapy What the Surgeon Needs to Know

Targeted Therapy What the Surgeon Needs to Know Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures

More information

Colorectal cancer xenopatients: A preclinical platform for precision medicine

Colorectal cancer xenopatients: A preclinical platform for precision medicine Colorectal cancer xenopatients: A preclinical platform for precision medicine Livio Trusolino, MD PhD Laboratory of Molecular Pharmacology IRCC, Institute for Cancer Research and Treatment University of

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer

More information

Oncology Solutions with the MassARRAY System

Oncology Solutions with the MassARRAY System ARRAY Dx One Platform from DNA to Results with the ARRAY System ARRAY Dx is a CE-IVD marked genetic analysis system that enables reliable multiplexed detection of clinically relevant mutations as low as

More information

Evaluating the Evidence for Clinical Utility

Evaluating the Evidence for Clinical Utility A Blue Cross and Blue Shield Association Presentation Evaluating the Evidence for Clinical Utility Margaret Piper, PhD, MPH Director, Genomics Resources Technology Evaluation Center Institute of Medicine

More information

Targeted Chemotherapy: Guiding patients to more personalized care

Targeted Chemotherapy: Guiding patients to more personalized care Targeted Chemotherapy: Guiding patients to more personalized care Anna Hitron, Pharm.D, MS, MBA, BCOP Oncology Pharmacy Specialist Baptist Health Louisville September 10, 2015 Objectives Discuss the role

More information

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Rafal Dziadziuszko, MD, PhD University of Colorado Cancer Center, Aurora, CO, USA Medical University of Gdansk, Poland EMEA Workshop on Biomarkers,

More information

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns July 2013 Edition Vol. 7, Issue 7 Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns By Julie Katz, MPH, MPhil Biomarkers played a prominent role in the research presented in

More information

Nuevas tecnologías basadas en biomarcadores para oncología

Nuevas tecnologías basadas en biomarcadores para oncología Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS

More information

Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment

Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment Aims of this leaflet This leaflet has been written to help you understand your medicine options after being

More information

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Médecine de précision médecine personnalisée en Oncologie Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Successful targeted drug development Rapid identification

More information

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry The American Journal of Surgery (2013) 205, 608-612 North Pacific Surgical Association Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer

More information

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of

More information

WHITE PAPER SEPT 2015

WHITE PAPER SEPT 2015 WHITE PAPER SEPT 2015 LIQUID BIOPSY FOR THE DETECTION AND MONITORING OF CANCER: ANALYSIS OF 96 HOTSPOT MUTATIONS VIA PLASMA DERIVED CIRCULATING TUMOR DNA PATHWAY GENOMICS CANCER AND SOMATIC MUTATIONS The

More information

FARMACI PERSONALIZZATI PER

FARMACI PERSONALIZZATI PER ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica FARMACI

More information

Guideline Development The American Society of Clinical Oncology

Guideline Development The American Society of Clinical Oncology Assessing Genomic Sequencing Information for Health Care Decision Making Decision Making Once Evidence is Assessed/Graded Evaluated Guideline Development The American Society of Clinical Oncology Gary

More information

Targeted Therapies in Lung Cancer

Targeted Therapies in Lung Cancer Targeted Therapies in Lung Cancer I Edited by: Simona Carnio Thoracic Oncology Division - St Luigi Hospital Orbassano (TO) - Italy Silvia Novello Department of Oncology - University of Torino - Italy Why

More information

Colorectal Cancer Molecular Diagnostics

Colorectal Cancer Molecular Diagnostics Colorectal Cancer Molecular Diagnostics Mary P. Bronner, M.D. Division Chief of Anatomic and Molecular Oncologic Pathology Molecular CRC Testing MSI, MMR IHC KRAS BRAF PIK3CA PTEN APC, SMAD4, BMPRIA,STK11

More information

Click to edit Master title style

Click to edit Master title style O ral Cancer - so much research, Click to edit Master title style so little progress-why? Click to edit Master text styles Second Level Christopher Squier Third Level Department of O ral Pathology Fourth

More information

Immune Therapy / Targeted Therapy in HNSCC

Immune Therapy / Targeted Therapy in HNSCC Systemic Therapy: Chemotherapy Immune Therapy / Targeted Therapy in HNSCC Immunotherapy Alain Algazi, MD Assistant Clinical Professor UCSF Melanoma & Head and Neck Oncology Targeted therapy alain.algazi@ucsf.edu

More information

How Will Genomics Change Our Practice? Paula Trahan Rieger RN, MSN, CAE, FAAN CEO, Oncology Nursing Society

How Will Genomics Change Our Practice? Paula Trahan Rieger RN, MSN, CAE, FAAN CEO, Oncology Nursing Society How Will Genomics Change Our Practice? Paula Trahan Rieger RN, MSN, CAE, FAAN CEO, Oncology Nursing Society Objectives Name two possibilities for using information obtained through molecular profiling

More information

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE Branko Zakotnik MD, PhD Department of Medical Oncology Institute of Oncology Ljubljana 1 I have no conflict of interest to declare

More information

COLD-PCR: Very High Sensitivity Mutation Detection

COLD-PCR: Very High Sensitivity Mutation Detection COLD-PCR: Very High Sensitivity Mutation Detection New and Developing Technologies for Genetic Diagnostics Salisbury July 2010 Detection of Somatic Mutations 50% Mutant 10% Mutant 5% Mutant 2% Mutant 1%

More information

Immuno-Oncology: Harnessing the Oncologist That Lies Within A Patient s Immune System

Immuno-Oncology: Harnessing the Oncologist That Lies Within A Patient s Immune System Immuno-Oncology: Harnessing the Oncologist That Lies Within A Patient s Immune System Kevin P. Hubbard, DO, FACOI Interim Chair - Department of Specialty Medicine Professor and Chair - Division of Internal

More information

Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views

Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Dr. Tilman Schöning Heidelberg University Hospital, Germany Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Conflicts of interest Participation in Advisory Boards Amgen GmbH,

More information

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials)

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) 3 Integrated Trials Testing Targeted Therapy in Early Stage Lung Cancer Part of NCI s Precision Medicine Effort in

More information

Molecular Diagnosis of Gastrointestinal Tumors

Molecular Diagnosis of Gastrointestinal Tumors Molecular Diagnosis of Gastrointestinal Tumors Zoltan Szentirmay National Institute of Oncology Center of Surgical and Molecular Tumor Pathology EEA and Norwegian Financial Mechanisms in Hungary, Development

More information

BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time?

BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? Brooke Phillips, MD, Matthew Kalady, MD, and Richard Kim, MD Dr. Phillips is a fellow in the Department of Oncology at the Taussig

More information

Validation of Blood Testing for K-ras Mutations in Colorectal and Pancreatic Cancer

Validation of Blood Testing for K-ras Mutations in Colorectal and Pancreatic Cancer Short Review Validation of Blood Testing for K-ras Mutations in Colorectal and Pancreatic Cancer MOSHE ROGOSNITZKY 1 and RACHEL DANKS 2 1 MedInsight Research Institute, Telz Stone, Israel; 2 MedInsight

More information

El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future

El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future El papel de la anatomía patológica en oncología: presente y futuro The role of pathological anatomy in oncology: present and future Federico Rojo Fundación Jiménez Díaz, Madrid All patients with same diagnosis:

More information

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Vincent A. Miller, M.D. Foundation Medicine, Inc. AACR Annual Meeting 2012 Current Concepts session

More information

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam

More information

Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012

Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 Nuovi Scenari in Oncologia G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 WHAT is cancer? «Cancer is a genetic disease of the somatic cell» [B. Vogelstein] Ten years ago Now [Cell.

More information

Distribution of KRAS and BRAF Mutations in Metastatic Colorectal Cancers in Turkish Patients

Distribution of KRAS and BRAF Mutations in Metastatic Colorectal Cancers in Turkish Patients DOI:http://dx.doi.org/10.7314/APJCP.2016.17.3.1175 RESEARCH ARTICLE Distribution of KRAS and BRAF Mutations in Metastatic Colorectal Cancers in Turkish Patients Orhan Gorukmez 1, Tahsin Yakut 2 *, Ozlem

More information

Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC)

Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Policy #: 468 Latest Review Date: October 2015 Category: Laboratory Policy Grade: B Background/Definitions:

More information

Mechanism Of Action of Palbociclib & PFS Benefit

Mechanism Of Action of Palbociclib & PFS Benefit A Phase II Randomized Controlled Trial of Palbociclib & Tamoxifen/Fulvestrant in Postmenopausal Women and Men With Hormone-Receptor Positive, HER2- Negative Metastatic Breast Cancer (MBC) Protocol Chair:

More information

Maintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai

Maintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Maintenance therapy in in Metastatic NSCLC Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Definition of Maintenance therapy The U.S. National Cancer Institute s

More information

Spitz nevus. Spiz nevus

Spitz nevus. Spiz nevus FISH in Spitz Nävi. Ein ungelöstes Problem L. Mazzucchelli Istituto cantonale di patologia, Locarno, Schweiz 5. FISH-Anwenderforum 211, Wiesbaden-Delkenheim Until the late 194s, Spitz nevus was commonly

More information

The following information is only meant for people who have been diagnosed with advanced non-small cell

The following information is only meant for people who have been diagnosed with advanced non-small cell Important information for people with advanced non-small cell lung cancer The following information is only meant for people who have been diagnosed with advanced non-small cell lung cancer (NSCLC). NSCLC

More information

KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date

KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date MP 2.04.43 KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013

More information

Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress

Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Lung Cancer Accounts for 14% of All New Cancer Diagnoses in the United States 1 Lung cancer is the second most common malignancy

More information

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine

More information

Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC)

Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Medical Policy Manual Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Section: Genetic Testing Policy No: 56 Date of Origin: August 2010 Last Reviewed Date: December

More information

AKT1 APC BRAF CTNNB1 KIT EGFR IDH1 MAP2K1 KRAS NOTCH1 NRAS PIK3CA TP53 PTEN. Rapid Tumor Genotyping in Solid Tumors

AKT1 APC BRAF CTNNB1 KIT EGFR IDH1 MAP2K1 KRAS NOTCH1 NRAS PIK3CA TP53 PTEN. Rapid Tumor Genotyping in Solid Tumors AKT1 AC BRAF CTNNB1 KIT IDH1 MA2K1 NOTCH1 NRAS IK3CA TEN T53 Rapid Tumor Genotyping in Solid Tumors Tumor Genotyping ersonalized Medicine Requires ersonalized Diagnostics Biological discoveries utilizing

More information

Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center

Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Future Directions in Clinical Research Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Outline 1. Status of Cancer Treatment 2. Overview of Clinical Research at UCDCC 3.

More information

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a La diagnostica molecolare nelle neoplasie colo-rettali C-NET A do Scarpa e Dipartime to Pato ogia e U iversita di Vero a La stessa malattia puo avere diverse patogenesi cucchiaio moneta forchetta Gastrointestinal

More information

The role of K-RAS and B-RAF mutations as biomarkers in metastatic colorectal cancer

The role of K-RAS and B-RAF mutations as biomarkers in metastatic colorectal cancer J BUON 2013; 18(1): 116-123 ISSN: 1107-0625 www.bu-on.org/jbuon E-mail: jbuon@ath.forthnet.gr ORIGINAL ARTICLE The role of K-RAS and B-RAF mutations as biomarkers in metastatic colorectal cancer F. Selcukbiricik

More information

EGFR gene mutations Ex 19 Ex 21 Paez et al, Science 2004

EGFR gene mutations Ex 19 Ex 21 Paez et al, Science 2004 Evolution of knowledge in NSCLC Pao and Girard, Lancet Oncology 2011 Fattori da considerare nella scelta terapeutica del NSCLC nel 2012 Stadio di malattia PS Età Comorbidità Compliance e desiderio del

More information

Array BioPharma COLUMBUS: Met Primary Endpoint. September 26, 2016

Array BioPharma COLUMBUS: Met Primary Endpoint. September 26, 2016 Array BioPharma COLUMBUS: Met Primary Endpoint September 26, 2016 Safe Harbor Statement 2 This presentation contains forward-looking statements within the meaning of the Private Securities Litigation Reform

More information

Histopathology and prognosis in renal cancer

Histopathology and prognosis in renal cancer Histopathology and prognosis in renal cancer Granular cell Granular cell Granular cell Granular cell Clear cell Chromophobe cell Papillary type 2 Luca Mazzucchelli Istituto cantonale di patologia, Locarno

More information

Clinical development of AZD9291 in non-small cell lung cancer

Clinical development of AZD9291 in non-small cell lung cancer Clinical development of AZD9291 in non-small cell lung cancer Rachael Lawrance (AstraZeneca) PSI One Day Meeting: The Innovative, Challenging and Diversified World of Respiratory Disease 13 Nov 2015 Overview

More information

Targeted therapies for Early Stage Breast Cancer. Cynthia Vakhariya D.O. Providence Hospital

Targeted therapies for Early Stage Breast Cancer. Cynthia Vakhariya D.O. Providence Hospital Targeted therapies for Early Stage Breast Cancer Cynthia Vakhariya D.O. Providence Hospital Case 55-year-old postmenopausal woman Routine screening mammogram 3 cm irreg mass in L breast Left breast ultrasound

More information

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical

More information

Challenges of Anti-Cancer Immunotherapy Development- Industry Perspective. Eric H. Rubin, M.D. Merck Sharp & Dohme

Challenges of Anti-Cancer Immunotherapy Development- Industry Perspective. Eric H. Rubin, M.D. Merck Sharp & Dohme Challenges of Anti-Cancer Immunotherapy Development- Industry Perspective Eric H. Rubin, M.D. Merck Sharp & Dohme Key Challenges Unique mechanism of action and increasing commercial availability create

More information

Adjuvant Therapy Non Small Cell Lung Cancer. Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015

Adjuvant Therapy Non Small Cell Lung Cancer. Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015 Adjuvant Therapy Non Small Cell Lung Cancer Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015 No Disclosures Number of studies Studies Per Month 12 10 8 6 4 2 0 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3

More information

Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART

Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART Goals Discuss treatment options for stage 4 lung cancer: New and old Discuss new developments in personalized

More information

Cellular, Molecular, and Biochemical Targets in Breast Cancer

Cellular, Molecular, and Biochemical Targets in Breast Cancer Cellular, Molecular, and Biochemical Targets in Breast Cancer Kristy Kummerow Ingrid Meszoely December 12, 2012 VUMC Resident Bonus Conference One size fits all surgical treatment of breast cancer Wilhelm

More information

Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma. Claire Vines, 2016 Pharm.D. Candidate

Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma. Claire Vines, 2016 Pharm.D. Candidate + Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma Claire Vines, 2016 Pharm.D. Candidate + Disclosure I have no conflicts of interest to disclose. + Objectives Summarize NCCN

More information

SAMO FoROMe Post-ESMO 2013 Breast Cancer

SAMO FoROMe Post-ESMO 2013 Breast Cancer SAMO FoROMe Post-ESMO 2013 Breast Cancer Dr. med. Manuela Rabaglio Klinik und Poliklinik für Medizinische Onkologie Breast Cancer Track 300 Abstracts 142 Poster 11 Proffered paper 4 late breaking news

More information

Rilevanza dell innovazione tecnologica per la

Rilevanza dell innovazione tecnologica per la Rilevanza dell innovazione tecnologica per la ricerca traslazionale e la terapia in oncologia Ruggero De Maria Dipartimento di Ematologia Oncologia e Medicina Molecolare, Istituto Superiore di Sanità Translational

More information

TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC

TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC Dr.ssa Sara Ramella Radioterapia Oncologica Campus Bio-Medico Trimodality therapy offers a promising chance of long-term survival Evidenze

More information

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Michael B. Atkins, M.D. Deputy Director Georgetown-Lombardi Comprehensive Cancer Center Michael Atkins, MD Consulting Fees (e.g., advisory

More information

POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS DISCLAIMER CODING INFORMATION REFERENCES POLICY HISTORY

POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS DISCLAIMER CODING INFORMATION REFERENCES POLICY HISTORY Original Issue Date (Created): 9/1/2011 Most Recent Review Date (Revised): 1/27/2015 Effective Date: 11/2/2015 POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS

More information

Anti-Epidermal Growth Factor Receptor Monoclonal Antibodies in Metastatic Colorectal Cancer Biotherapy: A Systematic Review

Anti-Epidermal Growth Factor Receptor Monoclonal Antibodies in Metastatic Colorectal Cancer Biotherapy: A Systematic Review Academic Journal of Cancer Research 6 (1): 21-28, 2013 ISSN 1995-8943 IDOSI Publications, 2013 DOI: 10.5829/idosi.ajcr.2013.6.1.72115 Anti-Epidermal Growth Factor Receptor Monoclonal Antibodies in Metastatic

More information

PROSPETTIVE FUTURE NEL TRATTAMENTO. Cinzia Ortega Dipartimento di Oncologia Medica Fondazione del Piemonte per l Oncologia I.R.C.C.S.

PROSPETTIVE FUTURE NEL TRATTAMENTO. Cinzia Ortega Dipartimento di Oncologia Medica Fondazione del Piemonte per l Oncologia I.R.C.C.S. PROSPETTIVE FUTURE NEL TRATTAMENTO MEDICO DEL mrcc Cinzia Ortega Dipartimento di Oncologia Medica Fondazione del Piemonte per l Oncologia I.R.C.C.S. Candiolo Future strategies in mrcc Improve therapeutic

More information

Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing

Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing These Are Hopeful Times for Lung Cancer Survivors When people first learn they have cancer, they are often afraid. But

More information

Canait ate 'Tumour ::arkers. ana PotentiaC 'Tfierapeutic. 'Targets in CoCorectaC Cancer

Canait ate 'Tumour ::arkers. ana PotentiaC 'Tfierapeutic. 'Targets in CoCorectaC Cancer Canait ate 'Tumour ::arkers ana PotentiaC 'Tfierapeutic 'Targets in CoCorectaC Cancer Cassandra M. McIver, B. Sc. Hons A Thesis submitted in total fulfilment of the requirements for the degree of Doctor

More information

Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku

Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku 11 th International Congress on Targeted Anticancer Therapies Paris March 4-6, 2013 Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku Investigational Cancer Therapeutics (Phase

More information

Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga. Jorge S Reis-Filho, MD PhD FRCPath

Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga. Jorge S Reis-Filho, MD PhD FRCPath Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga Jorge S Reis-Filho, MD PhD FRCPath Summary How do PARP inhibitors work? Synthetic lethality Potential

More information

Targeted therapies and brain metastases in lung cancer patients. Benjamin Besse, MD, PhD. Medical Oncologist. 19 septembre 2014

Targeted therapies and brain metastases in lung cancer patients. Benjamin Besse, MD, PhD. Medical Oncologist. 19 septembre 2014 Targeted therapies and brain metastases in lung cancer patients Benjamin Besse, MD, PhD Medical Oncologist 19 septembre 2014 Targeted therapies and brain mets! Brain mets in NSCLC! Specific targeted therapies!

More information

REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM

REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM Valerie Van Damme, Isabelle Wauters, Johan Vansteenkiste Univ. Hospital Leuven and Leuven Lung Cancer Group Introduction Perspectives in Lung Cancer (PILC)

More information

Metastatic breast cancer represents an incurable condition associated with an average survival time of 18 to 24 months.

Metastatic breast cancer represents an incurable condition associated with an average survival time of 18 to 24 months. TACT-2C Trial A phase II randomized, open-label study evaluating the addiction of trastuzumabto (nabtm)-paclitaxel as first line treatment in primary HER2 negative metastatic breast cancer patients with

More information

Cost effectiveness Analysis of Cetuximab in Treatment of Metastatic Colorectal Cancer in Iranian Pharmaceutical Market

Cost effectiveness Analysis of Cetuximab in Treatment of Metastatic Colorectal Cancer in Iranian Pharmaceutical Market International Journal of Preventive Medicine Original Article Open Access Cost effectiveness Analysis of in Treatment of Metastatic Colorectal Cancer in Iranian Pharmaceutical Market Majid Davari, Farzaneh

More information

Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D.

Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D. Prognostic and Predictive Factors in Oncology Mustafa Benekli, M.D. NCI Definitions ESMO Course -Essentials of Medical Oncology -Istanbul 2 Prognostic factor: NCI Definition A situation or condition, or

More information

Nieuwe ontwikkelingen in de systemische behandeling van GE maligniteiten: Over -abs, -ibs en andere zaken

Nieuwe ontwikkelingen in de systemische behandeling van GE maligniteiten: Over -abs, -ibs en andere zaken Nieuwe ontwikkelingen in de systemische behandeling van GE maligniteiten: Over -abs, -ibs en andere zaken Hanneke W.M. van Laarhoven Medical Oncology Academic Medical Centre University of Amsterdam Available

More information

NCCN Non-Small Cell Lung Cancer V.1.2011 Update Meeting 07/09/10

NCCN Non-Small Cell Lung Cancer V.1.2011 Update Meeting 07/09/10 Guideline Page and Request NSCL-3 Stage IA, margins positive delete the recommendation for chemoradiation. Stage IB, IIA, margins positive delete the recommendation for chemoradiation + Stage IIA, Stage

More information

DIPARTIMENTO di SCIENZE BIOMEDICHE e BIOTECNOLOGICHE

DIPARTIMENTO di SCIENZE BIOMEDICHE e BIOTECNOLOGICHE July 15, 2015 Science editor of World Journal of Gastroenterology Jing Yu Email: j.yu@wjgnet.com Dear Prof. Jing Yu, please find enclosed a revised version of our paper Non-coding landscapes of Colorectal

More information

Craig Hallum Conference Investor Presentation

Craig Hallum Conference Investor Presentation Craig Hallum Conference Investor Presentation Improving cancer outcomes with groundbreaking precision in molecular testing Paul Kinnon President and CEO Sept 2015 1 Forward-Looking Statements Certain statements

More information

RESEARCH ARTICLE. Value of KRAS, BRAF, and PIK3CA Mutations and Survival Benefit from Systemic Chemotherapy in Colorectal Peritoneal Carcinomatosis

RESEARCH ARTICLE. Value of KRAS, BRAF, and PIK3CA Mutations and Survival Benefit from Systemic Chemotherapy in Colorectal Peritoneal Carcinomatosis RESEARCH ARTICLE Value of KRAS, BRAF, and PIK3CA Mutations and Survival Benefit from Systemic Chemotherapy in Colorectal Peritoneal Carcinomatosis Yusuke Sasaki 1,2, Tetsuya Hamaguchi 1 *, Yasuhide Yamada

More information

10 th EADO Congress Vilnius, 7-10 May 2014. Ipilimumab update. Michele Maio

10 th EADO Congress Vilnius, 7-10 May 2014. Ipilimumab update. Michele Maio 10 th EADO Congress Vilnius, 7-10 May 2014 Ipilimumab update Michele Maio Medical Oncology and Immunotherapy, Department of Oncology University Hospital of Siena, Istituto Toscano Tumori SIENA, ITALY Evolving

More information

How can we generate economic value from personalized medicine and big data analysis?

How can we generate economic value from personalized medicine and big data analysis? Estonian Health Innovation Forum 2015 Focus on Personalised Medicine How can we generate economic value from personalized medicine and big data analysis? Jonathan Knowles October 26, 2015 Tallinn, Viru

More information

RICERCA FINALIZZATA+GIOVANI RICERCATORI MALATTIE RARE. Graduatoria e Finanziamento

RICERCA FINALIZZATA+GIOVANI RICERCATORI MALATTIE RARE. Graduatoria e Finanziamento Direzione Generale Ricerca Scientifica e Tecnologica RICERCA FINALIZZATA+GIOVANI RICERCATORI MALATTIE RARE Graduatoria e Finanziamento Ministero della Salute Direzione Generale Ricerca Scientifica e Tecnologica

More information

Innovation: Present Meets Future

Innovation: Present Meets Future Innovation: Present Meets Future SOCIAL INNOVATION Leading Innovation in the Cooperative Group Setting Craig Nichols, M.D. BEST OF SWOG Barlogie-Salmon Myeloma Committee Robert Z. Orlowski, M.D., Ph.D.

More information

Cos è EGFR? Epidermal Growth Factor Receptor. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro

Cos è EGFR? Epidermal Growth Factor Receptor. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro Formazione interna Cos è EGFR? Epidermal Growth Factor Receptor Valutazione di EGFR con FISH in varie malattie neoplastiche V. Martin 1-0-008 Recettore transmembrana di tipo TK. Codificato dal gene EGFR,

More information

Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics

Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics EPAAC WP8 Research Forum - 2 July, Sofitel Hotel Europe, Brussels Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics JY Blay, Past President EORTC

More information

The trial and tribulations of predictive biomarkers in metastatic RCC.

The trial and tribulations of predictive biomarkers in metastatic RCC. The trial and tribulations of predictive biomarkers in metastatic RCC. Professor Thomas Powles Renal cancer lead for London Cancer Barts Cancer Institute and Royal Free Hospital UCL and QMUL. Proportion

More information

Evaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models

Evaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models Group members and Contact details Jacques Robert graduated in medicine from the University of Strasbourg in 1974 and received hi Research projects: The objectives of our group are: (1) to identify preclinical

More information

HER2 Testing in Breast Cancer

HER2 Testing in Breast Cancer HER2 Testing in Breast Cancer GAIL H. VANCE, M.D. AGT MEETING JUNE 13, 2014 LOUISVILLE, KENTUCKY No Conflict of Interest to Report Human Epidermal Growth Factor Receptor 2-HER2 Human epidermal growth factor

More information

BREAST CANCER UPDATE C H R I S S Z Y A R T O, D O G E N E S E E H E M A T O L O G Y O N C O L O G Y F L I N T, M I

BREAST CANCER UPDATE C H R I S S Z Y A R T O, D O G E N E S E E H E M A T O L O G Y O N C O L O G Y F L I N T, M I BREAST CANCER UPDATE C H R I S S Z Y A R T O, D O G E N E S E E H E M A T O L O G Y O N C O L O G Y F L I N T, M I Overview Why is it important to understand breast cancer? Choosing wisely Appropriateness

More information

Ovarian Cancer and Modern Immunotherapy: Regulatory Strategies for Drug Development

Ovarian Cancer and Modern Immunotherapy: Regulatory Strategies for Drug Development Ovarian Cancer and Modern Immunotherapy: Regulatory Strategies for Drug Development Sanjeeve Bala, MD, MPH Ovarian Cancer Endpoints Workshop FDA White Oak September 3, 2015 Overview Immune agents from

More information

targeted therapy a guide for the patient

targeted therapy a guide for the patient targeted therapy FOR LUNG CANCER a guide for the patient TABLE OF CONTENTS lung cancer basics... 2-3 Gene changes... 4-5 Testing... 7-8 Targeted therapy... 9-11 Drugs Targeting EGFR... 12 Drugs Targeting

More information

BioPATH: A Study of Biomarker Profiles in Asia Pacific HER2 Breast Cancer Patients Treated with Lapatinib and Other Anti-HER2 Therapy

BioPATH: A Study of Biomarker Profiles in Asia Pacific HER2 Breast Cancer Patients Treated with Lapatinib and Other Anti-HER2 Therapy BioPATH: A Study of Biomarker Profiles in Asia Pacific HER2 Breast Cancer Patients Treated with Lapatinib and Other Anti-HER2 Therapy Soonmyung Paik 1 ; Gyungyub Gong 2 ; Yap Yoon Sim 3 ; Tae- You Kim

More information

FAK INHIBITOR DEFACTINIB (VS-6063) TARGETS MESOTHELIOMA CANCER STEM CELLS. Jonathan Pachter, Ph.D.

FAK INHIBITOR DEFACTINIB (VS-6063) TARGETS MESOTHELIOMA CANCER STEM CELLS. Jonathan Pachter, Ph.D. FAK INHIBITOR DEFACTINIB (VS-6063) TARGETS MESOTHELIOMA CANCER STEM CELLS Rationale for maintenance therapy after conventional therapy Jonathan Pachter, Ph.D. Vice President of Research, Verastem, Inc.

More information