1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?

Size: px
Start display at page:

Download "1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?"

Transcription

1 EGFR downstream pathways KRAS domande frequenti ed importanti. Luca Mazzucchelli Istituto cantonale di patologia Locarno )'"* )-# %& # +%,!"# '( "#$ Anti-EGFR monoclonal antibodies (MoAbs) Cetuximab and Panitumumab recognize the extracellular domain of EGFR, lead to receptor internalization and degradation, and therefore block EGFR and its downstream cascade activation. Inhibition of cell proliferation, invasion, metastasis and neoangiogenesis 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? Ciardiello et al, N Engl J Med 2008 Ciardiello et al, N Engl J Med 2008,/ #,/ # &114) &114)11 1

2 # 0. Genotypic classification of CRCs by K-Ras status Wild Type Mutated Study Patients KRAS mutations Moroni et al Di Fiore et al Frattini et al Benvenuti et al Khambata-Ford et al Karapetis et al Lievre et al De Roock et al Amado et al Van Cutsem et al Bokemeyer et al !. % 444% 6 44'4'' * #. ; % 9 72.$ 2. %09 7. )$5 % '4%',& 3$%< 557;08 "# "4, "# "4, 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? KRAS G13D mutation (8%) has no effect on EGFR targeted therapies KRAS codon 61 (2%) induces resistence to anti-egfr therapies (Lancet Oncology 2010) 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? 2

3 #%<. 2"4,!%9 Study Patients KRAS mutations? $?57)$%%)5 Wild Type Mutated Method Moroni et al Sequencing Di Fiore et al Sequencing Frattini et al Sequencing Benvenuti et al Sequencing Khambata-Ford et al Sequencing Karapetis et al Sequencing Lievre et al Allele-specific PCR De Roock et al Allele-specific PCR Amado et al Allele-specific PCR Van Cutsem et al Melt-curve analysis Bokemeyer et al Melt-curve analysis Sensitivity (mut/wt; %) !"'A(><0#%<. 9.!") Sensitivity of 0.01% ttggagctggtggcgtaggca wt sequence K-Ras cod 12 5' 3' ttggagctgatgacgtaggca mutated sequence ttggacctggtggcgtaggca wt sequence Mismatched primers introduce a BstNI (in red, for cod 12) or BglI (for cod 13) restriction sites 1 PCR 5' ttggagctgatgacgtaggca 3' The presence of KRAS12 or 13 mutation prevent the formation of mutated sequence BstNI or BglI restriction sites High sensitive KRAS mutation detection methods, such as ME-PCR (sensitivity of 0.01%), have never been used for the assessment of KRAS predictive role 1 DIGESTION 2 PCR 2 DIGESTION 1 digestion with BstNI or BglI restriction enzymes 2 PCR with mismatched primers 2 digestion with BstNI or BglI restriction enzymes 3% poliacrillamide gel electrophoresis and sequencing RESULTS KRAS mutations by ME-PCR 32 mcrc patients wild-type for KRAS and BRAF as detected by DS RESULTS KRAS analysis by ME-PCR in primary tumor and metastasis KRAS wt mut 25/32 (78%) 7/32 (22%) Responders 11 0 Non responders 14 7 PRIMARY TUMOUR METASTASIS DS ME-PCR 1 PT colon WT G12D M lung G12D G12D M brain G12D G12D 2 PT colon WT G12V M LN G12V G12V Anti-EGFR therapy MUT 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? WT Tumor progression MUT WT ME-PCR seems to increase the detection rate of NR patients Additional prospective studies, and cost-benefit analyses are needed to clarify this issue In primary tumor there could be KRAS mutated minor clones KRAS mutated minor clones detected only by ME-PCR in primary tumor may acquire relevance in the metastatic process 3

4 > Primary tumor Metastasis Patient 1 KRAS wt KRAS mut 3. Bisogna analizzare il tumore primitivo o le metastasi? Patient 2 Primary tumor KRAS mut Metastasis KRAS wt ). 0 9 ( B $-?$55 D D$"?$55 C 9$?)$ "4 $ $; ; 1 1 1; 3. Bisogna analizzare il tumore primitivo o le metastasi?!$+?$5 %$?($; ; Perform KRAS testing on metastais/recidive, if possible %! $?)$55; '$?($ Pre-treatment Small biopsy Biopsy not always available Not representative of the entire tumour specimen Post-treatment Chemoradiation could alterate the tumor molecular profile Few tumoral cells 4. Prima o dopo terapia neoadiuvante? 4

5 AIM To compare KRAS gene status between pre and post-treatment specimens of LARC patients by using two techniques with different sensitivity (direct sequencing and ME-PCR) RESULTS KRAS mutations #%< / KRAS mutations Patients and methods 61 patients with LARC treated with Neo-Adjuvant Chemo-Radiation were analyzed for KRAS mutations by direct sequencing and ME-PCR Direct sequencing ME-PCR Pre-treated biopsies 24/61 (39%) 28/61 (46%) Post-treated specimens 13/61 (21%) 24/61 (39%) Prima o dopo terapia neoadiuvante? The use of high sensitive techniques enhances the detection of KRAS mutations in pts with LARC treated with NCRT 5. Should we test for BRAF? On pre-treatment biopsy, direct sequencing can be routinely used while post-treated specimens must be investigated only by means of high sensitive methodologies "4,!%9 113 patients with metastatic CRC treated with Cetuximab or Panitumumab 79 patients mut KRAS 34/113 (30%) mut BRAF 11/79 (14%) +%,68" 68 patients '+%,68" 9 9 5

6 +%, <9. 9 +%,68" 9<9.. ASCO 2010, Abstract Should we test for BRAF? BRAF is an adverse prognostic factor Patients with BRAF mutations may benefit from other target therapies BRAFmutation is significantly associated with a low response rate 6. So what? To date, KRAS is the only validated biomarker predictive of efficacy of anti-egfr agents; use of all other biomarkers is promising but still at a preliminary stage Quadruple negative patients Lancet Oncology 2010 (Sartore Bianchi et al, PLOS-One 2009) 6

7 Objective response Disease control Progression free survival 6. So what? Overall survival BRAF, NRAS PIK3CA ex 20 are significantly associated with a low response rate Objective response rates could be improved by additional genotyping of BRAF, NRAS, PIk3C ex 20 in KRAS wt population Istitutto cantonale di patologia, Locarno IOSI, Bellinzona Collaborazioni Candiolo, Milano, Basilea Milo Frattini Vittoria Martin Elena Zanellato Martina Nucifora Alice Riva Davide Romanelli Sara Banfi Antonella Camponovo Morena Ghisletta Paola Galli 7

!! "# - ' - ) * $ ( ISTITUTO TUMORI MILANO

!! # - ' - ) * $ ( ISTITUTO TUMORI MILANO "!! "# "#'( "# " ) * +, +, - ' - ( STTUTO TUMOR MLANO 1 " "!"# #./01- - -( # * ' ( ' ( ) ' +, #--!. * ) #!"# #!"# STTUTO TUMOR MLANO!"# ' *+*+++,"--!. * ' ( 1 ## ) -!/!00 STTUTO TUMOR MLANO #582#32:5825#24)592

More information

Overall survival in metasta0c colorectal cancer and cost of treament

Overall survival in metasta0c colorectal cancer and cost of treament Overall survival in metasta0c colorectal cancer and cost of treament months 20 ~ 24 $ (8 weeks of treatment) 6-8 12-14 BSC 5FU FOLFOX FOLFIRI FOLFOX/ FOLFIRI + cetuximab- bevacizumab Mayo Clinic LV5FU2

More information

quali sottogruppi biologici di elezione?

quali sottogruppi biologici di elezione? Roma, 10 maggio 2013 Meccanismi molecolari di resistenza alle terapie anti-egfr nella neoplasia colorettale metastatica: quali sottogruppi biologici di elezione? Andrea Sartore Bianchi Oncologia Clinica

More information

Come è cambiata la storia naturale della malattia

Come è cambiata la storia naturale della malattia Malattia Metastatica del Carcinoma del Grosso Intestino Tecniche e terapie Innovative Come è cambiata la storia naturale della malattia Antonio Frassoldati Oncologia Clinica - Ferrara 29 ottobre 2011 Colorectal

More information

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Medical Policy An independent licensee of the Blue Cross Blue Shield Association KRAS, NRAS, and BRAF Mutation Analysis in Page 1 of 17 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: KRAS, NRAS, and BRAF Mutation Analysis in Professional Institutional

More information

Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient

Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient Cetuximab (Erbitux) Policy Number: Original Effective Date: MM.04.005 05/10/2005 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s)

More information

Targeted Therapy What the Surgeon Needs to Know

Targeted Therapy What the Surgeon Needs to Know Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures

More information

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions

More information

Colorectal cancer xenopatients: A preclinical platform for precision medicine

Colorectal cancer xenopatients: A preclinical platform for precision medicine Colorectal cancer xenopatients: A preclinical platform for precision medicine Livio Trusolino, MD PhD Laboratory of Molecular Pharmacology IRCC, Institute for Cancer Research and Treatment University of

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer

More information

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Médecine de précision médecine personnalisée en Oncologie Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Successful targeted drug development Rapid identification

More information

Nuevas tecnologías basadas en biomarcadores para oncología

Nuevas tecnologías basadas en biomarcadores para oncología Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS

More information

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Rafal Dziadziuszko, MD, PhD University of Colorado Cancer Center, Aurora, CO, USA Medical University of Gdansk, Poland EMEA Workshop on Biomarkers,

More information

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns July 2013 Edition Vol. 7, Issue 7 Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns By Julie Katz, MPH, MPhil Biomarkers played a prominent role in the research presented in

More information

FARMACI PERSONALIZZATI PER

FARMACI PERSONALIZZATI PER ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica FARMACI

More information

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry The American Journal of Surgery (2013) 205, 608-612 North Pacific Surgical Association Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer

More information

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of

More information

WHITE PAPER SEPT 2015

WHITE PAPER SEPT 2015 WHITE PAPER SEPT 2015 LIQUID BIOPSY FOR THE DETECTION AND MONITORING OF CANCER: ANALYSIS OF 96 HOTSPOT MUTATIONS VIA PLASMA DERIVED CIRCULATING TUMOR DNA PATHWAY GENOMICS CANCER AND SOMATIC MUTATIONS The

More information

Targeted Therapies in Lung Cancer

Targeted Therapies in Lung Cancer Targeted Therapies in Lung Cancer I Edited by: Simona Carnio Thoracic Oncology Division - St Luigi Hospital Orbassano (TO) - Italy Silvia Novello Department of Oncology - University of Torino - Italy Why

More information

BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time?

BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? Brooke Phillips, MD, Matthew Kalady, MD, and Richard Kim, MD Dr. Phillips is a fellow in the Department of Oncology at the Taussig

More information

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE Branko Zakotnik MD, PhD Department of Medical Oncology Institute of Oncology Ljubljana 1 I have no conflict of interest to declare

More information

Guideline Development The American Society of Clinical Oncology

Guideline Development The American Society of Clinical Oncology Assessing Genomic Sequencing Information for Health Care Decision Making Decision Making Once Evidence is Assessed/Graded Evaluated Guideline Development The American Society of Clinical Oncology Gary

More information

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials)

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) 3 Integrated Trials Testing Targeted Therapy in Early Stage Lung Cancer Part of NCI s Precision Medicine Effort in

More information

Molecular Diagnosis of Gastrointestinal Tumors

Molecular Diagnosis of Gastrointestinal Tumors Molecular Diagnosis of Gastrointestinal Tumors Zoltan Szentirmay National Institute of Oncology Center of Surgical and Molecular Tumor Pathology EEA and Norwegian Financial Mechanisms in Hungary, Development

More information

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam

More information

Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center

Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Future Directions in Clinical Research Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Outline 1. Status of Cancer Treatment 2. Overview of Clinical Research at UCDCC 3.

More information

Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012

Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 Nuovi Scenari in Oncologia G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 WHAT is cancer? «Cancer is a genetic disease of the somatic cell» [B. Vogelstein] Ten years ago Now [Cell.

More information

Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views

Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Dr. Tilman Schöning Heidelberg University Hospital, Germany Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Conflicts of interest Participation in Advisory Boards Amgen GmbH,

More information

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Vincent A. Miller, M.D. Foundation Medicine, Inc. AACR Annual Meeting 2012 Current Concepts session

More information

El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future

El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future El papel de la anatomía patológica en oncología: presente y futuro The role of pathological anatomy in oncology: present and future Federico Rojo Fundación Jiménez Díaz, Madrid All patients with same diagnosis:

More information

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical

More information

Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress

Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Lung Cancer Accounts for 14% of All New Cancer Diagnoses in the United States 1 Lung cancer is the second most common malignancy

More information

KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date

KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date MP 2.04.43 KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013

More information

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a La diagnostica molecolare nelle neoplasie colo-rettali C-NET A do Scarpa e Dipartime to Pato ogia e U iversita di Vero a La stessa malattia puo avere diverse patogenesi cucchiaio moneta forchetta Gastrointestinal

More information

Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku

Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku 11 th International Congress on Targeted Anticancer Therapies Paris March 4-6, 2013 Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku Investigational Cancer Therapeutics (Phase

More information

Clinical development of AZD9291 in non-small cell lung cancer

Clinical development of AZD9291 in non-small cell lung cancer Clinical development of AZD9291 in non-small cell lung cancer Rachael Lawrance (AstraZeneca) PSI One Day Meeting: The Innovative, Challenging and Diversified World of Respiratory Disease 13 Nov 2015 Overview

More information

Histopathology and prognosis in renal cancer

Histopathology and prognosis in renal cancer Histopathology and prognosis in renal cancer Granular cell Granular cell Granular cell Granular cell Clear cell Chromophobe cell Papillary type 2 Luca Mazzucchelli Istituto cantonale di patologia, Locarno

More information

Cos è EGFR? Epidermal Growth Factor Receptor. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro

Cos è EGFR? Epidermal Growth Factor Receptor. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro Formazione interna Cos è EGFR? Epidermal Growth Factor Receptor Valutazione di EGFR con FISH in varie malattie neoplastiche V. Martin 1-0-008 Recettore transmembrana di tipo TK. Codificato dal gene EGFR,

More information

Maintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai

Maintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Maintenance therapy in in Metastatic NSCLC Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Definition of Maintenance therapy The U.S. National Cancer Institute s

More information

Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC)

Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Policy #: 468 Latest Review Date: October 2015 Category: Laboratory Policy Grade: B Background/Definitions:

More information

Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga. Jorge S Reis-Filho, MD PhD FRCPath

Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga. Jorge S Reis-Filho, MD PhD FRCPath Translating DNA repair pathways into therapeutic targets: beyond the BRCA1/2 and PARP inhibitor saga Jorge S Reis-Filho, MD PhD FRCPath Summary How do PARP inhibitors work? Synthetic lethality Potential

More information

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine

More information

Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART

Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART Goals Discuss treatment options for stage 4 lung cancer: New and old Discuss new developments in personalized

More information

POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS DISCLAIMER CODING INFORMATION REFERENCES POLICY HISTORY

POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS DISCLAIMER CODING INFORMATION REFERENCES POLICY HISTORY Original Issue Date (Created): 9/1/2011 Most Recent Review Date (Revised): 1/27/2015 Effective Date: 11/2/2015 POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS

More information

Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC)

Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Medical Policy Manual Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Section: Genetic Testing Policy No: 56 Date of Origin: August 2010 Last Reviewed Date: December

More information

Mechanism Of Action of Palbociclib & PFS Benefit

Mechanism Of Action of Palbociclib & PFS Benefit A Phase II Randomized Controlled Trial of Palbociclib & Tamoxifen/Fulvestrant in Postmenopausal Women and Men With Hormone-Receptor Positive, HER2- Negative Metastatic Breast Cancer (MBC) Protocol Chair:

More information

Adjuvant Therapy Non Small Cell Lung Cancer. Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015

Adjuvant Therapy Non Small Cell Lung Cancer. Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015 Adjuvant Therapy Non Small Cell Lung Cancer Sunil Nagpal MD Director, Thoracic Oncology Jan 30, 2015 No Disclosures Number of studies Studies Per Month 12 10 8 6 4 2 0 1 2 3 4 5 6 7 8 9 10 11 12 1 2 3

More information

Rilevanza dell innovazione tecnologica per la

Rilevanza dell innovazione tecnologica per la Rilevanza dell innovazione tecnologica per la ricerca traslazionale e la terapia in oncologia Ruggero De Maria Dipartimento di Ematologia Oncologia e Medicina Molecolare, Istituto Superiore di Sanità Translational

More information

EGFR gene mutations Ex 19 Ex 21 Paez et al, Science 2004

EGFR gene mutations Ex 19 Ex 21 Paez et al, Science 2004 Evolution of knowledge in NSCLC Pao and Girard, Lancet Oncology 2011 Fattori da considerare nella scelta terapeutica del NSCLC nel 2012 Stadio di malattia PS Età Comorbidità Compliance e desiderio del

More information

TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC

TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC Dr.ssa Sara Ramella Radioterapia Oncologica Campus Bio-Medico Trimodality therapy offers a promising chance of long-term survival Evidenze

More information

Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing

Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing These Are Hopeful Times for Lung Cancer Survivors When people first learn they have cancer, they are often afraid. But

More information

Innovation: Present Meets Future

Innovation: Present Meets Future Innovation: Present Meets Future SOCIAL INNOVATION Leading Innovation in the Cooperative Group Setting Craig Nichols, M.D. BEST OF SWOG Barlogie-Salmon Myeloma Committee Robert Z. Orlowski, M.D., Ph.D.

More information

REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM

REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM REPORT PERSPECTIVES IN LUNG CANCER 2010 AMSTERDAM Valerie Van Damme, Isabelle Wauters, Johan Vansteenkiste Univ. Hospital Leuven and Leuven Lung Cancer Group Introduction Perspectives in Lung Cancer (PILC)

More information

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Michael B. Atkins, M.D. Deputy Director Georgetown-Lombardi Comprehensive Cancer Center Michael Atkins, MD Consulting Fees (e.g., advisory

More information

Craig Hallum Conference Investor Presentation

Craig Hallum Conference Investor Presentation Craig Hallum Conference Investor Presentation Improving cancer outcomes with groundbreaking precision in molecular testing Paul Kinnon President and CEO Sept 2015 1 Forward-Looking Statements Certain statements

More information

PROSPETTIVE FUTURE NEL TRATTAMENTO. Cinzia Ortega Dipartimento di Oncologia Medica Fondazione del Piemonte per l Oncologia I.R.C.C.S.

PROSPETTIVE FUTURE NEL TRATTAMENTO. Cinzia Ortega Dipartimento di Oncologia Medica Fondazione del Piemonte per l Oncologia I.R.C.C.S. PROSPETTIVE FUTURE NEL TRATTAMENTO MEDICO DEL mrcc Cinzia Ortega Dipartimento di Oncologia Medica Fondazione del Piemonte per l Oncologia I.R.C.C.S. Candiolo Future strategies in mrcc Improve therapeutic

More information

Targeted therapies and brain metastases in lung cancer patients. Benjamin Besse, MD, PhD. Medical Oncologist. 19 septembre 2014

Targeted therapies and brain metastases in lung cancer patients. Benjamin Besse, MD, PhD. Medical Oncologist. 19 septembre 2014 Targeted therapies and brain metastases in lung cancer patients Benjamin Besse, MD, PhD Medical Oncologist 19 septembre 2014 Targeted therapies and brain mets! Brain mets in NSCLC! Specific targeted therapies!

More information

DIPARTIMENTO di SCIENZE BIOMEDICHE e BIOTECNOLOGICHE

DIPARTIMENTO di SCIENZE BIOMEDICHE e BIOTECNOLOGICHE July 15, 2015 Science editor of World Journal of Gastroenterology Jing Yu Email: j.yu@wjgnet.com Dear Prof. Jing Yu, please find enclosed a revised version of our paper Non-coding landscapes of Colorectal

More information

Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D.

Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D. Prognostic and Predictive Factors in Oncology Mustafa Benekli, M.D. NCI Definitions ESMO Course -Essentials of Medical Oncology -Istanbul 2 Prognostic factor: NCI Definition A situation or condition, or

More information

Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma. Claire Vines, 2016 Pharm.D. Candidate

Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma. Claire Vines, 2016 Pharm.D. Candidate + Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma Claire Vines, 2016 Pharm.D. Candidate + Disclosure I have no conflicts of interest to disclose. + Objectives Summarize NCCN

More information

Future Oncology: Technology, Products, Market and Service Opportunities

Future Oncology: Technology, Products, Market and Service Opportunities Brochure More information from http://www.researchandmarkets.com/reports/296370/ Future Oncology: Technology, Products, Market and Service Opportunities Description: Future Oncology is an analytical newsletter

More information

SAMO FoROMe Post-ESMO 2013 Breast Cancer

SAMO FoROMe Post-ESMO 2013 Breast Cancer SAMO FoROMe Post-ESMO 2013 Breast Cancer Dr. med. Manuela Rabaglio Klinik und Poliklinik für Medizinische Onkologie Breast Cancer Track 300 Abstracts 142 Poster 11 Proffered paper 4 late breaking news

More information

Cellular, Molecular, and Biochemical Targets in Breast Cancer

Cellular, Molecular, and Biochemical Targets in Breast Cancer Cellular, Molecular, and Biochemical Targets in Breast Cancer Kristy Kummerow Ingrid Meszoely December 12, 2012 VUMC Resident Bonus Conference One size fits all surgical treatment of breast cancer Wilhelm

More information

Ovarian Cancer and Modern Immunotherapy: Regulatory Strategies for Drug Development

Ovarian Cancer and Modern Immunotherapy: Regulatory Strategies for Drug Development Ovarian Cancer and Modern Immunotherapy: Regulatory Strategies for Drug Development Sanjeeve Bala, MD, MPH Ovarian Cancer Endpoints Workshop FDA White Oak September 3, 2015 Overview Immune agents from

More information

Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi

Cancer SBL101. James Gomes School of Biological Sciences Indian Institute of Technology Delhi Cancer SBL101 James Gomes School of Biological Sciences Indian Institute of Technology Delhi All Figures in this Lecture are taken from 1. Molecular biology of the cell / Bruce Alberts et al., 5th ed.

More information

How can we generate economic value from personalized medicine and big data analysis?

How can we generate economic value from personalized medicine and big data analysis? Estonian Health Innovation Forum 2015 Focus on Personalised Medicine How can we generate economic value from personalized medicine and big data analysis? Jonathan Knowles October 26, 2015 Tallinn, Viru

More information

10 th EADO Congress Vilnius, 7-10 May 2014. Ipilimumab update. Michele Maio

10 th EADO Congress Vilnius, 7-10 May 2014. Ipilimumab update. Michele Maio 10 th EADO Congress Vilnius, 7-10 May 2014 Ipilimumab update Michele Maio Medical Oncology and Immunotherapy, Department of Oncology University Hospital of Siena, Istituto Toscano Tumori SIENA, ITALY Evolving

More information

RICERCA FINALIZZATA+GIOVANI RICERCATORI MALATTIE RARE. Graduatoria e Finanziamento

RICERCA FINALIZZATA+GIOVANI RICERCATORI MALATTIE RARE. Graduatoria e Finanziamento Direzione Generale Ricerca Scientifica e Tecnologica RICERCA FINALIZZATA+GIOVANI RICERCATORI MALATTIE RARE Graduatoria e Finanziamento Ministero della Salute Direzione Generale Ricerca Scientifica e Tecnologica

More information

The following information is only meant for people who have been diagnosed with advanced non-small cell

The following information is only meant for people who have been diagnosed with advanced non-small cell Important information for people with advanced non-small cell lung cancer The following information is only meant for people who have been diagnosed with advanced non-small cell lung cancer (NSCLC). NSCLC

More information

Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics

Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics EPAAC WP8 Research Forum - 2 July, Sofitel Hotel Europe, Brussels Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics JY Blay, Past President EORTC

More information

A NOVEL APPROACH TO DEVELOP PREDICTIVE BIOMARKERS

A NOVEL APPROACH TO DEVELOP PREDICTIVE BIOMARKERS A NOVEL APPROACH TO DEVELOP PREDICTIVE BIOMARKERS Prediction of response to anti-egfr therapy in a large panel of patient-derived colorectal cancer xenograft models Dissertation zur Erlangung des akademischen

More information

BREAST CANCER UPDATE C H R I S S Z Y A R T O, D O G E N E S E E H E M A T O L O G Y O N C O L O G Y F L I N T, M I

BREAST CANCER UPDATE C H R I S S Z Y A R T O, D O G E N E S E E H E M A T O L O G Y O N C O L O G Y F L I N T, M I BREAST CANCER UPDATE C H R I S S Z Y A R T O, D O G E N E S E E H E M A T O L O G Y O N C O L O G Y F L I N T, M I Overview Why is it important to understand breast cancer? Choosing wisely Appropriateness

More information

HER2 Testing in Breast Cancer

HER2 Testing in Breast Cancer HER2 Testing in Breast Cancer GAIL H. VANCE, M.D. AGT MEETING JUNE 13, 2014 LOUISVILLE, KENTUCKY No Conflict of Interest to Report Human Epidermal Growth Factor Receptor 2-HER2 Human epidermal growth factor

More information

NCCN Non-Small Cell Lung Cancer V.1.2011 Update Meeting 07/09/10

NCCN Non-Small Cell Lung Cancer V.1.2011 Update Meeting 07/09/10 Guideline Page and Request NSCL-3 Stage IA, margins positive delete the recommendation for chemoradiation. Stage IB, IIA, margins positive delete the recommendation for chemoradiation + Stage IIA, Stage

More information

MetAction actionable targets in cancer metastasis from bed to bench to byte to bedside

MetAction actionable targets in cancer metastasis from bed to bench to byte to bedside MetAction actionable targets in cancer metastasis from bed to bench to byte to bedside Kjersti Flatmark MD PhD Departments of Tumor Biology and Gastroenterological Surgery, Oslo University Hospital PIs:

More information

targeted therapy a guide for the patient

targeted therapy a guide for the patient targeted therapy FOR LUNG CANCER a guide for the patient TABLE OF CONTENTS lung cancer basics... 2-3 Gene changes... 4-5 Testing... 7-8 Targeted therapy... 9-11 Drugs Targeting EGFR... 12 Drugs Targeting

More information

Metastatic breast cancer represents an incurable condition associated with an average survival time of 18 to 24 months.

Metastatic breast cancer represents an incurable condition associated with an average survival time of 18 to 24 months. TACT-2C Trial A phase II randomized, open-label study evaluating the addiction of trastuzumabto (nabtm)-paclitaxel as first line treatment in primary HER2 negative metastatic breast cancer patients with

More information

Tissue Biomarkers in Oncology Clinical Development The Digital Advantage

Tissue Biomarkers in Oncology Clinical Development The Digital Advantage Tissue Biomarkers in Oncology Clinical Development The Digital Advantage Christopher Ung VP Strategic Business & Operations, Oncology TMD A Quintiles Laboratory 1 The Targeted Therapy Continuum Non-Targeted

More information

AIDS IN IDENTIFYING CANDIDATES FOR HER2-TARGETED THERAPY

AIDS IN IDENTIFYING CANDIDATES FOR HER2-TARGETED THERAPY AIDS IN IDENTIFYING CANDIDATES FOR HER2-TARGETED THERAPY THE HERMARK BREAST CANCER ASSAY HERmark is based on our proprietary VeraTag technology that precisely quantifies HER2 proteins and protein complexes

More information

The EGFR mutation and precision therapy for lung cancer

The EGFR mutation and precision therapy for lung cancer for lung cancer Outcomes in advanced lung cancer have seen meaningful improvement in the past decade thanks to new precision drug therapies. Because tumors usually develop resistance to the drugs, scientists

More information

BioPATH: A Study of Biomarker Profiles in Asia Pacific HER2 Breast Cancer Patients Treated with Lapatinib and Other Anti-HER2 Therapy

BioPATH: A Study of Biomarker Profiles in Asia Pacific HER2 Breast Cancer Patients Treated with Lapatinib and Other Anti-HER2 Therapy BioPATH: A Study of Biomarker Profiles in Asia Pacific HER2 Breast Cancer Patients Treated with Lapatinib and Other Anti-HER2 Therapy Soonmyung Paik 1 ; Gyungyub Gong 2 ; Yap Yoon Sim 3 ; Tae- You Kim

More information

Biomarker Trends in Breast Cancer Research

Biomarker Trends in Breast Cancer Research WHITE PAPER Biomarker Trends in Breast Cancer Research Jason Hill, PhD, Associate Director, External Science Affairs, Quintiles Quintiles examines the novel drug combinations and mechanisms of action that

More information

A disease of populations of cells that live, divide, invade and spread without regard to normal limits

A disease of populations of cells that live, divide, invade and spread without regard to normal limits 1 Targeted Cancer Therapies Mark McKeage Medical Oncology Specialist Professor in Clinical Pharmacology 2 Cancer Definition- A disease of populations of cells that live, divide, invade and spread without

More information

Miquel Àngel Seguí Palmer

Miquel Àngel Seguí Palmer Miquel Àngel Seguí Palmer HER2+ Breast Cancer is characterized by overexpression of HER2 receptors HER2+ Breast Cancer is characterized by overexpression of HER2 receptors HER2+ status is associated with

More information

Welcome to the Launch of Biocon s Breakthrough Innovation. For Psoriasis. Treatment

Welcome to the Launch of Biocon s Breakthrough Innovation. For Psoriasis. Treatment Welcome to the Launch of Biocon s Breakthrough Innovation For Psoriasis Treatment PRESS MEET Bangalore, August 10, 2013 Autoimmune Diseases are on the Rise Globally Autoimmune Disease Segment includes

More information

Clinical Trial Designs for Incorporating Multiple Biomarkers in Combination Studies with Targeted Agents

Clinical Trial Designs for Incorporating Multiple Biomarkers in Combination Studies with Targeted Agents Clinical Trial Designs for Incorporating Multiple Biomarkers in Combination Studies with Targeted Agents J. Jack Lee, Ph.D. Department of Biostatistics 3 Primary Goals for Clinical Trials Test safety and

More information

Brigham and Women s Hospital, Boston, MA, USA; 2 Verastem, Inc., Boston, MA, USA

Brigham and Women s Hospital, Boston, MA, USA; 2 Verastem, Inc., Boston, MA, USA Determination of Biomarker Response in a Phase II Window of Opportunity Study of Defactinib (VS 6063), a Focal Adhesion Kinase (FAK) Inhibitor, in Patients with Resectable Malignant Pleural Mesothelioma

More information

Humanity s fight against cancer has always been

Humanity s fight against cancer has always been 10 this time, it s Personal In what is an exciting era in the evolution of oncology treatment, this special feature by Deborah J. Ausman explores how Next-Generation Sequencing and Convergent Informatics

More information

Evaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models

Evaluation of the role of gene polymorphisms in anticancer drug efficacy using in vitro models Group members and Contact details Jacques Robert graduated in medicine from the University of Strasbourg in 1974 and received hi Research projects: The objectives of our group are: (1) to identify preclinical

More information

PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO. Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA.

PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO. Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA. PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA. Carcinoma de Endometrio Cáncer de Ovario Endometrial carcinoma

More information

CLINICAL POLICY Department: Medical Management Document Name: Opdivo Reference Number: CP.PHAR.121 Effective Date: 07/15

CLINICAL POLICY Department: Medical Management Document Name: Opdivo Reference Number: CP.PHAR.121 Effective Date: 07/15 Page: 1 of 6 IMPORTANT REMINDER This Clinical Policy has been developed by appropriately experienced and licensed health care professionals based on a thorough review and consideration of generally accepted

More information

Ruolo del K-ras come fattore predittivo di Risposta ad anticorpi anti-egfr nel carcinoma del colon retto

Ruolo del K-ras come fattore predittivo di Risposta ad anticorpi anti-egfr nel carcinoma del colon retto Ruolo del K-ras come fattore predittivo di Risposta ad anticorpi anti-egfr nel carcinoma del colon retto Antonio Marchetti Pathology and Oncogenetic Unit, Center of Excellence on Aging University-Foundation

More information

Trials in Elderly Melanoma Patients (with a focus on immunotherapy)

Trials in Elderly Melanoma Patients (with a focus on immunotherapy) Trials in Elderly Melanoma Patients (with a focus on immunotherapy) Where we were Immunotherapy Trials: past and present Relevance for real world practice Where we are SIOG October 2012 James Larkin FRCP

More information

Cambia l algoritmo terapeutico

Cambia l algoritmo terapeutico X Seminario I.T.M.O. Neoplasie a bassa incidenza Istituto di Oncologia Policlinico di Monza Monza 07 Maggio2012? Cambia l algoritmo terapeutico Michele Maio Medical Oncology and Immunotherapy, Department

More information

Evaluation and Validation of Diagnostic Tests for Guiding Therapeutic Decisions

Evaluation and Validation of Diagnostic Tests for Guiding Therapeutic Decisions METHODOLOGY Thérapie 2009 Mai-Juin; 64 (3): 195 201 DOI: 10.2515/therapie/2009028 c 2009 Société Française de Pharmacologie et de Thérapeutique Evaluation and Validation of Diagnostic Tests for Guiding

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Ado-Trastuzumab Emtansine (Trastuzumab-DM1) for Treatment of File Name: Origination: Last CAP Review: Next CAP Review: Last Review: ado_trastuzumab_emtansine_(trastuzumab-dm1)_for_treatment_of_her-2_positivemalignancies

More information

Pancreatic Cancer: FDA Approved Treatments and Clinical Trials

Pancreatic Cancer: FDA Approved Treatments and Clinical Trials Pancreatic Cancer: FDA Approved Treatments and Clinical Trials Vincent J Picozzi MD MMM Virginia Mason Medical Center Seattle WA 1 Pancreatic cancer is the hardest cancer of all to treat 2 Pancreatic cancer:

More information

Understanding series. new. directions. 1-800-298-2436 LungCancerAlliance.org. A guide for the patient

Understanding series. new. directions. 1-800-298-2436 LungCancerAlliance.org. A guide for the patient Understanding series LUNG CANCER: new treatment directions 1-800-298-2436 LungCancerAlliance.org A guide for the patient TABLE OF CONTENTS What s New in lung cancer? Advancements...4 Changes in genes that

More information

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function: Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic

More information

Molecular Diagnostics in Thyroid Cancer

Molecular Diagnostics in Thyroid Cancer Disclosure Nothing to disclose Jonathan George, MD, MPH Assistant Professor Head and Neck Oncologic & Endocrine Surgery Molecular Diagnostics in Thyroid Cancer Current Practices & Future Trends UCSF Medical

More information