1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?

Size: px
Start display at page:

Download "1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?"

Transcription

1 EGFR downstream pathways KRAS domande frequenti ed importanti. Luca Mazzucchelli Istituto cantonale di patologia Locarno )'"* )-# %& # +%,!"# '( "#$ Anti-EGFR monoclonal antibodies (MoAbs) Cetuximab and Panitumumab recognize the extracellular domain of EGFR, lead to receptor internalization and degradation, and therefore block EGFR and its downstream cascade activation. Inhibition of cell proliferation, invasion, metastasis and neoangiogenesis 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? Ciardiello et al, N Engl J Med 2008 Ciardiello et al, N Engl J Med 2008,/ #,/ # &114) &114)11 1

2 # 0. Genotypic classification of CRCs by K-Ras status Wild Type Mutated Study Patients KRAS mutations Moroni et al Di Fiore et al Frattini et al Benvenuti et al Khambata-Ford et al Karapetis et al Lievre et al De Roock et al Amado et al Van Cutsem et al Bokemeyer et al !. % 444% 6 44'4'' * #. ; % 9 72.$ 2. %09 7. )$5 % '4%',& 3$%< 557;08 "# "4, "# "4, 1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico? KRAS G13D mutation (8%) has no effect on EGFR targeted therapies KRAS codon 61 (2%) induces resistence to anti-egfr therapies (Lancet Oncology 2010) 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? 2

3 #%<. 2"4,!%9 Study Patients KRAS mutations? $?57)$%%)5 Wild Type Mutated Method Moroni et al Sequencing Di Fiore et al Sequencing Frattini et al Sequencing Benvenuti et al Sequencing Khambata-Ford et al Sequencing Karapetis et al Sequencing Lievre et al Allele-specific PCR De Roock et al Allele-specific PCR Amado et al Allele-specific PCR Van Cutsem et al Melt-curve analysis Bokemeyer et al Melt-curve analysis Sensitivity (mut/wt; %) !"'A(><0#%<. 9.!") Sensitivity of 0.01% ttggagctggtggcgtaggca wt sequence K-Ras cod 12 5' 3' ttggagctgatgacgtaggca mutated sequence ttggacctggtggcgtaggca wt sequence Mismatched primers introduce a BstNI (in red, for cod 12) or BglI (for cod 13) restriction sites 1 PCR 5' ttggagctgatgacgtaggca 3' The presence of KRAS12 or 13 mutation prevent the formation of mutated sequence BstNI or BglI restriction sites High sensitive KRAS mutation detection methods, such as ME-PCR (sensitivity of 0.01%), have never been used for the assessment of KRAS predictive role 1 DIGESTION 2 PCR 2 DIGESTION 1 digestion with BstNI or BglI restriction enzymes 2 PCR with mismatched primers 2 digestion with BstNI or BglI restriction enzymes 3% poliacrillamide gel electrophoresis and sequencing RESULTS KRAS mutations by ME-PCR 32 mcrc patients wild-type for KRAS and BRAF as detected by DS RESULTS KRAS analysis by ME-PCR in primary tumor and metastasis KRAS wt mut 25/32 (78%) 7/32 (22%) Responders 11 0 Non responders 14 7 PRIMARY TUMOUR METASTASIS DS ME-PCR 1 PT colon WT G12D M lung G12D G12D M brain G12D G12D 2 PT colon WT G12V M LN G12V G12V Anti-EGFR therapy MUT 2. Il metodo utilizzato per determinare la presenza di mutazione di KRAS ha importanza clinica? WT Tumor progression MUT WT ME-PCR seems to increase the detection rate of NR patients Additional prospective studies, and cost-benefit analyses are needed to clarify this issue In primary tumor there could be KRAS mutated minor clones KRAS mutated minor clones detected only by ME-PCR in primary tumor may acquire relevance in the metastatic process 3

4 > Primary tumor Metastasis Patient 1 KRAS wt KRAS mut 3. Bisogna analizzare il tumore primitivo o le metastasi? Patient 2 Primary tumor KRAS mut Metastasis KRAS wt ). 0 9 ( B $-?$55 D D$"?$55 C 9$?)$ "4 $ $; ; 1 1 1; 3. Bisogna analizzare il tumore primitivo o le metastasi?!$+?$5 %$?($; ; Perform KRAS testing on metastais/recidive, if possible %! $?)$55; '$?($ Pre-treatment Small biopsy Biopsy not always available Not representative of the entire tumour specimen Post-treatment Chemoradiation could alterate the tumor molecular profile Few tumoral cells 4. Prima o dopo terapia neoadiuvante? 4

5 AIM To compare KRAS gene status between pre and post-treatment specimens of LARC patients by using two techniques with different sensitivity (direct sequencing and ME-PCR) RESULTS KRAS mutations #%< / KRAS mutations Patients and methods 61 patients with LARC treated with Neo-Adjuvant Chemo-Radiation were analyzed for KRAS mutations by direct sequencing and ME-PCR Direct sequencing ME-PCR Pre-treated biopsies 24/61 (39%) 28/61 (46%) Post-treated specimens 13/61 (21%) 24/61 (39%) Prima o dopo terapia neoadiuvante? The use of high sensitive techniques enhances the detection of KRAS mutations in pts with LARC treated with NCRT 5. Should we test for BRAF? On pre-treatment biopsy, direct sequencing can be routinely used while post-treated specimens must be investigated only by means of high sensitive methodologies "4,!%9 113 patients with metastatic CRC treated with Cetuximab or Panitumumab 79 patients mut KRAS 34/113 (30%) mut BRAF 11/79 (14%) +%,68" 68 patients '+%,68" 9 9 5

6 +%, <9. 9 +%,68" 9<9.. ASCO 2010, Abstract Should we test for BRAF? BRAF is an adverse prognostic factor Patients with BRAF mutations may benefit from other target therapies BRAFmutation is significantly associated with a low response rate 6. So what? To date, KRAS is the only validated biomarker predictive of efficacy of anti-egfr agents; use of all other biomarkers is promising but still at a preliminary stage Quadruple negative patients Lancet Oncology 2010 (Sartore Bianchi et al, PLOS-One 2009) 6

7 Objective response Disease control Progression free survival 6. So what? Overall survival BRAF, NRAS PIK3CA ex 20 are significantly associated with a low response rate Objective response rates could be improved by additional genotyping of BRAF, NRAS, PIk3C ex 20 in KRAS wt population Istitutto cantonale di patologia, Locarno IOSI, Bellinzona Collaborazioni Candiolo, Milano, Basilea Milo Frattini Vittoria Martin Elena Zanellato Martina Nucifora Alice Riva Davide Romanelli Sara Banfi Antonella Camponovo Morena Ghisletta Paola Galli 7

!! "# - ' - ) * $ ( ISTITUTO TUMORI MILANO

!! # - ' - ) * $ ( ISTITUTO TUMORI MILANO "!! "# "#'( "# " ) * +, +, - ' - ( STTUTO TUMOR MLANO 1 " "!"# #./01- - -( # * ' ( ' ( ) ' +, #--!. * ) #!"# #!"# STTUTO TUMOR MLANO!"# ' *+*+++,"--!. * ' ( 1 ## ) -!/!00 STTUTO TUMOR MLANO #582#32:5825#24)592

More information

Advances in Understanding EGFR Resistance Pathways

Advances in Understanding EGFR Resistance Pathways Advances in Understanding EGFR Resistance Pathways Philip C. Mack, PhD Assistant Adjunct Professor UC Davis Cancer Center Resistance to EGFR Inhibitors Primary vs Secondary Primary: best response = progressive

More information

DENOMINATOR: Adult patients with metastatic colorectal cancer who receive anti-egfr monoclonal antibody therapy

DENOMINATOR: Adult patients with metastatic colorectal cancer who receive anti-egfr monoclonal antibody therapy Measure #451 (NQF 1859): KRAS Gene Mutation Testing Performed for Patients with Metastatic Colorectal Cancer who receive Anti-epidermal Growth Factor Receptor (EGFR) Monoclonal Antibody Therapy National

More information

Come è cambiata la storia naturale della malattia

Come è cambiata la storia naturale della malattia Malattia Metastatica del Carcinoma del Grosso Intestino Tecniche e terapie Innovative Come è cambiata la storia naturale della malattia Antonio Frassoldati Oncologia Clinica - Ferrara 29 ottobre 2011 Colorectal

More information

quali sottogruppi biologici di elezione?

quali sottogruppi biologici di elezione? Roma, 10 maggio 2013 Meccanismi molecolari di resistenza alle terapie anti-egfr nella neoplasia colorettale metastatica: quali sottogruppi biologici di elezione? Andrea Sartore Bianchi Oncologia Clinica

More information

KRAS Sequence Variant Analysis for Metastatic Colorectal Cancer

KRAS Sequence Variant Analysis for Metastatic Colorectal Cancer Easy Choice Health Plan, Inc. Harmony Health Plan of Illinois, Inc. M issouri Care, Inc. Ohana Health Plan, a plan offered by WellCare Health Insurance of Arizona, Inc. WellCare Health Insurance of Illinois,

More information

Overall survival in metasta0c colorectal cancer and cost of treament

Overall survival in metasta0c colorectal cancer and cost of treament Overall survival in metasta0c colorectal cancer and cost of treament months 20 ~ 24 $ (8 weeks of treatment) 6-8 12-14 BSC 5FU FOLFOX FOLFIRI FOLFOX/ FOLFIRI + cetuximab- bevacizumab Mayo Clinic LV5FU2

More information

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Medical Policy An independent licensee of the Blue Cross Blue Shield Association KRAS, NRAS, and BRAF Mutation Analysis in Page 1 of 17 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: KRAS, NRAS, and BRAF Mutation Analysis in Professional Institutional

More information

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America

Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions

More information

Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient

Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient Cetuximab (Erbitux) Policy Number: Original Effective Date: MM.04.005 05/10/2005 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s)

More information

Targeted Therapy What the Surgeon Needs to Know

Targeted Therapy What the Surgeon Needs to Know Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures

More information

Colorectal cancer xenopatients: A preclinical platform for precision medicine

Colorectal cancer xenopatients: A preclinical platform for precision medicine Colorectal cancer xenopatients: A preclinical platform for precision medicine Livio Trusolino, MD PhD Laboratory of Molecular Pharmacology IRCC, Institute for Cancer Research and Treatment University of

More information

NRAS-BRAF-EGFR S492R Mutation Assay

NRAS-BRAF-EGFR S492R Mutation Assay Simple, rapid, highly sensitive diagnostics at hand NRAS 3 Idylla NRAS-BRAF-EGFR S492R Mutation Assay NRAS-BRAF-EGFR S492R Outstanding ease of use Less than 2 minutes hands-on time About 50% of all metastatic

More information

RAS mutation testing policy

RAS mutation testing policy RAS mutation testing policy Greater Manchester Cancer Services Colorectal Cancer Pathway Board and Clinical Subgroup Start date: June 2014 Review date: May 2017 RAS mutation testing Background In metastatic

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer

More information

Benjamin Legendre, Jr. PhD Vice President, Laboratory Operations. Overview:

Benjamin Legendre, Jr. PhD Vice President, Laboratory Operations. Overview: Simple and effective clinical testing protocol using ICE COLD- PCR across targeted cancer gene panels using the Veriti Thermal Cycler & Sanger Sequencing Benjamin Legendre, Jr. PhD Vice President, Laboratory

More information

RAS mutation testing policy

RAS mutation testing policy RAS mutation testing policy Greater Manchester Cancer Services Colorectal Cancer Pathway Board and Clinical Subgroup Start date: June 2014 Review date: May 2017 RAS mutation testing Background In metastatic

More information

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Medical Policy An independent licensee of the Blue Cross Blue Shield Association KRAS, NRAS, and BRAF Mutation Analysis in Page 1 of 20 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: KRAS, NRAS, and BRAF Mutation Analysis in Metastatic Colorectal

More information

Oncology Solutions with the MassARRAY System

Oncology Solutions with the MassARRAY System ARRAY Dx One Platform from DNA to Results with the ARRAY System ARRAY Dx is a CE-IVD marked genetic analysis system that enables reliable multiplexed detection of clinically relevant mutations as low as

More information

Evaluating the Evidence for Clinical Utility

Evaluating the Evidence for Clinical Utility A Blue Cross and Blue Shield Association Presentation Evaluating the Evidence for Clinical Utility Margaret Piper, PhD, MPH Director, Genomics Resources Technology Evaluation Center Institute of Medicine

More information

Targeted Chemotherapy: Guiding patients to more personalized care

Targeted Chemotherapy: Guiding patients to more personalized care Targeted Chemotherapy: Guiding patients to more personalized care Anna Hitron, Pharm.D, MS, MBA, BCOP Oncology Pharmacy Specialist Baptist Health Louisville September 10, 2015 Objectives Discuss the role

More information

HER2 and lung cancer. Molecular events in lung cancer

HER2 and lung cancer. Molecular events in lung cancer HER2 and lung cancer Federico Cappuzzo scano Tumori Ospedale Civile Liv Unknown Squamous Cell Carcinoma Molecular events in lung cancer FGFR Amplification Others FGFR Mutation DDR2 PIK3CA Unknown BRAF

More information

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns

Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns July 2013 Edition Vol. 7, Issue 7 Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns By Julie Katz, MPH, MPhil Biomarkers played a prominent role in the research presented in

More information

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer

Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Rafal Dziadziuszko, MD, PhD University of Colorado Cancer Center, Aurora, CO, USA Medical University of Gdansk, Poland EMEA Workshop on Biomarkers,

More information

Nuevas tecnologías basadas en biomarcadores para oncología

Nuevas tecnologías basadas en biomarcadores para oncología Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS

More information

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN

Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Médecine de précision médecine personnalisée en Oncologie Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Successful targeted drug development Rapid identification

More information

Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment

Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment Helping you understand the importance of Predictive RAS Biomarkers in Colorectal Cancer Treatment Aims of this leaflet This leaflet has been written to help you understand your medicine options after being

More information

Obiettivo Sopravvivenza: l importanza della

Obiettivo Sopravvivenza: l importanza della Multidisciplinarietà e Biologia Molecolare applicate alla Pratica Clinica Oncologica: Un opportunità e un Vantaggio per Tutti Obiettivo Sopravvivenza: l importanza della Scelta Terapeutica di Prima Linea

More information

KRAS Mutation in Colon Cancer: A Marker of Resistance to EGFR-I Therapy

KRAS Mutation in Colon Cancer: A Marker of Resistance to EGFR-I Therapy Ann Surg Oncol (2010) 17:1168 1176 DOI 10.1245/s10434-009-0811-z ORIGINAL ARTICLE TRANSLATIONAL RESEARCH AND BIOMARKERS KRAS Mutation in Colon Cancer: A Marker of Resistance to EGFR-I Therapy Ahmad D.

More information

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry

Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry The American Journal of Surgery (2013) 205, 608-612 North Pacific Surgical Association Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer

More information

J Clin Oncol 29: by American Society of Clinical Oncology INTRODUCTION

J Clin Oncol 29: by American Society of Clinical Oncology INTRODUCTION VOLUME 29 NUMBER 15 MAY 20 2011 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T From the University Hospital Gasthuisberg, Leuven, Belgium; Klinikum Oldenburg, Oldenburg; University Hospital Carl

More information

FARMACI PERSONALIZZATI PER

FARMACI PERSONALIZZATI PER ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica FARMACI

More information

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle

Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of

More information

WHITE PAPER SEPT 2015

WHITE PAPER SEPT 2015 WHITE PAPER SEPT 2015 LIQUID BIOPSY FOR THE DETECTION AND MONITORING OF CANCER: ANALYSIS OF 96 HOTSPOT MUTATIONS VIA PLASMA DERIVED CIRCULATING TUMOR DNA PATHWAY GENOMICS CANCER AND SOMATIC MUTATIONS The

More information

BRAF gene mutation analysis

BRAF gene mutation analysis BRAF gene mutation analysis BRAF gene encodes a serine/threonine kinase that functions within the Ras-Raf- MEK-MAPK pathway, which connects extracellular signals to transcriptional regulation. Activating

More information

Alan Rosenberg, MD VP Medical Policy, Technology Assessment and Credentialing WellPoint, Inc. 233 S. Wacker Drive, Suite 3900 Chicago, IL 60606

Alan Rosenberg, MD VP Medical Policy, Technology Assessment and Credentialing WellPoint, Inc. 233 S. Wacker Drive, Suite 3900 Chicago, IL 60606 March 15, 2011 Alan Rosenberg, MD VP Medical Policy, Technology Assessment and Credentialing WellPoint, Inc. 233 S. Wacker Drive, Suite 3900 Chicago, IL 60606 Dear Dr. Rosenberg, The American Gastroenterological

More information

Molecular Profiling. Molecular Pathology of Lung Cancer. Lung Cancer Biomarkers. Mutations in Lung Cancer 5/28/2011

Molecular Profiling. Molecular Pathology of Lung Cancer. Lung Cancer Biomarkers. Mutations in Lung Cancer 5/28/2011 Molecular Pathology of Lung Cancer Molecular Profiling Emergence of personalized treatment HER2 receptor-directed therapy in breast cancer with HER2 amplification Recent discovery of genetic alterations

More information

Melanoma Central Nervous System Metastases

Melanoma Central Nervous System Metastases Melanoma Central Nervous System Metastases Current Approaches, Challenges and Opportunities In December, 2015, the Melanoma Research Foundation convened a major scientific meeting to address the issue

More information

Colorectal Cancer Molecular Diagnostics

Colorectal Cancer Molecular Diagnostics Colorectal Cancer Molecular Diagnostics Mary P. Bronner, M.D. Division Chief of Anatomic and Molecular Oncologic Pathology Molecular CRC Testing MSI, MMR IHC KRAS BRAF PIK3CA PTEN APC, SMAD4, BMPRIA,STK11

More information

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE

GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE Branko Zakotnik MD, PhD Department of Medical Oncology Institute of Oncology Ljubljana 1 I have no conflict of interest to declare

More information

How Will Genomics Change Our Practice? Paula Trahan Rieger RN, MSN, CAE, FAAN CEO, Oncology Nursing Society

How Will Genomics Change Our Practice? Paula Trahan Rieger RN, MSN, CAE, FAAN CEO, Oncology Nursing Society How Will Genomics Change Our Practice? Paula Trahan Rieger RN, MSN, CAE, FAAN CEO, Oncology Nursing Society Objectives Name two possibilities for using information obtained through molecular profiling

More information

Molecular Diagnostics and Targeted Therapeutics in the Management of Colorectal Cancer

Molecular Diagnostics and Targeted Therapeutics in the Management of Colorectal Cancer Molecular Diagnostics and Targeted Therapeutics in the Management of Colorectal Cancer Jason A. Zell, DO, MPH Division of Hematology/Oncology Dept. of Medicine, & Dept. of Epidemiology, University of California

More information

Targeted Therapies in Lung Cancer

Targeted Therapies in Lung Cancer Targeted Therapies in Lung Cancer I Edited by: Simona Carnio Thoracic Oncology Division - St Luigi Hospital Orbassano (TO) - Italy Silvia Novello Department of Oncology - University of Torino - Italy Why

More information

Circulating Tumor DNA

Circulating Tumor DNA Circulating Tumor DNA Matthias Holdhoff, MD, PhD Assistant Professor of Oncology Johns Hopkins University National Cancer Policy Workshop Institute of Medicine November 10, 2014 Conflict of Interest No

More information

Molecular Diagnosis of Gastrointestinal Tumors

Molecular Diagnosis of Gastrointestinal Tumors Molecular Diagnosis of Gastrointestinal Tumors Zoltan Szentirmay National Institute of Oncology Center of Surgical and Molecular Tumor Pathology EEA and Norwegian Financial Mechanisms in Hungary, Development

More information

COLD-PCR: Very High Sensitivity Mutation Detection

COLD-PCR: Very High Sensitivity Mutation Detection COLD-PCR: Very High Sensitivity Mutation Detection New and Developing Technologies for Genetic Diagnostics Salisbury July 2010 Detection of Somatic Mutations 50% Mutant 10% Mutant 5% Mutant 2% Mutant 1%

More information

Published Ahead of Print on November 10, 2008 as /JCO J Clin Oncol by American Society of Clinical Oncology

Published Ahead of Print on November 10, 2008 as /JCO J Clin Oncol by American Society of Clinical Oncology Published Ahead of Print on November, 8 as.1/jco.8.18.786 The latest version is at http://jco.ascopubs.org/cgi/doi/.1/jco.8.18.786 JOURNAL OF CLINICAL ONCOLOGY O R I G I N A L R E P O R T Is Required for

More information

Immuno-Oncology: Harnessing the Oncologist That Lies Within A Patient s Immune System

Immuno-Oncology: Harnessing the Oncologist That Lies Within A Patient s Immune System Immuno-Oncology: Harnessing the Oncologist That Lies Within A Patient s Immune System Kevin P. Hubbard, DO, FACOI Interim Chair - Department of Specialty Medicine Professor and Chair - Division of Internal

More information

Guideline Development The American Society of Clinical Oncology

Guideline Development The American Society of Clinical Oncology Assessing Genomic Sequencing Information for Health Care Decision Making Decision Making Once Evidence is Assessed/Graded Evaluated Guideline Development The American Society of Clinical Oncology Gary

More information

Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views

Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Dr. Tilman Schöning Heidelberg University Hospital, Germany Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Conflicts of interest Participation in Advisory Boards Amgen GmbH,

More information

Immune Therapy / Targeted Therapy in HNSCC

Immune Therapy / Targeted Therapy in HNSCC Systemic Therapy: Chemotherapy Immune Therapy / Targeted Therapy in HNSCC Immunotherapy Alain Algazi, MD Assistant Clinical Professor UCSF Melanoma & Head and Neck Oncology Targeted therapy alain.algazi@ucsf.edu

More information

Click to edit Master title style

Click to edit Master title style O ral Cancer - so much research, Click to edit Master title style so little progress-why? Click to edit Master text styles Second Level Christopher Squier Third Level Department of O ral Pathology Fourth

More information

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials)

ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) ALCHEMIST (Adjuvant Lung Cancer Enrichment Marker Identification and Sequencing Trials) 3 Integrated Trials Testing Targeted Therapy in Early Stage Lung Cancer Part of NCI s Precision Medicine Effort in

More information

Cancer Treatment Reviews

Cancer Treatment Reviews Cancer Treatment Reviews 35 (2009) 262 271 Contents lists available at ScienceDirect Cancer Treatment Reviews journal homepage: www.elsevierhealth.com/journals/ctrv ANTI-TUMOUR TREATMENT Clinical relevance

More information

NCCN Non Small Cell Lung Cancer V Meeting July 18, 2014

NCCN Non Small Cell Lung Cancer V Meeting July 18, 2014 External request: Consider a position statement of the Fleischner Society, an international, multidisciplinary medical society for thoracic radiology, which makes its own recommendations for the follow

More information

Validation of Blood Testing for K-ras Mutations in Colorectal and Pancreatic Cancer

Validation of Blood Testing for K-ras Mutations in Colorectal and Pancreatic Cancer Short Review Validation of Blood Testing for K-ras Mutations in Colorectal and Pancreatic Cancer MOSHE ROGOSNITZKY 1 and RACHEL DANKS 2 1 MedInsight Research Institute, Telz Stone, Israel; 2 MedInsight

More information

El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future

El papel de la anatomía patológica en oncología: presente y futuro. The role of pathological anatomy in oncology: present and future El papel de la anatomía patológica en oncología: presente y futuro The role of pathological anatomy in oncology: present and future Federico Rojo Fundación Jiménez Díaz, Madrid All patients with same diagnosis:

More information

BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time?

BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? Brooke Phillips, MD, Matthew Kalady, MD, and Richard Kim, MD Dr. Phillips is a fellow in the Department of Oncology at the Taussig

More information

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities

Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Vincent A. Miller, M.D. Foundation Medicine, Inc. AACR Annual Meeting 2012 Current Concepts session

More information

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk

Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam

More information

Molecular Pathology: Targets and Methods. Prof. Dr. Joachim Diebold

Molecular Pathology: Targets and Methods. Prof. Dr. Joachim Diebold Molecular Pathology: Targets and Methods Prof. Dr. Joachim Diebold Molekularpathologie Molecular pathology: Targets and methods Protein DNA Fluorescence in-situ hybridization (FISH) Polymerase chain reaction

More information

Distribution of KRAS and BRAF Mutations in Metastatic Colorectal Cancers in Turkish Patients

Distribution of KRAS and BRAF Mutations in Metastatic Colorectal Cancers in Turkish Patients DOI:http://dx.doi.org/10.7314/APJCP.2016.17.3.1175 RESEARCH ARTICLE Distribution of KRAS and BRAF Mutations in Metastatic Colorectal Cancers in Turkish Patients Orhan Gorukmez 1, Tahsin Yakut 2 *, Ozlem

More information

Mechanism Of Action of Palbociclib & PFS Benefit

Mechanism Of Action of Palbociclib & PFS Benefit A Phase II Randomized Controlled Trial of Palbociclib & Tamoxifen/Fulvestrant in Postmenopausal Women and Men With Hormone-Receptor Positive, HER2- Negative Metastatic Breast Cancer (MBC) Protocol Chair:

More information

Spitz nevus. Spiz nevus

Spitz nevus. Spiz nevus FISH in Spitz Nävi. Ein ungelöstes Problem L. Mazzucchelli Istituto cantonale di patologia, Locarno, Schweiz 5. FISH-Anwenderforum 211, Wiesbaden-Delkenheim Until the late 194s, Spitz nevus was commonly

More information

Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC)

Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Policy #: 468 Latest Review Date: October 2015 Category: Laboratory Policy Grade: B Background/Definitions:

More information

Personalized treatment for breast cancer patients. Fabrice ANDRÉ Institut Gustave Roussy Villejuif, France

Personalized treatment for breast cancer patients. Fabrice ANDRÉ Institut Gustave Roussy Villejuif, France Personalized treatment for breast cancer patients Fabrice ANDRÉ Institut Gustave Roussy Villejuif, France Outline Who is cured WITHOUT adjuvant chemotherapy? Mammaprint Oncotype DX Immunohistochemistry

More information

KRAS wild-type state predicts survival and is associated to early radiological response in metastatic colorectal cancer treated with cetuximab

KRAS wild-type state predicts survival and is associated to early radiological response in metastatic colorectal cancer treated with cetuximab original article Annals of Oncology 19: 508 515, 2008 doi:10.1093/annonc/mdm496 Published online 12 November 2007 KRAS wild-type state predicts survival and is associated to early radiological response

More information

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger

White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical

More information

ONCOLOGY QUALITY IMPROVEMENT COLLABORATIVE MCKESSON SPECIALTY HEALTH THE US ONCOLOGY NETWORK

ONCOLOGY QUALITY IMPROVEMENT COLLABORATIVE MCKESSON SPECIALTY HEALTH THE US ONCOLOGY NETWORK ONCOLOGY QUALITY IMPROVEMENT COLLABORATIVE MCKESSON SPECIALTY HEALTH THE US ONCOLOGY NETWORK QUALITY IN HEALTH CARE ADVISORY GROUP, LLC (QHC ADVISORY GROUP) CECITY Non-PQRS Narrative Measure Specifications

More information

KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date

KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date MP 2.04.43 KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013

More information

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer

Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer Effects of Herceptin on circulating tumor cells in HER2 positive early breast cancer J.-L. Zhang, Q. Yao, J.-H. Chen,Y. Wang, H. Wang, Q. Fan, R. Ling, J. Yi and L. Wang Xijing Hospital Vascular Endocrine

More information

The following information is only meant for people who have been diagnosed with advanced non-small cell

The following information is only meant for people who have been diagnosed with advanced non-small cell Important information for people with advanced non-small cell lung cancer The following information is only meant for people who have been diagnosed with advanced non-small cell lung cancer (NSCLC). NSCLC

More information

Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center

Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Future Directions in Clinical Research Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Outline 1. Status of Cancer Treatment 2. Overview of Clinical Research at UCDCC 3.

More information

Empowering Personalized Therapy Decisions for Your Patient

Empowering Personalized Therapy Decisions for Your Patient Empowering Personalized Therapy Decisions for Your Patient Colorectal Carcinoma StrandAdvantage Tissue-Specific Genomic Test for Cancer Colorectal tissue-specific genomic test for standard-of-care therapy

More information

Vittoria Martin, Antonella Camponovo, Morena Ghisletta, Massimo Bongiovanni, and Luca Mazzucchelli

Vittoria Martin, Antonella Camponovo, Morena Ghisletta, Massimo Bongiovanni, and Luca Mazzucchelli Hindawi Publishing Corporation Pathology Research International Volume 2012, Article ID 261857, 5 pages doi:10.1155/2012/261857 Clinical Study Internal Quality Assurance Program for ERBB2 (HER2) Testing

More information

The role of K-RAS and B-RAF mutations as biomarkers in metastatic colorectal cancer

The role of K-RAS and B-RAF mutations as biomarkers in metastatic colorectal cancer J BUON 2013; 18(1): 116-123 ISSN: 1107-0625 www.bu-on.org/jbuon E-mail: jbuon@ath.forthnet.gr ORIGINAL ARTICLE The role of K-RAS and B-RAF mutations as biomarkers in metastatic colorectal cancer F. Selcukbiricik

More information

Maintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai

Maintenance therapy in in Metastatic NSCLC. Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Maintenance therapy in in Metastatic NSCLC Dr Amit Joshi Associate Professor Dept. Of Medical Oncology Tata Memorial Centre Mumbai Definition of Maintenance therapy The U.S. National Cancer Institute s

More information

Clinical development of AZD9291 in non-small cell lung cancer

Clinical development of AZD9291 in non-small cell lung cancer Clinical development of AZD9291 in non-small cell lung cancer Rachael Lawrance (AstraZeneca) PSI One Day Meeting: The Innovative, Challenging and Diversified World of Respiratory Disease 13 Nov 2015 Overview

More information

Anti-Epidermal Growth Factor Receptor Monoclonal Antibodies in Metastatic Colorectal Cancer Biotherapy: A Systematic Review

Anti-Epidermal Growth Factor Receptor Monoclonal Antibodies in Metastatic Colorectal Cancer Biotherapy: A Systematic Review Academic Journal of Cancer Research 6 (1): 21-28, 2013 ISSN 1995-8943 IDOSI Publications, 2013 DOI: 10.5829/idosi.ajcr.2013.6.1.72115 Anti-Epidermal Growth Factor Receptor Monoclonal Antibodies in Metastatic

More information

Histopathology and prognosis in renal cancer

Histopathology and prognosis in renal cancer Histopathology and prognosis in renal cancer Granular cell Granular cell Granular cell Granular cell Clear cell Chromophobe cell Papillary type 2 Luca Mazzucchelli Istituto cantonale di patologia, Locarno

More information

Targeted therapies for Early Stage Breast Cancer. Cynthia Vakhariya D.O. Providence Hospital

Targeted therapies for Early Stage Breast Cancer. Cynthia Vakhariya D.O. Providence Hospital Targeted therapies for Early Stage Breast Cancer Cynthia Vakhariya D.O. Providence Hospital Case 55-year-old postmenopausal woman Routine screening mammogram 3 cm irreg mass in L breast Left breast ultrasound

More information

Quale impatto sulla pratica clinica

Quale impatto sulla pratica clinica Ospedaletto di Pescantina, 21 marzo 2014 La biopsia del linfonodo sentinella prima o dopo la chemioterapia neoadiuvante Quale impatto sulla pratica clinica Nicla La Verde ONCOLOGIA MEDICA E CHEMIOTERAPIA

More information

Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress

Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Lung Cancer Accounts for 14% of All New Cancer Diagnoses in the United States 1 Lung cancer is the second most common malignancy

More information

Breast Cancer Biomarkers: From Serendipity to Rational Discovery

Breast Cancer Biomarkers: From Serendipity to Rational Discovery // Breast Cancer Biomarkers: From Serendipity to Rational Discovery Partha S. Ray, MD Clinical Assistant Professor Department of Surgery University of Illinois College of Medicine at Urbana Champaign Carle

More information

Cellular, Molecular, and Biochemical Targets in Breast Cancer

Cellular, Molecular, and Biochemical Targets in Breast Cancer Cellular, Molecular, and Biochemical Targets in Breast Cancer Kristy Kummerow Ingrid Meszoely December 12, 2012 VUMC Resident Bonus Conference One size fits all surgical treatment of breast cancer Wilhelm

More information

Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012

Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 Nuovi Scenari in Oncologia G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 WHAT is cancer? «Cancer is a genetic disease of the somatic cell» [B. Vogelstein] Ten years ago Now [Cell.

More information

Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC)

Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Medical Policy Manual Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Section: Genetic Testing Policy No: 56 Date of Origin: August 2010 Last Reviewed Date: December

More information

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a

La diagnostica molecolare nelle neoplasie colo-rettali. A do Scarpa. U iversita di Vero a La diagnostica molecolare nelle neoplasie colo-rettali C-NET A do Scarpa e Dipartime to Pato ogia e U iversita di Vero a La stessa malattia puo avere diverse patogenesi cucchiaio moneta forchetta Gastrointestinal

More information

AKT1 APC BRAF CTNNB1 KIT EGFR IDH1 MAP2K1 KRAS NOTCH1 NRAS PIK3CA TP53 PTEN. Rapid Tumor Genotyping in Solid Tumors

AKT1 APC BRAF CTNNB1 KIT EGFR IDH1 MAP2K1 KRAS NOTCH1 NRAS PIK3CA TP53 PTEN. Rapid Tumor Genotyping in Solid Tumors AKT1 AC BRAF CTNNB1 KIT IDH1 MA2K1 NOTCH1 NRAS IK3CA TEN T53 Rapid Tumor Genotyping in Solid Tumors Tumor Genotyping ersonalized Medicine Requires ersonalized Diagnostics Biological discoveries utilizing

More information

CRC subtypes: from molecular signatures to therapeutic opportunities. Rodrigo Dienstmann, MD

CRC subtypes: from molecular signatures to therapeutic opportunities. Rodrigo Dienstmann, MD CRC subtypes: from molecular signatures to therapeutic opportunities Rodrigo Dienstmann, MD No conflicts of interest. REALITY Until recently, the evolution of biomarkers for matched targeted therapies

More information

Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma. Claire Vines, 2016 Pharm.D. Candidate

Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma. Claire Vines, 2016 Pharm.D. Candidate + Anti-PD1 Agents: Immunotherapy agents in the treatment of metastatic melanoma Claire Vines, 2016 Pharm.D. Candidate + Disclosure I have no conflicts of interest to disclose. + Objectives Summarize NCCN

More information

Rilevanza dell innovazione tecnologica per la

Rilevanza dell innovazione tecnologica per la Rilevanza dell innovazione tecnologica per la ricerca traslazionale e la terapia in oncologia Ruggero De Maria Dipartimento di Ematologia Oncologia e Medicina Molecolare, Istituto Superiore di Sanità Translational

More information

SBRT for oligometastases. new histology always needed?

SBRT for oligometastases. new histology always needed? Department of Radiation Oncology Chairman: Prof. Dr. Matthias Guckenberger SBRT for oligometastases new histology always needed? Matthias Guckenberger Oligo-Metastases vs Oligo-Progression Oligo-metastasis

More information

Molecular Markers in Advanced NSCLC (Part 6): Who to Test, and What to Test For? Implementing Molecular Markers in a Network/Health Care System, by

Molecular Markers in Advanced NSCLC (Part 6): Who to Test, and What to Test For? Implementing Molecular Markers in a Network/Health Care System, by Molecular Markers in Advanced NSCLC (Part 6): Who to Test, and What to Test For? Implementing Molecular Markers in a Network/Health Care System, by Dr. Glen Goss Dr. Alice Shaw Dr. Charlie Rudin Johns

More information

Prognostic and predictive factors Surrogate endpoints

Prognostic and predictive factors Surrogate endpoints Prognostic and predictive factors Surrogate endpoints Xavier Paoletti Institut Curie, Paris / Inserm U900 some slides from Marc Buyse IDDI & Hasselt University, Belgique OUTLINE 1. Setting the scene: definitions

More information

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy

Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Predictive Biomarkers for PD1 Pathway Inhibitor Immunotherapy Michael B. Atkins, M.D. Deputy Director Georgetown-Lombardi Comprehensive Cancer Center Michael Atkins, MD Consulting Fees (e.g., advisory

More information

Les cancers bronchiques chez la femme: une épidémie? Professeur Jean Trédaniel Unité de cancérologie thoracique Hôpital Saint-Louis

Les cancers bronchiques chez la femme: une épidémie? Professeur Jean Trédaniel Unité de cancérologie thoracique Hôpital Saint-Louis Les cancers bronchiques chez la femme: une épidémie? Professeur Jean Trédaniel Unité de cancérologie thoracique Hôpital Saint-Louis Annual Age-adjusted Cancer Incidence Rates Among Males and Females for

More information

TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC

TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC TRATTAMENTO COMBINATO RADIO- CHEMIOTERAPICO NEL III STADIO NSCLC Dr.ssa Sara Ramella Radioterapia Oncologica Campus Bio-Medico Trimodality therapy offers a promising chance of long-term survival Evidenze

More information