!! "# - ' - ) * $ ( ISTITUTO TUMORI MILANO
|
|
|
- Annice Lester
- 8 years ago
- Views:
Transcription
1 "!! "# "#'( "# " ) * +, +, - ' - ( STTUTO TUMOR MLANO 1
2 " "!"# #./ ( # * ' ( ' ( ) ' +, #--!. * ) #!"# #!"# STTUTO TUMOR MLANO!"# ' *+*+++,"--!. * ' ( 1 ## ) -!/!00 STTUTO TUMOR MLANO #582#32:5825#24) # 8 2#3"4)52 4)5272#8#5 4)5298#5 / # : "#!#20!-/< ## #/< = 9 > ' > ) ) ) / 2
3 2 LEU ALA THR VAL LYS SER ARG CTAGCTACAGTGAAATCTCGA LEU ALA THR VAL LYS SER ARG GLU CTAGCTACAGTGAAATCTCGA A 7?.@ 7?.4A.BB2 9"2 "2 "# > 9#"#2 #"#2? 299)9#592< CC D C E FG 3
4 4 3// 299)94)592 #592"#)25< H #592"4)44)< "''!/#",#4!//. / "/"!! "!
5 7J # /:4AK5# +)0-50 /,!. = ',+-!! '( ()*+ < ',+- = +!! '( ()* > Linfomi per diagnosi e prognosi Sarcomi per diagnosi Carcinoma mammario x terapia Carcinoma colorettale x terapia Tumori cerebrali x terapia 5
6 299)9 #5 92< 299)9 4) 5 92< 9 "# / :A( 2 2 < #.LL LLL '.L1 - * ML / :- B.L LLL?L1 B.1 F. MLLL C/F1 - *?L1 : < N # : :(? #: ( ( 9
7 β##,03.,03., , < * 0 0"- #2 /# 0 /# 0 #/#! ## β##,)+). β7 "J 4# 0 0"- #2 /# 0 /# 0 #/#! ## '#2OCLL.NP.C<FMG/F0M " : /##9" #0: Q Q - Q 9 < /./) " / '?P?? - * / /9 :< R/.P' " / 'G C /./) ' /9 C./) /9 / 9J 'O 5 CLLGNCF<.P?P/.PCM 9J 'O 5 CLLGNCF<.P?P/.PCM 7
8 /?0 / A < "'"C"F A 95 2 /./) : H 95(.L/GL1?0/?0/ " / '?G?C 95?0 " 'C O '#2O?BBFNPP?NC?P/CC? 9J 'O 5 CLLGNCF<.P?P/.PCM?0./) /?0 " / 'P?./) 95?0?./) 95?0? 95?0 95?0-./) 2 95?0./) 8
9 227(/ 4 '#2OCLL0NP.0<??GL/??MF 28< Ligand Monomer Monomer P P Dimer Cross-auto phosphorylation Cell survival Signaling pathways Cell duplication 'O 5 CLLMNC.<FL.M/FLG. 28/ 28/ < 2 S( : A S( 4 R 2 4S( 8 S( 9 4S(!/#9#!/!/#9 28' ' 7 T?L1 '. 28 //!55/= 4 '#2OCLL0NP.0<??GL/??MF 'CLLFN 'CLLFNA 'CLLM( 9
10 28 /28 'CLLFN C 'CLLF( 28 ( 'CLL.( 28 < ' J 'CLLFN9 'CLLFNR H 'CLLG( # PHCM??1( E E 28 M 28 : L #:"D "( P #8 /: /: ( Moroni et al mcrc Score EGFR gene/ nucleus (CNG). ncreased EGFR CNG was defined as the presence of three or more signals per nucleus. 9/20 (45) Of the 9 patients with CNG 8 responded and 1 non responded to cetuximab or panitumumab, suggesting a genetic basis of response to anti-egfr treatment Frattini et al mcrc 1) Loss if 1 copy of chr 7 in >50 of cells 2) Disomy if 2 copies of chr 7 in >50 of cells 3) Low polysomy f 3 or 4 copies of chr 7 in >50 of cells 4) Marked polysomy if >4 copies of chr 7 in >50 of cells 5) Amplification if R> 3 in at least 10 of cells 0/27 (0) 3/27 (11) 0/27 (0) 1/27 (59) 8/27 (30) Patients whit amplification or marked polysomy have a increased likelihood to response to cetuximab therapy (depending from K-ras and PTEN status) while the disomic one in generally are resistant SartoreBianchi et al mcrc Score EGFR gene/nucleus and use the cut off value. FSH + if > 2.5 and/or > 40 chr 7 polysomy FSH - if 2.5 and/or 40 chr 7 polysomy 38-39/ /58 Patients with disomic or low polisomy of chr7 have a reduced likelihood to response to panitumumab Cappuzzo et al mcrc Score EGFR /nucleus and use the cut off value. FSH + if > 2.92 FSH - if /85 (50) 42/85 (50) Patients with EGFR CNG have an increased likelihood to response to '7 O <?L??PGHV CLL0L.B.BC ( C M J : L P U /: /: 28 M?GHCM.B1( 28 0HCM PL1( F G?C '7 O H M #:"D "( CLLMN BM<??PB/??F.( PHCM??1( E E M 'CLL0/ G?BU Observations 28 F?C?U Number of cases and FSH interpretation criteria 0HCM PL1( 28 Type M?GHCM.B1( 'CLL. Cases ( M U Authors and year J H 28 CLLMN BM<??PB/??F.( 10
11 @ TCL/PL1 TFL1 TCL/PL1 TFL1 :PR R/ :PR R/ :42# J TPL1 7 2R T./?L1 :42# J TPL1 7 2R T./?L1 45 2R?'C 45 2R?'C R/ R/ < / 1# W/ MBH??PML1( PFH??PPL1( > Wild Type Mutated KRAS Response Rate Response Rate Study Patients mutations () () () Moroni et al Di Fiore et al Frattini et al Benvenuti et al Khambata-Ford et al Karapetis et al Lievre et al and account for about 40 of NR patients De Roock et al Amado et al Van Cutsem et al Bokemeyer et al K-Ras mutations associated with cetuximab/panitumumab resistance : 'CLLB CCHMBC01( CHPFG1( #/.MHMBMC1( PCHPFBF1( p<0.05, two-tailed Fisher s exact test /28 "# X X 'O 5 CLL0NCG<.ML./.M?C( R/ 7 W/ W/ 1# MBH??PML1( PFH??PPL1( G0HMB0G1(??HMB?F1( > > #/ p<0.05, two-tailed Fisher s exact test CCHMBC01(.MHMBMC1(?!? CHPFG1( PCHPFBF1( /28 "# X X 'O 5 CLL0NCG<.ML./.M?C( CCHG0PC1( LH??L1( #/ FGHG0G01(??H???LL1( p<0.05, two-tailed Fisher s exact test J R/@/ "# X X 'O 5 CLL0NCG<.ML./.M?C( 11
12 'E??P 7 R UUYLL.ELL??( # R PFH??PPL1( CHPFG1(U PCHPFBF1(UU W/4R MBH??PML1( CCHMBC01(UU.MHMBMC1(UU R/ PCH0BPG1(# RPFH??PPL1( BRAF mutational status on Wild-Type KRAS tumors UYLL.ELLCB( # 7??HMB?F1( LH??L1(U??H???LL1(U W/47 G0HMB0G1( CCHG0PC1(U FGHG0G01(U 7??H0B?C1(# 7??H??P?L1( 7AGLL2 R/7 R/7 F01 # "# X X 'O 5 CLL0NCG<.ML./.M?C( 4 7AGLL2 "# X X 'O 5 CLL0NCG<.ML./.M?C( 'E??P UUYLL.ELL??( # UYLL.ELLCB( # R R PFH??PPL1( CHPFG1(U PCHPFBF1(UU BRAF mutational status on Wild-Type KRAS tumors 7??HMB?F1( LH??L1(U??H???LL1(U W/4R MBH??PML1( CCHMBC01(UU.MHMBMC1(UU W/47 G0HMB0G1( CCHG0PC1(U FGHG0G01(U R/ PCH0BPG1(# RPFH??PPL1( R/7 R/7 F01 # "# X X 'O 5 CLL0NCG<.ML./.M?C(?!? 7??H0B?C1(# 7??H??P?L1( TCL1 :42# TPL1 :PR J 45 R/ 7 2R 2R?'C TPL/FL1 T?L1 :RP #@ W/ Evaluation of KRAS status 18 B.H??L0G1(?.H??L?F1( Mutated KRAS Wild-type KRAS CCHB.CP1( > LH?.L1( Very low or no probability of clinical benefit Mutated BRAF or Mutated PK3CA Evaluation of BRAF and PK3CA #/ MPHB.MM1(?.H?.?LL1( p<0.001, two-tailed Fisher s exact test J High probability of clinical benefit Wild-type BRAF and Wild-type PK3CA /7X X 'CLLBNGB<?0.?/?0.M( /7 'CLLB( 12
13 : : 8?/ 0#,!/#9@0#!/!/#9#. Z Q 00 #! 1# /!# 9 Q +##"##"=<-R LF?[J[LG' LG?[J[L0' '7OCLLBN?LL<?L0M/?LBF( <R/ :K4)5 PM 244 A"=0 C?.M1( A"=0 CCGL1(!#?GFP1(!#?.FL1( " R/ PHPM01(κEL0P':YLLLL?( :4 8 R/ >?HPMCM1( W/ : /28< 24 ( :<CH?C?M1( #<?LH?C0P1( cases EGFR HC EGFR FSH K-Ras BRAF PTEN HC clinical T M T M T M T M T M response CNG CNG WT WT WT WT + + PR CNG CNG WT WT WT WT + + PR D D WT WT V00E V00E + + NR D D WT WT WT WT + + NR CNG CNG G12S G12S WT WT + + NR + + CNG CNG G12A G12A WT WT + + NR CNG CNG WT WT WT WT - - NR D CNG G12A G12A WT WT - - NR D CNG G12D G12D WT WT + + NR D CNG G12A G12A WT WT - - NR D CNG WT WT V00E V00E - - NR CNG CNG G12D WT WT WT + + NR > 9 R/ 8?C CHPM.F1( W/ 4 R/ /28 '7OCLLBN?LL<?L0M/?LBF( '7OCLLBN?LL<?L0M/?LBF( R/ < / R/< Wild Type Mutated KRAS Response Rate Response Rate Study Patients mutations () () () Moroni et al Di Fiore et al Frattini et al Benvenuti et al Khambata-Ford et al Karapetis et al Lievre et al De Roock et al Amado et al Van Cutsem et al Bokemeyer et al : 'CLLB NT 13
14 R/ R/ H8:HH H8:HH 2 R/ 28/ 2 R/ 28/ "J 'OCL?L( "J 'OCL?L( 28 /R4 84 <HH@@@ / H( 14
1. Le mutazioni di KRAS hanno tutte lo stesso significato clinico?
EGFR downstream pathways KRAS domande frequenti ed importanti. Luca Mazzucchelli Istituto cantonale di patologia Locarno )'"* )-# %& # +%,!"# '( "#$ Anti-EGFR monoclonal antibodies (MoAbs) Cetuximab and
Overall survival in metasta0c colorectal cancer and cost of treament
Overall survival in metasta0c colorectal cancer and cost of treament months 20 ~ 24 $ (8 weeks of treatment) 6-8 12-14 BSC 5FU FOLFOX FOLFIRI FOLFOX/ FOLFIRI + cetuximab- bevacizumab Mayo Clinic LV5FU2
Cos è EGFR? Epidermal Growth Factor Receptor. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro. EGFR e il cancro
Formazione interna Cos è EGFR? Epidermal Growth Factor Receptor Valutazione di EGFR con FISH in varie malattie neoplastiche V. Martin 1-0-008 Recettore transmembrana di tipo TK. Codificato dal gene EGFR,
Medical Policy An independent licensee of the Blue Cross Blue Shield Association
KRAS, NRAS, and BRAF Mutation Analysis in Page 1 of 17 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: KRAS, NRAS, and BRAF Mutation Analysis in Professional Institutional
quali sottogruppi biologici di elezione?
Roma, 10 maggio 2013 Meccanismi molecolari di resistenza alle terapie anti-egfr nella neoplasia colorettale metastatica: quali sottogruppi biologici di elezione? Andrea Sartore Bianchi Oncologia Clinica
Come è cambiata la storia naturale della malattia
Malattia Metastatica del Carcinoma del Grosso Intestino Tecniche e terapie Innovative Come è cambiata la storia naturale della malattia Antonio Frassoldati Oncologia Clinica - Ferrara 29 ottobre 2011 Colorectal
Pharmacogenomic markers in EGFR-targeted therapy of lung cancer
Pharmacogenomic markers in EGFR-targeted therapy of lung cancer Rafal Dziadziuszko, MD, PhD University of Colorado Cancer Center, Aurora, CO, USA Medical University of Gdansk, Poland EMEA Workshop on Biomarkers,
Ruolo del K-ras come fattore predittivo di Risposta ad anticorpi anti-egfr nel carcinoma del colon retto
Ruolo del K-ras come fattore predittivo di Risposta ad anticorpi anti-egfr nel carcinoma del colon retto Antonio Marchetti Pathology and Oncogenetic Unit, Center of Excellence on Aging University-Foundation
BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time?
BRAF Testing in Advanced Colorectal Cancer: Is It Ready for Prime Time? Brooke Phillips, MD, Matthew Kalady, MD, and Richard Kim, MD Dr. Phillips is a fellow in the Department of Oncology at the Taussig
Médecine de précision médecine personnalisée en Oncologie. Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN
Médecine de précision médecine personnalisée en Oncologie Fabien Calvo, Directeur Recherche et Innovation, INCa, Directeur ITMO Cancer, AVIESAN Successful targeted drug development Rapid identification
FARMACI PERSONALIZZATI PER
ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica FARMACI
Corporate Medical Policy
Corporate Medical Policy Molecular Analysis for Targeted Therapy for Non-Small Cell Lung File Name: Origination: Last CAP Review: Next CAP Review: Last Review: molecular_analysis_for_targeted_therapy_for_non_small_cell_lung_cancer
Cetuximab (Erbitux) MM.04.005 05/10/2005. HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s) of Service: Office: Outpatient
Cetuximab (Erbitux) Policy Number: Original Effective Date: MM.04.005 05/10/2005 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST Integration 01/01/2015 Section: Prescription Drugs Place(s)
Genomic Analysis of Mature B-cell Malignancies
Genomic Analysis of Mature B-cell Malignancies Update and Lessons Learned Omar Abdel-Wahab, MD Memorial Sloan Kettering Cancer Center Human Oncology and Pathogenesis Program and Leukemia Service Disclaimer:
GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE
GENETIC PROFILES AND TARGETED TREATMENT OF CANCER - PERSONALIZED MEDICINE Branko Zakotnik MD, PhD Department of Medical Oncology Institute of Oncology Ljubljana 1 I have no conflict of interest to declare
Rilevanza dell innovazione tecnologica per la
Rilevanza dell innovazione tecnologica per la ricerca traslazionale e la terapia in oncologia Ruggero De Maria Dipartimento di Ematologia Oncologia e Medicina Molecolare, Istituto Superiore di Sanità Translational
High-quality genomic DNA isolation and sensitive mutation analysis
Application Note High-quality genomic DNA isolation and sensitive mutation analysis Izabela Safin, Ivonne Schröder-Stumberger and Peter Porschewski Introduction A major objective of cancer research is
Prognostic and Predictive Factors in Oncology. Mustafa Benekli, M.D.
Prognostic and Predictive Factors in Oncology Mustafa Benekli, M.D. NCI Definitions ESMO Course -Essentials of Medical Oncology -Istanbul 2 Prognostic factor: NCI Definition A situation or condition, or
Recap. Lecture 2. Protein conformation. Proteins. 8 types of protein function 10/21/10. Proteins.. > 50% dry weight of a cell
Lecture 2 Protein conformation ecap Proteins.. > 50% dry weight of a cell ell s building blocks and molecular tools. More important than genes A large variety of functions http://www.tcd.ie/biochemistry/courses/jf_lectures.php
PNA BRAF Mutation Detection Kit
- PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit
HER2 Testing in Breast Cancer
HER2 Testing in Breast Cancer GAIL H. VANCE, M.D. AGT MEETING JUNE 13, 2014 LOUISVILLE, KENTUCKY No Conflict of Interest to Report Human Epidermal Growth Factor Receptor 2-HER2 Human epidermal growth factor
Personalized Predictive Medicine and Genomic Clinical Trials
Personalized Predictive Medicine and Genomic Clinical Trials Richard Simon, D.Sc. Chief, Biometric Research Branch National Cancer Institute http://brb.nci.nih.gov brb.nci.nih.gov Powerpoint presentations
Successes and Limitations of Targeted Cancer Therapy in Lung Cancer
Successes and Limitations of Targeted Cancer Therapy in Lung Cancer Kenichi Suda a, b Tetsuya Mitsudomi a a Division of Thoracic Surgery, Department of Surgery, Kinki University Faculty of Medicine, Osaka-Sayama,
Nuovi Scenari in Oncologia. G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012
Nuovi Scenari in Oncologia G. Zoppoli X-Files in Nutrizione Clinica e Artificiale, 08/06/2012 WHAT is cancer? «Cancer is a genetic disease of the somatic cell» [B. Vogelstein] Ten years ago Now [Cell.
plaque reduction assay, modified dye uptake assay including formazan test, dye uptake assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
Colorectal cancer xenopatients: A preclinical platform for precision medicine
Colorectal cancer xenopatients: A preclinical platform for precision medicine Livio Trusolino, MD PhD Laboratory of Molecular Pharmacology IRCC, Institute for Cancer Research and Treatment University of
Domain Antivirals tested Test methods for phenotype References. Aciclovir (ACV), Foscarnet (FOS) ACV, FOS ACV,
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns
July 2013 Edition Vol. 7, Issue 7 Breast and Lung Cancer Biomarker Research at ASCO: Changing Treatment Patterns By Julie Katz, MPH, MPhil Biomarkers played a prominent role in the research presented in
Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress
Non Small Cell Lung Cancer: Scientific Discoveries and the Pursuit of Progress Lung Cancer Accounts for 14% of All New Cancer Diagnoses in the United States 1 Lung cancer is the second most common malignancy
Cost-effectiveness of KRAS Genetic Testing for Anti-EGFR Therapy in Metastatic Colorectal Cancer. Luciano Ieraci, MSc
Cost-effectiveness of KRAS Genetic Testing for Anti-EGFR Therapy in Metastatic Colorectal Cancer Luciano Ieraci, MSc November 2010 Figures...24 Objectives...3 Methods...3 Results...3 Conclusions...3 StudyQuestion...5
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger
White paper Evaluation of BRAF (V600E) Mutation by Immunohistochemical Staining with anti-braf V600E (VE1) Antibody: A Comparison with Sanger Sequencing 2 Evaluation of BRAF (V600E) Mutation by Immunohistochemical
Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?
Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their
Genomic Medicine The Future of Cancer Care. Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America
Genomic Medicine The Future of Cancer Care Shayma Master Kazmi, M.D. Medical Oncology/Hematology Cancer Treatment Centers of America Personalized Medicine Personalized health care is a broad term for interventions
Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics
EPAAC WP8 Research Forum - 2 July, Sofitel Hotel Europe, Brussels Public-Private Partnerships in early phase clinical research: Spurring access to innovative therapeutics JY Blay, Past President EORTC
Relative Risk (Sokal & Hasford): Relationship with Treatment Results. Michele Baccarani
Relative Risk (Sokal & Hasford): Relationship with Treatment Results Michele Baccarani European LeukemiaNet EVOLVING CONCEPTS IN THE MANAGEMENT OF CHRONIC MYELOID LEUKEMIA VENICE 8 9 MAY 2006 Disease risk
The EGFR mutation and precision therapy for lung cancer
for lung cancer Outcomes in advanced lung cancer have seen meaningful improvement in the past decade thanks to new precision drug therapies. Because tumors usually develop resistance to the drugs, scientists
Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities
Applications of comprehensive clinical genomic analysis in solid tumors: obstacles and opportunities Vincent A. Miller, M.D. Foundation Medicine, Inc. AACR Annual Meeting 2012 Current Concepts session
Mature Lymphoproliferative disorders (2): Mature B-cell Neoplasms. Dr. Douaa Mohammed Sayed
Mature Lymphoproliferative disorders (2): Mature B-cell Neoplasms Dr. Douaa Mohammed Sayed Small lymphocytic lymphoma/b-cell chronic lymphocytic leukemia BMB: nodular, interstitial, diffuse or a combination
Future Directions in Clinical Research. Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center
Future Directions in Clinical Research Karen Kelly, MD Associate Director for Clinical Research UC Davis Cancer Center Outline 1. Status of Cancer Treatment 2. Overview of Clinical Research at UCDCC 3.
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
BAP1 germline mutations A new Cutaneous Nevus Melanoma Syndrome. Thomas Wiesner
BAP1 germline mutations A new Cutaneous Nevus Melanoma Syndrome Thomas Wiesner Disclosure Listed as co-inventor US patent application US 61/463,389 BAP1 mutational analysis in determining susceptibility
Overview 1/28/2013. Bethesda System Cytology Categories and Molecular Alterations in Thyroid FNA Specimens
Bethesda System Cytology Categories and Molecular Alterations in Thyroid FNA Specimens N. Paul Ohori, M.D. Department of Pathology University of Pittsburgh Medical Center Pittsburgh, Pennsylvania N. Paul
AP Biology 2013 Free-Response Questions
AP Biology 2013 Free-Response Questions About the College Board The College Board is a mission-driven not-for-profit organization that connects students to college success and opportunity. Founded in 1900,
Gebruik van predictieve markers voor targeted therapy in de algemene praktijk
Gebruik van predictieve markers voor targeted therapy in de algemene praktijk Gerrit A. Meijer, MD, PhD Professor of Pathology Chair of the Department of Pathology VU Universtiy Medical Center Amsterdam
A NOVEL APPROACH TO DEVELOP PREDICTIVE BIOMARKERS
A NOVEL APPROACH TO DEVELOP PREDICTIVE BIOMARKERS Prediction of response to anti-egfr therapy in a large panel of patient-derived colorectal cancer xenograft models Dissertation zur Erlangung des akademischen
Nancy E. Davidson, MD Johns Hopkins University. Breast Cancer
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System
White Paper Oncology Insights Enabled by Knowledge Base-Guided Panel Design and the Seamless Workflow of the GeneReader NGS System Abstract: This paper describes QIAGEN s philosophy and process for developing
PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO. Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA.
PATOLOGIA MOLECULAR DEL CANCER GINECOLOGICO Xavier Matias-Guiu Hospital Universitari Arnau de Vilanova, Universitat de Lleida, IRBLLEIDA. Carcinoma de Endometrio Cáncer de Ovario Endometrial carcinoma
HER2 Status: What is the Difference Between Breast and Gastric Cancer?
Ask the Experts HER2 Status: What is the Difference Between Breast and Gastric Cancer? Bharat Jasani MBChB, PhD, FRCPath Marco Novelli MBChB, PhD, FRCPath Josef Rüschoff, MD Robert Y. Osamura, MD, FIAC
Non-Small Cell Lung Cancer
Non-Small Cell Lung Cancer in East tasia Chia-Chi (Josh) Lin, MD, PhD 林 家 齊 Director of Phase I Center, e Department of Oncology, National Taiwan University Hospital Clinical Associate Professor, Department
KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Original Policy Date
MP 2.04.43 KRAS Mutation Analysis in Non-Small Cell Lung Cancer (NSCLC) Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013
Update in Hematology Oncology Targeted Therapies. Mark Holguin
Update in Hematology Oncology Targeted Therapies Mark Holguin 25 years ago Why I chose oncology People How to help people with possibly the most difficult thing they may have to deal with Science Turning
WHITE PAPER SEPT 2015
WHITE PAPER SEPT 2015 LIQUID BIOPSY FOR THE DETECTION AND MONITORING OF CANCER: ANALYSIS OF 96 HOTSPOT MUTATIONS VIA PLASMA DERIVED CIRCULATING TUMOR DNA PATHWAY GENOMICS CANCER AND SOMATIC MUTATIONS The
Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?
Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.
Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer Registry
The American Journal of Surgery (2013) 205, 608-612 North Pacific Surgical Association Stage III & IV colon and rectal cancers share a similar genetic profile: a review of the Oregon Colorectal Cancer
Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC)
Name of Policy: Molecular Analysis for Targeted Therapy of Non-Small-Cell Lung Cancer (NSCLC) Policy #: 468 Latest Review Date: October 2015 Category: Laboratory Policy Grade: B Background/Definitions:
Serum Creatine Kinase analysis in mouse models of muscular dystrophy.
Please quote this SOP in your Methods. Serum Creatine Kinase analysis in mouse models of muscular dystrophy. SOP (ID) Number MD_M.2.2.001 Version 2.0 Issued October 18th, 2008 Last reviewed March 25th,
Craig Hallum Conference Investor Presentation
Craig Hallum Conference Investor Presentation Improving cancer outcomes with groundbreaking precision in molecular testing Paul Kinnon President and CEO Sept 2015 1 Forward-Looking Statements Certain statements
MetAction actionable targets in cancer metastasis from bed to bench to byte to bedside
MetAction actionable targets in cancer metastasis from bed to bench to byte to bedside Kjersti Flatmark MD PhD Departments of Tumor Biology and Gastroenterological Surgery, Oslo University Hospital PIs:
Molecular Diagnosis of Gastrointestinal Tumors
Molecular Diagnosis of Gastrointestinal Tumors Zoltan Szentirmay National Institute of Oncology Center of Surgical and Molecular Tumor Pathology EEA and Norwegian Financial Mechanisms in Hungary, Development
POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS DISCLAIMER CODING INFORMATION REFERENCES POLICY HISTORY
Original Issue Date (Created): 9/1/2011 Most Recent Review Date (Revised): 1/27/2015 Effective Date: 11/2/2015 POLICY PRODUCT VARIATIONS DESCRIPTION/BACKGROUND RATIONALE DEFINITIONS BENEFIT VARIATIONS
(21) Appl. No.: 09/120,044
US 20010014332A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2001/0014332 A1 MINETTI et al. (43) Pub. Date: Aug. 16, 2001 (54) MODIFIED IMMUNOGENIC PNEUMOLYSIN COMPOSITIONS
Medical Policy Manual. Date of Origin: August 2010. Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC)
Medical Policy Manual Topic: Molecular Analysis for Targeted Therapy of Non- Small Cell Lung Cancer (NSCLC) Section: Genetic Testing Policy No: 56 Date of Origin: August 2010 Last Reviewed Date: December
Evaluation and Validation of Diagnostic Tests for Guiding Therapeutic Decisions
METHODOLOGY Thérapie 2009 Mai-Juin; 64 (3): 195 201 DOI: 10.2515/therapie/2009028 c 2009 Société Française de Pharmacologie et de Thérapeutique Evaluation and Validation of Diagnostic Tests for Guiding
Breakthrough Lung Cancer Treatment Approved Webcast September 9, 2011 Renato Martins, M.D., M.P.H. Introduction
Breakthrough Lung Cancer Treatment Approved Webcast September 9, 2011 Renato Martins, M.D., M.P.H. Please remember the opinions expressed on Patient Power are not necessarily the views of Seattle Cancer
Cáncer de Pulmón n con Mutación de EGFR: Una Entidad Clínica y Patológica Distinta
Cáncer de Pulmón n con Mutación de EGFR: Una Entidad Clínica y Patológica Distinta Luis Paz-Ares Hospital Universitario Virgen del Rocio Seville, Spain Advanced NSCLC: chemotherapy has reached a therapeutic
Targeted Therapies in Lung Cancer
Targeted Therapies in Lung Cancer I Edited by: Simona Carnio Thoracic Oncology Division - St Luigi Hospital Orbassano (TO) - Italy Silvia Novello Department of Oncology - University of Torino - Italy Why
Molecular analyses of EGFR: mutation and amplification detection
Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation
SECOND PRIMARY BREAST CANCERS FOLLOWING HAEMATOLOGIC MALIGNANCIES A CASE SERIES STUDY FARAH TANVEER PGY 3 DR.MEIR WETZLER DR.
SECOND PRIMARY BREAST CANCERS FOLLOWING HAEMATOLOGIC MALIGNANCIES A CASE SERIES STUDY FARAH TANVEER PGY 3 DR.MEIR WETZLER DR. TRACEY O CONNOR RESEARCH QUESTON Patients with previously diagnosed hematologic
Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART
Harmesh Naik, MD. Hope Cancer Clinic HOW DO I MANAGE STAGE 4 NSCLC IN 2012: STATE OF THE ART Goals Discuss treatment options for stage 4 lung cancer: New and old Discuss new developments in personalized
Nuevas tecnologías basadas en biomarcadores para oncología
Nuevas tecnologías basadas en biomarcadores para oncología Simposio ASEBIO 14 de marzo 2013, PCB Jose Jimeno, MD, PhD Co-Founder / Vice Chairman Pangaea Biotech SL Barcelona, Spain PANGAEA BIOTECH BUSINESS
Targeted Therapy What the Surgeon Needs to Know
Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures
DIPARTIMENTO di SCIENZE BIOMEDICHE e BIOTECNOLOGICHE
July 15, 2015 Science editor of World Journal of Gastroenterology Jing Yu Email: j.yu@wjgnet.com Dear Prof. Jing Yu, please find enclosed a revised version of our paper Non-coding landscapes of Colorectal
BRAF as a prognostic marker in papillary thyroid cancer
12 Congresso Nazionale AME Molecular markers in thyroid cancer: current role in clinical practice BRAF as a prognostic marker in papillary thyroid cancer Dott. ssa Cristina Romei Sezione di Endocrinologia
Metastatic breast cancer represents an incurable condition associated with an average survival time of 18 to 24 months.
TACT-2C Trial A phase II randomized, open-label study evaluating the addiction of trastuzumabto (nabtm)-paclitaxel as first line treatment in primary HER2 negative metastatic breast cancer patients with
Analysis of KRAS/NRAS and BRAF mutations in FIRE-3
Analysis of KRAS/NRAS and BRAF mutations in FIRE-3 A randomized phase III study of FOLFIRI plus cetuximab or bevacizumab as first-line treatment for wild-type KRAS (exon 2) metastatic colorectal cancer
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Instruction manual for product # PNAC-2001. Version 1.2
PNAClamp BRAF Mutation Detection Kit For in vitro diagnostic use Instruction manual for product # PNAC-2001 Version 1.2 Store at -20 C. Instruction Version: Ver. 1.2 Date of Revision: 2012 February 1 /
Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia
Boolean Implications Identify Wilms Tumor 1 Mutation as a Driver of DNA Hypermethylation in Acute Myeloid Leukemia Subarna Sinha PhD Department of Computer Science Principal Investigator: David Dill Daniel
targeted cancer therapy
LUNG CANCER TREATMENTS What you need to know about... targeted cancer therapy foreword About LUNGevity LUNGevity is the largest national lung cancer-focused nonprofit, changing outcomes for people with
Perspectives of Anti-Cancer Targeted Therapies
Perspectives of Anti-Cancer Targeted Therapies Rome, May 18, 2012 Director Giampaolo Tortora M. D. Oncologia Medica Azienda Ospedaliera Universitaria Integrata di Verona Verona Program Friday, May 18 8.30
Understanding series. new. directions. 1-800-298-2436 LungCancerAlliance.org. A guide for the patient
Understanding series LUNG CANCER: new treatment directions 1-800-298-2436 LungCancerAlliance.org A guide for the patient TABLE OF CONTENTS What s New in lung cancer? Advancements...4 Changes in genes that
Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views
Dr. Tilman Schöning Heidelberg University Hospital, Germany Seminar N2 Targeted Therapies in Hospital Pharmacy One Problem, Two Views Conflicts of interest Participation in Advisory Boards Amgen GmbH,
Günter Klöppel Dept. of Pathology Consultation Center for Pancreatic and Endocrine tumors Technische Universität München
Günter Klöppel Dept. of Pathology Consultation Center for Pancreatic and Endocrine tumors Technische Universität München Incidental 1.5 cm tumor in a 45-year old man: Most probable diagnosis - Pan NEN.
Chapter 18. An Introduction to the Endocrine System. Hormone Chemistry
Chapter 18 An Introduction to the Endocrine System Hormone Chemistry Endocrine System Components endocrine system - glands, tissues, and cells that secrete hormones Copyright The McGraw-Hill Companies,
RENAL CANCER PATHOLOGY WHAT REALLY MATTERS? STEWART FLEMING UNIVERSITY OF DUNDEE
RENAL CANCER PATHOLOGY WHAT REALLY MATTERS? STEWART FLEMING UNIVERSITY OF DUNDEE MAJOR PARADIGM SHIFT IN EARLY 1990S IN UNDERSTANDING RENAL CANCER Molecular differential pathology of renal cell tumours
BOC334 (Proteomics) Practical 1. Calculating the charge of proteins
BC334 (Proteomics) Practical 1 Calculating the charge of proteins Aliphatic amino acids (VAGLIP) N H 2 H Glycine, Gly, G no charge Hydrophobicity = 0.67 MW 57Da pk a CH = 2.35 pk a NH 2 = 9.6 pi=5.97 CH
Carcinoma papilar renal, cromófobo y otras histologías. Maria José Méndez Vidal Servicio de oncología Medica Hospital Reina Sofía Córdoba
Carcinoma papilar renal, cromófobo y otras histologías. Maria José Méndez Vidal Servicio de oncología Medica Hospital Reina Sofía Córdoba Europe 121 629 new cases RCC 2012, 75 676 affected men Slide 3
Lung Cancer Genomics and Patient Individualization
Lung Cancer Genomics and Patient Individualization Ming Sound Tsao, MD, FRCPC Qasim Choksi Chair in Lung Cancer Translational Research University Health Network OCI/PMH Leading Causes of Deaths (WHO) In
Opportunities and Challenges in Translating Novel Discoveries into Useful Clinical Tests
Opportunities and Challenges in Translating Novel Discoveries into Useful Clinical Tests James H. Doroshow, M.D. NCI Deputy Director for Clinical and Translational Research NCI Workshop: Evidence Needed
Lung Cancer. Advances in Lung Cancer Treatment
Lung Cancer Advances in Lung Cancer Treatment Treatment for lung cancer is changing rapidly. There are new therapies that target specific molecular changes that drive the growth and spread of the lung
Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku
11 th International Congress on Targeted Anticancer Therapies Paris March 4-6, 2013 Next Generation Sequencing in Early-Phase Clinical Trials in Cancer Filip Janku Investigational Cancer Therapeutics (Phase
Guideline Development The American Society of Clinical Oncology
Assessing Genomic Sequencing Information for Health Care Decision Making Decision Making Once Evidence is Assessed/Graded Evaluated Guideline Development The American Society of Clinical Oncology Gary
MEDICAL POLICY EFFECTIVE DATE: 12/20/07 REVISED DATE: 12/18/08, 12/17/09, 02/17/11, 12/15/11, 12/20/12, 12/19/13, 02/19/15
MEDICAL POLICY SUBJECT: GENOTYPING - EPIDERMAL GROWTH PAGE: 1 OF: 6 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including
The role of epidermal growth factor receptor in non-small cell lung cancer
Dicle Tıp Dergisi / 2015; 42 (1): 117-122 Dicle Medical Journal doi: 10.5798/diclemedj.0921.2015.01.0545 REVIEW ARTICLE / DERLEME The role of epidermal growth factor receptor in non-small cell lung cancer
Therapy in Prostate Cancer: Cure or Regression
Therapy in Prostate Cancer: Cure or Regression F. Di Silverio Department of Urologia U Bracci University La Sapienza Rome Objectives and classification of the results obtained from therapies in oncology
Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing
Individualizing Your Lung Cancer Care: Informing Decisions Through Biomarker Testing These Are Hopeful Times for Lung Cancer Survivors When people first learn they have cancer, they are often afraid. But
2 nd PROCART Forum. October 9th, 2012
2 nd PROCART Forum October 9th, 2012 The main investments in cancer research 2012 research Spending 120 M Including INCa, Aviesan cancer, Ministry of Health cancer biology, cancer sciences, genomics Activities