Data Integration and Data Retrieval

Size: px
Start display at page:

Download "Data Integration and Data Retrieval"

Transcription

1 Data Integration and Data Retrieval Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

2 Overview Data and services at the EBI Integration models EB-Eye SRS Biomart Integrative access Web services REST SOAP How do I use web services?

3 EBI databases Genomes Nucleotides Proteins Structures Other molecules Interactions Experiments Literature Ontologies

4

5 Challenges of Data Integration Different types of data (sequence, function, literature etc.) Different data formats (FASTA, EMBL, Genbank, tab delimited etc.) Different storage formats (ASCII flatfile, XML, RDBMS) No standard formats for common fields (citations, descriptions, dates etc.) Volume and size of data 2007/6/30 5

6 EBI Services

7 Challenges when using tools in unison Manually transfer data from one application to another Understand disparate data formats Convert file formats where appropriate Manage and understand disparate application environments e.g. web browser, desktop application

8 EB-Eye Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

9 EB-Eye Approach to Data Integration Parse original data Reformat data if necessary Create searchable indices Extrapolate links between datasets Standardise field formats Unified interface regardless of data 2007/6/30 9

10 What is the data available? > 20 domains Ligand >137M entries > 550 Gb of data

11 What is the data available formats ID... AC... DT... ID... AC... DT... ID :.. PARENT ID :.. RANK :..... Ligand <XML>... </XML> <XML>... </XML> <XML>... </XML> <XML>... </XML> <XML>... </XML> <XML>... </XML> <XML>... </XML>

12 What is the data available sizes 81M 43M 4.2G 1G 8.4G 57Gb, >500 files 25K 6.3G 374Gb, >600 files

13 Points to take into consideration Our World A large amount of data A variety of file formats A variety of file sizes Data formats are changing Our Quest Index the data as fast as possible Add and configure a new domain easily Detect errors in the data Being up to date No downtime

14 Parsing and indexing different formats Flat files ID AF030562; SV 1; linear; genomic DNA; STS; FUN; 852 BP. AC AF030562; DT 04-DEC-1997 (Rel. 53, Created) DT 03-MAR-2000 (Rel. 62, Last updated, Version 2) XX DE Fusarium venenatum clone VEN-A RAPD band generated using Operon primer DE OPW-03, sequence tagged site.... EMBL grammar Taxonomy grammar UniProt grammar... ID XML files ID AF030562; SV 1; linear; genomic DNA; STS; FUN; 852 BP. <MedlineCitationSet> XX <MedlineCitation ACOwner="NLM" Status="MEDLINE"> <PMID> </PMID> <MedlineCitationSet> ID AC AF030562; <DateCreated> <Year>2000</Year> XX<MedlineCitation Owner="NLM" Status="MEDLINE"> <Month>10</Month> Creation date / Modification date <PMID> </PMID> <Day>04</Day> DT 04-DEC-1997 (Rel. 53, Created) </DateCreated> DT <DateCreated> 03-MAR-2000 (Rel. 62, Last updated, Version 2) XX <Year>1965</Year> Creation Date DE <Month>02</Month> Fusarium venenatum clone VEN-A RAPD band generated using Operon primer DE <Day>01</Day> OPW-03, sequence tagged site. XX</DateCreated> KW <DateCompleted> STS. XX <Year>1996</Year> Organism species Modification Date OS <Month>12</Month> Fusarium venenatum Organism classes OC <Day>01</Day> Eukaryota; Fungi; Ascomycota; Pezizomycotina; Sordariomycetes; OC </DateCompleted> Hypocreomycetidae; Hypocreales; mitosporic Hypocreales; Fusarium. XX<DateRevised> RN <Year>2007</Year> [1] <Month>03</Month> References RP RA <Day>01</Day> Yoder W.T., Christianson L.M.; RT </DateRevised> "Species-specific primers resolve members of the section Fusarium. RT <Article Taxonomic PubModel="Print"> status of the edible 'Quorn' fungus re-evaluated"; RL <Journal> Fungal Genet. Biol. 0:0-0(1997). issn XX <ISSN IssnType="Print"> </ISSN> Medline grammar RN [2] <JournalIssue CitedMedium="Print"> RP <Volume>10</Volume> References <PubDate> Parser volume InterPro grammar RA Yoder W.T., Christianson L.M.; RT ; <Year>1964</Year> RL Submitted <Month>Jul</Month> (ANTLR) (21-OCT-1997) to the EMBL/GenBank/DDBJ Dump databases. file grammar RL Microbiology, </PubDate> Novo Nordisk Biotech, Inc., 1445 Drew Ave., Davis, CA 95616, </JournalIssue> name RL USA XX <Title>Clinica chimica acta; international journal of clinical.. chemistry</title>. FH Key <ISOAbbreviation>Clin. Location/Qualifiers Chim. Acta</ISOAbbreviation> FH </Journal> FT. source FT... /organism="fusarium venenatum" Indexer FT /strain="atcc20334 FT /db_xref="taxon:56646"... Lucene API Description Db <database> <name>intact.experiment</name> <description>experimental procedures that allowed to </description> <release>1.0</release> <release_date>2007-feb-16</release_date> <entry_count>5697</entry_count> <entries> <entry id="ebi-77680"> Parser (ANTXR) Dump file (XML) Uniprot Index Embl Index Taxonomy Index

15 Divide and Conquer the Indexing UniProt (>4M entries) Embl (>83M entries) Taxonomy (>0.37M entries) Medline (>16M entries) GO (>0.23M entries) Others (ArrayExpress Ensembl, Intact, ) Db XML XML 2 files, ~9.4G >600 files ~ 375G 1 file, ~81M >500 files ~ 57G 1 file ~ 27M XML dump XML dump XML dump XML XML XML dump XML dump XML dump 8 cpu 8 cpu 8 cpu 8 cpu Uniprot Index Embl Index Taxonomy Index Medline Index Embl Index ArrayExpress Index Ensembl Index Intact Index

16 Let s put some figures on it 80,000,000 70,000,000 60,000,000 50,000,000 40,000,000 30,000,000 20,000,000 10,000,000 09:36:00 08:24:00 07:12:00 06:00:00 04:48:00 03:36:00 02:24:00 01:12:00 Entries Time (hours) 0 00:00:00 emblnew_std iprmatches embldeleted uniprot emblnew_wgs emblcds medlinerelease emblrelease_wgs emblrelease_std Less than 18 hours to index all the EBI

17 Web side story Load balancer Tomcat 1 Tomcat 2 Tomcat 3 Tomcat 4 UniProt Index Embl Index Taxonomy Index Medline Index ArrayExpress Index Ensembl Index Intact Index

18 Libraries Indexing Lucene (http://lucene.apache.org) ANTLR (http://www.antlr.org/) ANTXR (http://javadude.com/tools/antxr/index.html) JGroups (http://www.jgroups.org) Web Tomcat (http://tomcat.apache.org/) Spring Framework (http://www.springframework.org)

19 EB-eye Global search mechanism Searches most of the EBI resources in one go Not specific to any resource Unified searches of the EBI resources Free-text search (unified semantic) Basic results display (Google-like) Simple cross reference navigation Available on all the EBI web pages

20 EB-eye results summary page Organized into categories called domains Number of results per domain Refine your search Expand/Collapse for more details

21 EB-eye domain result page Results for all the resources in a domain A domain can contain several resources First 3 entries displayed for each resource View more entries for a particular resource Hierarchy of domains Forward search (smaller set of resources) Backward search (wider set of resources) Refine your search Navigate the results pages

22 EB-eye domain result page (one resource) Basic information: ID, name, description Link to the main resource web site Additional links EB-eye internal references

23 EB-eye cross-references navigation Navigate inside the EB-eye References context Navigation Using resources explicit references Using resources implicit references

24 EB-eye Advanced Search Accessible from all the pages Simple search criteria Domain specific search Domain selection Fields selection References

25 Exercices Find about protease but not about protease inhibitors proteases are classified into 4 large groups. Find out about cysteine and/or serine proteases but not about aspartic or metallo peptidases Find all uniprot entries regarding SARS but not those that are incomplete (are fragments) or a putative (no evidence they are what they pretend to be) and represent the spike glycoprotein.

26 Queries with SRS Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

27 Overview What is SRS? Data Integration Subentries Analysis Tools Search Terms SRS Web Interface Quick Searches Library Specific Searching Query History Linking Analysis Tools Databank Information and Index Browsing URL Queries 2007/6/30 27

28 What is SRS? Central resource for biological data Data integration and retrieval system more than 200 databases Databases are linked via common data Data analysis applications server more than 150 applications Run tool on query results or user supplied data Results linked to related data in other databases 2007/6/30 28

29 SRS Approach to Data Integration Parse original data Reformat data if necessary Create searchable indices Extrapolate links between datasets Standardise field formats Unified interface regardless of data 2007/6/30 29

30 Main page Tabs to main sections Quick simple search Tips and Aids Latest News Search with a list of IDs 2007/6/30 30

31 Databank Information 2007/6/30 31

32 Databank Information Information Data Fields 2007/6/30 32

33 Databank Information Browse Indices 2007/6/30 33

34 Databank Information Search term entered 2007/6/30 34

35 Databank Information 2007/6/30 35

36 Databank Information 2007/6/30 36

37 Quick Text Search 2007/6/30 37

38 SRS query language: index search Index queries can be targeted to specific data sources and to specific fields in them, or full entries (AllText) [database-field:searchterm], e.g, search all proteins in SwissProt with term "kinase" in the description field [swissprot-description:kinase] applicable database and field names can be found from the web-interface SRS is completely case-insensitive, this applies to search terms, database names, and field names Searchterms can be plain strings strings with wildcards regular expressions numeric range queries Searchterms can be combined with boolean operators Queries return sets of accession numbers or ids

39 SRS query language: expressions Wildcards: * matches any string,? matches any character Regular expressions are given within slashes /expr/ syntax similar to regular expressions in python (character classes []; grouping (); alternatives, repetitions *,+,?; beginning and end of word ^,*) Example: pattern /^[OPQ][0-9][A-Z0-9][A-Z0-9][A-Z0-9][0-9]$/ matches UniProt accession numbers Numeric ranges x:y (use hash-mark instead of colon between field name and search term) [medline-year#1999:2003] boundaries can be excluded with! in front of the boudary, e.g., 100:!200 means 100 and <200 either boundary may be omitted

40 SRS query language: operators Boolean operators: and(&), or( ), butnot(!) [swissprot-description:kinase!inhibitor] Linking [swissprot-description:kinase] > PATHWAY Searching multiple data sources (only field names common to all selected databases can be used) : [{swissprot embl}-description:kinase]

41 Query expressions Index queries (e.g., [embl-des:kinase!inhib*]) and full databases (e.g., pdb) are query expressions Query expressions can be combined with operators and grouped with parentheses to form more complex query expression The operators are: set intersection (&), union ( ), and subtraction (!) link-operators < and >

42 Quick Text Search 2007/6/30 42

43 List Search 2007/6/30 43

44 List Search 2007/6/30 44

45 Library Search Quick search input box Search types Databases 2007/6/30 45

46 Quick Search Search term entered UniProtKB Selected 2007/6/30 46

47 Quick Search 2007/6/30 47

48 Quick Search Search term entered UniProtKB selected Group expanded IPI selected 2007/6/30 48

49 Quick Search Results from multiple databases 2007/6/30 49

50 Standard Query Form Click on standard query form UniProtKB selected 2007/6/30 50

51 Standard Query Form Search options Input fields Predefined views Creating a view 2007/6/30 51

52 Standard Query Form Search terms Choosing fields 2007/6/30 52

53 Standard Query Form 2007/6/30 53

54 Standard Query Form Changed boolean logic 2007/6/30 54

55 Standard Query Form Changed view 2007/6/30 55

56 Standard Query Form 2007/6/30 56

57 Standard Query Form Change to list view Include sequence Choose sequence format 2007/6/30 57

58 Standard Query Form 2007/6/30 58

59 Standard Query Form - Subentries Subentry field 2007/6/30 59

60 Standard Query Form - Subentries 2007/6/30 60

61 Standard Query Form - Subentries 2007/6/30 61

62 Standard Query Form - Subentries 2007/6/30 62

63 Standard Query Form - Subentries Change type 2007/6/30 63

64 Standard Query Form - Subentries 2007/6/30 64

65 Standard Query Form - Subentries 2007/6/30 65

66 Extended Query Form Click on Extended query form UniProtKB selected 2007/6/30 66

67 Extended Query Form Special date field type User chosen fields Choose view type 2007/6/30 67

68 Extended Query Form 2007/6/30 68

69 Extended Query Form - Subentries 2007/6/30 69

70 Extended Query Form - Subentries 2007/6/30 70

71 Linking Link options Choose query Click link button 2007/6/30 71

72 Linking Databases to link to 2007/6/30 72

73 Linking 2007/6/30 73

74 Linking 2007/6/30 74

75 Linking 2007/6/30 75

76 Linking 2007/6/30 76

77 Views

78 Views

79 Query History Direct input of an SRS query Result options List of queries View options 2007/6/30 79

80 Rerun Query Choose query Choose view Click to rerun query 2007/6/30 80

81 Rerun Query 2007/6/30 81

82 Combine Queries Choose boolean logic to combine Click to combine Choose multiple queries 2007/6/30 82

83 Combine Queries 2007/6/30 83

84 Save Results Choose output to file or browser Choose output format 2007/6/30 84

85 Save Results 2007/6/30 85

86 Subentries Subentries are used when there is repeated structured information within an entry. Need to be able to search inside this structured information as if they were each isolated entries E.g. Searching for author Smith,A. publishing in Nature 2007/6/30 86

87 Subentries 2007/6/30 87

88 Subentries Another example features E.g. searching for key ACT_SITE and description phosphoserine 2007/6/30 88

89 Subentries 2007/6/30 89

90 BioMart Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

91 BioMart A collaboration Aim European Bioinformatics Institute (EBI) Cold Spring Harbor Laboratory (CSHL) To develop a generic data management system that works well for biology

92 Data model reversed star FK FK FK FK PK PK FK FK FK FK

93 Deployment Source data 1 Transformation

94 Transformation Tool

95 Deployment Source data 1 2 Transformation XML XML XML Configuration

96 Configuration Tool

97 Deployment Source data 1 2 Transformation XML XML XML Configuration 3 BioMart software Querying

98 Datasets, Attributes and Filters Mart Dataset GENE gene_id(pk) gene_stable_id gene_start gene_chrom_end chromosome gene_display_id description Attribute Filter

99 Data federation Dataset 1 Exportable name = uniprot_id attributes = uniprot_ac Links Dataset 2 Importable name = uniprot_id filters = uniprot_ac

100 Data federation Dataset 1 Exportable name=genomic_region attributes=chr_name, chr_start, chr_end Links Dataset 2 Importable name=genomic_region filters=chr_name (=), chr_start (>=), chr_end (<=)

101 Data Flow Desktop GUI Mart XML XML XML XML XML JAVA PERL Command line Web GUI Web Service

102 MartView

103 Examples Retrieve all SNPs for novel human G-protein coupled receptor genes (GPCRs IPR000276) on chromosome 2. Retrieve the sequences of the exons of the human MEFV gene in FASTA format. Retrieve the gene structure (i.e. start and end coordinates of exons) of the mouse gene ENSMUSG Retrieve all human disease genes containing transmembrane domains located between p11.2 and q22. The file contains a list of probeset IDs from a microarray experiment using the Affymetrix array HG-U133 Plus 2.0 (human). Retrieve the 500 bp upstream of the transcripts matching these probeset IDs. Retrieve the sequences 5kb upstream of all human known genes between D1S2806 and D1S464. Retrieve all human SNPs that have an ID from The SNP Consortium (TSC), from chromosome 6 between 15 Mb and 15.2 Mb, with 200 bases flanking sequence. Retrieve the mouse homologues of Homo sapiens genes CASP1, CASP2, CASP3, and CASP4.

104 Distributed Annotation System Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

105 Distributed Annotation System Developed in 1999/2000 by Lincoln Stein (CSHL) and collaborators as a GFF-based web service. Biodas.org (http://www.biodas.org): A client-server system in which a single client integrates information from multiple servers. It allows a single machine to gather up genome annotation information from multiple distant websites, collate the information, and display it to the user in a single view.

106 General Feature Format Genome annotations, especially structural annotations, are often stored in GFF (General Feature Format) files. GFF is a simple tab-delimited data format. Fields are: <seqname> <source> <feature> <start> <end> <score> <strand> <frame> [attributes] [comments] See also:

107 DAS Concept Annotation server A Annotation server B Annotation server C Client Reference server

108 DAS Registry

109 DAS Server DAS request to retrieve the data sources on a DAS server: Result:

110 DAS Server DAS request to retrieve features on a segment: segment=1:1, Result:

111 Das viewer

112 Links

113 Web services Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

114 RESTful web services GET, POST HTML,XML,PNG REST: REpresentational State Transfer

115 SOAP services SOAP: Simple Object Access Protocol fetchdata(uniprot,wap_rat,default,xml)

116 SOAP based architecture

117 WSDL structure <wsdl:definitions> <wsdl:types> <schema/> </wsdl:types> <wsdl:message> <wsdl:porttype> <wsdl:operation/> </wsdl:porttype> <wsdl:binding /> <wsdl:service /> </wsdl:definitions>

118 Messages <wsdl:message name="fetchdatarequest"> <wsdl:part name="query" type="xsd:string"/> <wsdl:part name="format" type="xsd:string"/> <wsdl:part name="style" type="xsd:string"/> </wsdl:message> <wsdl:message name="fetchdataresponse"> <wsdl:part name="fetchdatareturn" type="xsd:string"/> </wsdl:message>

119 PortType <wsdl:porttype name="wsdbfetchserver"> <wsdl:operation name="fetchdata" parameterorder="query format style"> <wsdl:input message="impl:fetchdatarequest" name="fetchdatarequest"/> <wsdl:output message="impl:fetchdataresponse" </wsdl:operation> </wsdl:porttype> name="fetchdataresponse"/>

120 Binding <wsdl:binding name="wsdbfetchsoapbinding" type="impl:wsdbfetchserver"> <wsdlsoap:binding style="rpc transport="http://schemas.xmlsoap.org/soap/http"/> <wsdl:operation name="fetchdata"> <wsdlsoap:operation soapaction=""/> <wsdl:input name="fetchdatarequest"> <wsdlsoap:body encodingstyle="http://schemas.xmlsoap.org/soap/encoding/" namespace="http://wsdbfetch.ws.jdbfetch.ebi.ac.uk" use="encoded"/> </wsdl:input> <wsdl:output name="fetchdataresponse"> <wsdlsoap:body encodingstyle="http://schemas.xmlsoap.org/soap/encoding/" namespace="http://www.ebi.ac.uk/ws/services/wsdbfetch" use="encoded"/> </wsdl:output> </wsdl:operation> </wsdl:binding>

121 Service <wsdl:service name="wsdbfetchserverlegacyservice"> <wsdl:port binding="impl:wsdbfetchsoapbinding" name="wsdbfetch"> <wsdlsoap:address location="http://www.ebi.ac.uk/ws/services/wsdbfetch"/> </wsdl:port> </wsdl:service>

122 Accessing EBI Web services Curso práctico de base de datos e integración de informacion biológica Segovia 4 de Julio de2007 Alberto Labarga EMBL-EBI

123 Overview Technologies REST DAS SOAP (rpc/enc, doc/lit) Services Dbfetch EB-Eye SRS Martservice EBI Tools (Blast, InterProScan, ClustalW)

124 Well, that is a RESTful web service GET, POST HTML,XML,PNG REST: REpresentational State Transfer

125 Any web page is a web service

126 Friendly URL and XML documents

127 Available databases EMBL Nucleotide Sequence Database (embl) EMBL CDS (emblcds) EMBL-Contig (emblcon) EMBL Annotated Contigs (emblann) EMBL Sequence Version Archive (emblsva) Genome Reviews (genomereviews) Human Genic Bi-Allelic Sequences Database (hgvbase) NCBI Reference Sequence refseq, refseqp International Protein Index (ipi) Uniprotkb (uniprot) UniProt Reference Clusters uniref100,uniref50, uniref90 UniProtKB Sequence/Annotation Version Archive (unisave) UniProtKB Archive (uniparc) Protein Data Bank (pdb) Patent Protein Sequences epo_prt, uspto_prt, jpo_prt Integrated Resource of Protein Domains and Functional Sites (interpro) Medline (medline)

128 REST client use LWP::UserAgent; use URI::URL; my $ua= LWP::UserAgent->new(); my $u= my $req = GET URI::URL->new($u); my $resp = $ua->request($req); print $resp->content();

129 MartService Overview information(get) Marts Datasets Configuration Queries (POST).

130 MartService Overview (GET) Marts?type=registry Datasets?type=datasets&mart=mymart Configuration?type=configuration&dataset=mydataset

131 Web service <Query virtualschemaname="central_server_1"> <Dataset name="hsapiens_gene_ensembl" > <Attribute name="ensembl_gene_id"/> <Attribute name="ensembl_transcript_id"/> <Filter name="chromosome_name" value="1"/> <Filter name="band_end" value= p36.33"/> <Filter name="band_start" value= q44"/> </Dataset> <Dataset name="msd"> <Attribute name="pdb_id"/> <Attribute name= experiment_type"/> <Filter name="experiment_type" value= NMR"/> </Dataset> </Query>

132 SRS wgetz Usage: wgetz [-ew] [-page wwwpagename] [-id userid] [-uname uname] [-gname gname] [-permuserid permuserid] [-l liblist] [-lib libname] [-entry entryname] [-i2f] [-dbg] [-dbr] [-dbs] [-dbt] [-dbw] [-lo] [- info libinfo] [-qfrom queryfrom] [-launchfrom launchfrom] [-lfrom linkfrom] [-from fromlibname] [-to tolibname] [-f fieldlist] [-bv viewentriesstartn] [-lv viewentrieschunksize] [-lset listsetnumber] [-sf seqformat] [-q querystring] [-mime mimetype] [-qnum querynumber] [-enum entrynumber] [-snum sessionnumber] [-vt] [-vn viewnumber] [- view viewname] [-rs viewrecordsep] [-cs viewcolumnsep] [-bf browseindex] [-blib browselibs] [-ifile icarusfiletype] [-newid] [-appl appl] [-package package] [-version] [-codestrings] [-off] [-bioscout bioscoutid] [-jobname jobname] [-debug] [-ascii] [-ldrname loadername] [-sort sorton] [-sortdir sortdir] [-sqlimage sqlimage] [- pman projman] [-fman fromman] [-dlout] [-dlkey dlkey] [-nosession] 'queryexpression'

133 SRS wgetz -e+[swissprot-acc:p32234] -e+[swissprot-acc:p32234]+-ascii -e+[swissprot-acc:p32234]+-vn+1 (get IDs) -e+[swissprot-acc:p32234]+-vn+2 (get entries) -e+[swissprot-acc:p32234]+-vn+4 (get sequence)

134 SRS wgetz +-page+cresult+-ascii (count results) +-view+sequencesimple (get sequences) -permuserid+segovia2007 (use saved queries and views)

135 Perl client use LWP::Simple; my $srs="http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz"; my $id = "SEGOVIA2007"; my $query = "[interpro:*]"; my $view= "FAMILIAS"; # permuserid+segovia2007+-ascii+-view+familias+[interpro-id:] my $url = $srs?-permuserid+ $id+-ascii+-view+$view+$query"; print get $url;

136 DAS Perl client use LWP::Simple; use XML::Simple; $s="http://www.ebi.ac.uk/das-srv/uniprot/das/aristotle/sequence?segment=p00280"; $f="http://www.ebi.ac.uk/das-srv/uniprot/das/aristotle/features?segment=p00280"; $xml = new XML::Simple; my $features = $xml->xmlin(get $f); my $sequence = $xml->xmlin(get $s); print $sequence->{sequence}->{content}; my $list = $features->{gff}->{segment}->{feature}; foreach $feature (keys %$list){ print "$feature: "; print "$list->{$feature}->{start} $list->{$feature}->{end}\n"; }

137 SOAP services SOAP: Simple Object Access Protocol fetchdata(uniprot,wap_rat,default,xml)

138 wsdbfetch entry fetchdata (db, id, format, style)

139 wsdbfetch fetchdata dbname:id <output format> <output style> fetchbatch dbname 'id1;id2' <format> <style> getsupporteddbs getdbformats dbname getformatstyles dbname format

140 Perl client use SOAP::Lite; my $WSDL='http://www.ebi.ac.uk/Tools/webservices/wsdl/WSDbfetch.wsdl'; my $soap = SOAP::Lite->service($WSDL); # fetchdata dbname:id <format> <style> my $result = $soap->fetchdata( uniprot, default, raw ); die $soap->call->faultstring if $soap->call->fault; foreach my $i { print "$i\n"; }

141 Python from SOAPpy import WSDL wsdl ="http://www.ebi.ac.uk/tools/webservices/wsdl/wsdbfetch.wsdl") dbfetch = WSDL.Proxy(wsdl) resultlist = dbfetch.fetchdata("uniprot:slpi_human", "fasta", "raw") for result in resultlist: print result Ruby require 'soap/wsdldriver' wsdl = 'http://www.ebi.ac.uk/tools/webservices/wsdl/wsdbfetch.wsdl' dbfetchsoap = SOAP::WSDLDriverFactory.new(wsdl).create_rpc_driver puts dbfetchsoap.fetchdata("uniprot:slpi_human", "fasta", "default")

142 EBI web services (global search) getresultsids (db, query) ids getresults (db, query) results

143 Web Services API: Metadata List available domains (i.e. available for query in EB-eye) String[] listdomains() > listdomains() 2can arrayexpress-experiments arrayexpress-genes arrayexpress-repository biomodels chebi emblcds embldeleted emblnew_con emblnew_standard emblnew_wgs emblrelease_con List available fields in a domain (e.g. id, description ) String[] listfields(string domain) > listfields( msdpdb ) id acc_number name description

144 Web Services API: Metadata Get referenced domains in a domain or an entry (i.e. EB-eye domains referenced in a domain or an entry) String[] getdomainsreferencedindomain(string domain) String[] getdomainsreferencedinentry(string domain, > getdomainsreferencedindomain( msdpdb ) String entryid) go intenz interpro medlinenew medlinerelease msdpdb taxonomy uniprot List additional databases referenced in a domain (i.e. non EB-eye domains referenced in a domain) > listadditionalreferencefields( msdpdb ) String[] listadditionalreferencefields(string domain) CATH PFAM SCOP

145 Web Services API: Basic Full-text Search Get number of results for a simple query int getnumberofresults(string domain, String query) > getnumberofresults( msdpdb, dopamine ) 18 List result IDs for a simple query String[] getresultsids(string domain, String query, int start, int size) > getresultsids( msdpdb, dopamine, 0, 3) List result fields values for a simple query String[][] getresults(string domain, String query, String[] fields, int start, int size) > getresults( msdpdb, dopamine, [ id, acc_number, name, description ], 0, 3) "60734" "2a3r" "CRYSTAL STRUCTURE OF HUMAN " "TRANSFERASE XRAY entry at resolution 2.6" "14833" "5pah" "HUMAN PHENYLALANINE " "MONOOXYGENASE XRAY entry at resolution 2.1" "12412" "1i15" "DOPAMINE D2 RECEPTOR " "SIGNALING PROTEIN TMODEL entry at resolution "

146 Web Services API: Entry Search Get result fields values for a particular entry String[] getentry(string domain, String entryid, String[] > fields) getentry( uniprot, NR1H2_HUMAN, [ id, acc_number, description ]) NR1H2_HUMAN P55055 Oxysterols receptor LXR-beta (Liver X receptor beta) (Nuclear orphanreceptor LXR-beta) Get result fields values for a list a entries String[][] getentries(string domain, String[] entryids, > getentries( uniprot, [ NR1H2_HUMAN, Q8BP65_MOUSE, Q8AXU8_CHICK ], String[] fields) > [ id, acc_number, description ]) "NR1H2_HUMAN" "P55055" "Oxysterols receptor LXR-beta (Liver X receptor beta) (Nuclear..." "Q8BP65_MOUSE" "Q8BP65" "8 days embryo whole body cdna, RIKEN full-length enriched... " "Q8AXU8_CHICK" "Q8AXU8" "Liver X receptor alpha."

147 Web Services API: Cross-references Search Get referenced entries for a domain in a particular entry String[] getreferencedentries(string domain, String > entryid, getreferencedentries String ( uniprot, referenceddomain) NR1H2_HUMAN, medlinerelease )

148 Eb-Eye perl client use SOAP::Lite; my $namespace = 'http://webservice.ebinocle.ebi.ac.uk'; my $endpoint = 'http://www.ebi.ac.uk/ebisearch/service.ebi'; my $search = SOAP::Lite-> uri($namespace)-> proxy($endpoint); my $result = $search->getresultsids("uniprot", "kinase", 0, 100); = $result->valueof('//getresultsidsresponse//out//string'); foreach $id print "$id\n"; }

149 EBI web services (analysis tools) run(params, data) jobid checkstatus (jobid) status getresults (jobid) results available poll (jobid, type) result file

150 Perl use SOAP::Lite; my $WSDL = 'http://www.ebi.ac.uk/tools/webservices/wsdl/wsfasta.wsdl'; my $fasta_client = SOAP::Lite->service($WSDL); my %params=(); $params{'program'}='fasta3'; $params{'database'}='uniprot'; $params{ async'}= 1; $data={type=>"sequence", content=>"mrcsislvlgllalevalarnlqehvfnsvqsmcsddsfsedteci"}; # $data={type=>"sequence", # content=> uniprot:slpi_human"}; my $jobid = $fasta_client >runfasta( SOAP::Data->name('params')->type(map=>\%params), SOAP::Data->name( content => [$data])); print $fasta_client->poll($jobid);

151 Perl client (cont.) # set a loop for checking job submission status # RUNNING, NOT_FOUND, ERROR, DONE my $status = $fasta_client ->checkstatus($jobid); while (status eq "RUNNING") { sleep 10; $status = $fasta_client->checkstatus($jobid); } # when job is done, poll for the results my $result = $fasta_client ->poll($jobid) if ($status eq "DONE") ; print $result;

152 Perl client (cont.) my $results = $fasta_client->getresults($jobid); die $soap->call->faultstring if $soap->call->fault; for $result # tooloutput, toolxml, toolaln, toolpng $res= $fasta_client->poll($jobid,$result->{type}); write_file($outfile.".".$result->{ext},$res); }

153 REST client use LWP::UserAgent; use use use URI:URL; $URL="http://www.ebi.ac.uk/Tools/webservices/rest/submit"; my %params=(); $params{'tool'}="iprscan"; $params{'sequence'}="uniprot:slpi_human"; $ua= LWP::UserAgent->new(); $submit_url= URI::URL->new($URL); $resp = $ua->request( POST $submit_url, 'Content' => print $resp->content();

154 Available Services Ensembl Ensembl (Martservice Martservice) (Martservice Martservice) Data Data Retrieval Retrieval (WSDbfetch WSDbfetch) (WSDbfetch WSDbfetch) Uniprot Uniprot API API Search Search (EB-Eye) (EB-Eye) Sequence Sequence homology homology WSWUBlast WSWUBlast WSFasta WSFasta WSMPsrch WSMPsrch WSScanPS WSScanPS Expression Expression Profiler Profiler Integr8 Integr8 API API Wise, Wise, PromoterWise, PromoterWise, ScanWise ScanWise Protein Protein families, families, motifs motifs and and domains domains (WSInterProScan WSInterProScan) (WSInterProScan WSInterProScan) Literature Literature and and text text mining mining (Whatizit Whatizit, (Whatizit Whatizit, CiteXplore) CiteXplore) Ontologies Ontologies (OntologyLookup ( OntologyLookup) (OntologyLookup ( OntologyLookup) Protein Protein structure structure & & function: function: (MSD (MSD API) API) DaliLite, DaliLite, Maxsprout Maxsprout ChEBI ChEBI API API Sequence Sequence alignment alignment WSClustalW WSClustalW WSMuscle WSMuscle WSTCoffee WSTCoffee Sequence Sequence analysis analysis (WSEmboss) (WSEmboss) ID ID mapping mapping (Picr ( Picr, (Picr ( Picr, Martservice) Martservice)

155 Text output

156 XML results

157 Documentation

Joke Server example. with Java and Axis. Web services with Axis SOAP, WSDL, UDDI. Joke Metaservice Joke Server Joke Client.

Joke Server example. with Java and Axis. Web services with Axis SOAP, WSDL, UDDI. Joke Metaservice Joke Server Joke Client. Joke Server example SOAP and WSDL with Java and Axis Interactive web services, Course, Fall 2003 Henning Niss Joke Metaservice Joke Server Joke Client 3 meta service 2 IT University of Copenhagen client

More information

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr

Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information

More information

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.

The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

API Guide. SilkCentral Test Manager

API Guide. SilkCentral Test Manager API Guide SilkCentral Test Manager 2008 Borland Software Corporation 8303 N. Mopac Expressway, Suite A-300 Austin, TX 78759-8374 http://www.borland.com Borland Software Corporation may have patents and/or

More information

T320 E-business technologies: foundations and practice

T320 E-business technologies: foundations and practice T320 E-business technologies: foundations and practice Block 3 Part 1 Activity 5: Implementing a simple web service Prepared for the course team by Neil Simpkins Introduction 1 Components of a web service

More information

Web Services Servizio Telematico Doganale

Web Services Servizio Telematico Doganale Web Services Servizio Telematico Doganale USER MANUAL Pagina 1 di 20 Contents 1 Introduction... 3 2 Functional testing of web services... 6 3 Creating the client... 10 3.1 Open Source solutions... 10 3.2

More information

Library page. SRS first view. Different types of database in SRS. Standard query form

Library page. SRS first view. Different types of database in SRS. Standard query form SRS & Entrez SRS Sequence Retrieval System Bengt Persson Whatis SRS? Sequence Retrieval System User-friendly interface to databases http://srs.ebi.ac.uk Developed by Thure Etzold and co-workers EMBL/EBI

More information

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.

org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers. org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank

More information

EMBL-EBI Web Services

EMBL-EBI Web Services EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher

More information

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome

Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

The Ensembl Core databases and API

The Ensembl Core databases and API The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html

More information

Web Services at the European Bioinformatics Institute

Web Services at the European Bioinformatics Institute W6 W11 Nucleic Acids Research, 2007, Vol. 35, Web Server issue doi:10.1093/nar/gkm291 Web Services at the European Bioinformatics Institute Alberto Labarga, Franck Valentin, Mikael Anderson and Rodrigo

More information

Module 1. Sequence Formats and Retrieval. Charles Steward

Module 1. Sequence Formats and Retrieval. Charles Steward The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.

More information

Linear Sequence Analysis. 3-D Structure Analysis

Linear Sequence Analysis. 3-D Structure Analysis Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic

More information

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011

Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011 Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison

Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Contents. ISiLS Lecture 12. Genome Browsers. Data Integration. Genome browsers Solutions for integration CORBA SOAP DAS Ontology mapping

Contents. ISiLS Lecture 12. Genome Browsers. Data Integration. Genome browsers Solutions for integration CORBA SOAP DAS Ontology mapping Contents ISiLS Lecture 12 short introduction to data integration F.J. Verbeek Genome browsers Solutions for integration CORBA SOAP DAS Ontology mapping 2 nd lecture BioASP roadshow 1 2 Human Genome Browsers

More information

A Tutorial in Genetic Sequence Classification Tools and Techniques

A Tutorial in Genetic Sequence Classification Tools and Techniques A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

SilkCentral Test Manager 2009 SP1. API Help

SilkCentral Test Manager 2009 SP1. API Help SilkCentral Test Manager 2009 SP1 API Help Borland Software Corporation 4 Hutton Centre Dr., Suite 900 Santa Ana, CA 92707 Copyright 2009 Micro Focus (IP) Limited. All Rights Reserved. SilkCentral Test

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

An agent-based layered middleware as tool integration

An agent-based layered middleware as tool integration An agent-based layered middleware as tool integration Flavio Corradini Leonardo Mariani Emanuela Merelli University of L Aquila University of Milano University of Camerino ITALY ITALY ITALY Helsinki FSE/ESEC

More information

Processing Genome Data using Scalable Database Technology. My Background

Processing Genome Data using Scalable Database Technology. My Background Johann Christoph Freytag, Ph.D. freytag@dbis.informatik.hu-berlin.de http://www.dbis.informatik.hu-berlin.de Stanford University, February 2004 PhD @ Harvard Univ. Visiting Scientist, Microsoft Res. (2002)

More information

Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova

Using the Grid for the interactive workflow management in biomedicine. Andrea Schenone BIOLAB DIST University of Genova Using the Grid for the interactive workflow management in biomedicine Andrea Schenone BIOLAB DIST University of Genova overview background requirements solution case study results background A multilevel

More information

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013

NCBI resources III: GEO and ftp site. Yanbin Yin Spring 2013 NCBI resources III: GEO and ftp site Yanbin Yin Spring 2013 1 Homework assignment 2 Search colon cancer at GEO and find a data Series and perform a GEO2R analysis Write a report (in word or ppt) to include

More information

ICE Trade Vault. Public User & Technology Guide June 6, 2014

ICE Trade Vault. Public User & Technology Guide June 6, 2014 ICE Trade Vault Public User & Technology Guide June 6, 2014 This material may not be reproduced or redistributed in whole or in part without the express, prior written consent of IntercontinentalExchange,

More information

Data formats and file conversions

Data formats and file conversions Building Excellence in Genomics and Computational Bioscience s Richard Leggett (TGAC) John Walshaw (IFR) Common file formats FASTQ FASTA BAM SAM Raw sequence Alignments MSF EMBL UniProt BED WIG Databases

More information

Converting GenMAPP MAPPs between species using homology

Converting GenMAPP MAPPs between species using homology Converting GenMAPP MAPPs between species using homology 1 Introduction and Background 2 1.1 Fundamental principles of the GenMAPP Gene Database 2 1.1.1 Gene Database data types 2 1.1.2 GenMAPP System Codes

More information

Applying data integration into reconstruction of gene networks from micro

Applying data integration into reconstruction of gene networks from micro Applying data integration into reconstruction of gene networks from microarray data PhD Thesis Proposal Dipartimento di Informatica e Scienze dell Informazione Università degli Studi di Genova December

More information

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009

Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html

More information

Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer)

Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer) APID (Agile Protein Interaction DataAnalyzer) 23 APID (Agile Protein Interaction DataAnalyzer) Integrates and unifies 7 DBs: BIND, DIP, HPRD, IntAct, MINT, BioGRID. Includes 51,873 proteins 241,204 interactions

More information

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk

Three data delivery cases for EMBL- EBI s Embassy. Guy Cochrane www.ebi.ac.uk Three data delivery cases for EMBL- EBI s Embassy Guy Cochrane www.ebi.ac.uk EMBL European Bioinformatics Institute Genes, genomes & variation European Nucleotide Archive 1000 Genomes Ensembl Ensembl Genomes

More information

Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London

Distributed Data Mining in Discovery Net. Dr. Moustafa Ghanem Department of Computing Imperial College London Distributed Data Mining in Discovery Net Dr. Moustafa Ghanem Department of Computing Imperial College London 1. What is Discovery Net 2. Distributed Data Mining for Compute Intensive Tasks 3. Distributed

More information

UGENE Quick Start Guide

UGENE Quick Start Guide Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.

More information

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015

Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015 Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference

More information

Product Navigator User Guide

Product Navigator User Guide Product Navigator User Guide Table of Contents Contents About the Product Navigator... 1 Browser support and settings... 2 Searching in detail... 3 Simple Search... 3 Extended Search... 4 Browse By Theme...

More information

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques

A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web

More information

Distributed Embedded Systems

Distributed Embedded Systems Distributed Embedded Systems Computer Architecture and Operating Systems 2 Content 1. Motivation 2. An Overview of Distributed Software Architecture Approaches 2.1 Pro & Contra Middleware 2.2 Message-Based

More information

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment

Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249

More information

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures

ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected

More information

Guide for Bioinformatics Project Module 3

Guide for Bioinformatics Project Module 3 Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first

More information

Yale Pseudogene Analysis as part of GENCODE Project

Yale Pseudogene Analysis as part of GENCODE Project Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale

More information

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr

Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM lecrom@biologie.ens.fr Lecture 11 Data storage and LIMS solutions Stéphane LE CROM lecrom@biologie.ens.fr Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog

More information

Biological Databases and Protein Sequence Analysis

Biological Databases and Protein Sequence Analysis Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to

More information

GeneProf and the new GeneProf Web Services

GeneProf and the new GeneProf Web Services GeneProf and the new GeneProf Web Services Florian Halbritter florian.halbritter@ed.ac.uk Stem Cell Bioinformatics Group (Simon R. Tomlinson) simon.tomlinson@ed.ac.uk December 10, 2012 Florian Halbritter

More information

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.

Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac. Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.uk Introduc.on Genome browsing The Ensembl gene set Guided examples

More information

10CS73:Web Programming

10CS73:Web Programming 10CS73:Web Programming Question Bank Fundamentals of Web: 1.What is WWW? 2. What are domain names? Explain domain name conversion with diagram 3.What are the difference between web browser and web server

More information

Databases and mapping BWA. Samtools

Databases and mapping BWA. Samtools Databases and mapping BWA Samtools FASTQ, SFF, bax.h5 ACE, FASTG FASTA BAM/SAM GFF, BED GenBank/Embl/DDJB many more File formats FASTQ Output format from Illumina and IonTorrent sequencers. Quality scores:

More information

MarkLogic Server. Query Console User Guide. MarkLogic 8 February, 2015. Copyright 2015 MarkLogic Corporation. All rights reserved.

MarkLogic Server. Query Console User Guide. MarkLogic 8 February, 2015. Copyright 2015 MarkLogic Corporation. All rights reserved. Query Console User Guide 1 MarkLogic 8 February, 2015 Last Revised: 8.0-1, February, 2015 Copyright 2015 MarkLogic Corporation. All rights reserved. Table of Contents Table of Contents Query Console User

More information

Clone Manager. Getting Started

Clone Manager. Getting Started Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software

More information

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin

Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin

More information

Searching Nucleotide Databases

Searching Nucleotide Databases Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames

More information

CPAS Overview. Josh Eckels LabKey Software jeckels@labkey.com

CPAS Overview. Josh Eckels LabKey Software jeckels@labkey.com CPAS Overview Josh Eckels LabKey Software jeckels@labkey.com CPAS Web-based system for processing, storing, and analyzing results of MS/MS experiments Key goals: Provide a great analysis front-end for

More information

This document presents the new features available in ngklast release 4.4 and KServer 4.2.

This document presents the new features available in ngklast release 4.4 and KServer 4.2. This document presents the new features available in ngklast release 4.4 and KServer 4.2. 1) KLAST search engine optimization ngklast comes with an updated release of the KLAST sequence comparison tool.

More information

Oracle Service Bus. User Guide 10g Release 3 Maintenance Pack 1 (10.3.1) June 2009

Oracle Service Bus. User Guide 10g Release 3 Maintenance Pack 1 (10.3.1) June 2009 Oracle Service Bus User Guide 10g Release 3 Maintenance Pack 1 (10.3.1) June 2009 Oracle Service Bus User Guide, 10g Release 3 Maintenance Pack 1 (10.3.1) Copyright 2007, 2008, Oracle and/or its affiliates.

More information

Data Discovery on the Information Highway

Data Discovery on the Information Highway Data Discovery on the Information Highway Susan Gauch Introduction Information overload on the Web Many possible search engines Need intelligent help to select best information sources customize results

More information

G563 Quantitative Paleontology. SQL databases. An introduction. Department of Geological Sciences Indiana University. (c) 2012, P.

G563 Quantitative Paleontology. SQL databases. An introduction. Department of Geological Sciences Indiana University. (c) 2012, P. SQL databases An introduction AMP: Apache, mysql, PHP This installations installs the Apache webserver, the PHP scripting language, and the mysql database on your computer: Apache: runs in the background

More information

Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices

Pipeline Pilot Enterprise Server. Flexible Integration of Disparate Data and Applications. Capture and Deployment of Best Practices overview Pipeline Pilot Enterprise Server Pipeline Pilot Enterprise Server (PPES) is a powerful client-server platform that streamlines the integration and analysis of the vast quantities of data flooding

More information

JustClust User Manual

JustClust User Manual JustClust User Manual Contents 1. Installing JustClust 2. Running JustClust 3. Basic Usage of JustClust 3.1. Creating a Network 3.2. Clustering a Network 3.3. Applying a Layout 3.4. Saving and Loading

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Apply PERL to BioInformatics (II)

Apply PERL to BioInformatics (II) Apply PERL to BioInformatics (II) Lecture Note for Computational Biology 1 (LSM 5191) Jiren Wang http://www.bii.a-star.edu.sg/~jiren BioInformatics Institute Singapore Outline Some examples for manipulating

More information

Building and Using Web Services With JDeveloper 11g

Building and Using Web Services With JDeveloper 11g Building and Using Web Services With JDeveloper 11g Purpose In this tutorial, you create a series of simple web service scenarios in JDeveloper. This is intended as a light introduction to some of the

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information

Data integration for metagenomics: current status and future plans

Data integration for metagenomics: current status and future plans integration for metagenomics: current status and future plans Neil Wipat Computing Science University of Newcastle NERC Microbial Metagenomics Overview metamicrobase Current method of data integration

More information

K@ A collaborative platform for knowledge management

K@ A collaborative platform for knowledge management White Paper K@ A collaborative platform for knowledge management Quinary SpA www.quinary.com via Pietrasanta 14 20141 Milano Italia t +39 02 3090 1500 f +39 02 3090 1501 Copyright 2004 Quinary SpA Index

More information

Biological Abstracts. Quick Reference Card ISI WEB OF KNOWLEDGE SM. 1 Search

Biological Abstracts. Quick Reference Card ISI WEB OF KNOWLEDGE SM. 1 Search Biological Abstracts Quick Reference Card ISI WEB OF KNOWLEDGE SM Biological Abstracts offers researchers, educators, students, and information professionals comprehensive coverage of life sciences research

More information

Firewall Builder Architecture Overview

Firewall Builder Architecture Overview Firewall Builder Architecture Overview Vadim Zaliva Vadim Kurland Abstract This document gives brief, high level overview of existing Firewall Builder architecture.

More information

Managing DICOM Image Metadata with Desktop Operating Systems Native User Interface

Managing DICOM Image Metadata with Desktop Operating Systems Native User Interface Managing DICOM Image Metadata with Desktop Operating Systems Native User Interface Chia-Chi Teng, Member, IEEE Abstract Picture Archiving and Communication System (PACS) is commonly used in the hospital

More information

DiskPulse DISK CHANGE MONITOR

DiskPulse DISK CHANGE MONITOR DiskPulse DISK CHANGE MONITOR User Manual Version 7.9 Oct 2015 www.diskpulse.com info@flexense.com 1 1 DiskPulse Overview...3 2 DiskPulse Product Versions...5 3 Using Desktop Product Version...6 3.1 Product

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Web Services API Developer Guide

Web Services API Developer Guide Web Services API Developer Guide Contents 2 Contents Web Services API Developer Guide... 3 Quick Start...4 Examples of the Web Service API Implementation... 13 Exporting Warehouse Data... 14 Exporting

More information

Check Your Data Freedom: A Taxonomy to Assess Life Science Database Openness

Check Your Data Freedom: A Taxonomy to Assess Life Science Database Openness Check Your Data Freedom: A Taxonomy to Assess Life Science Database Openness Melanie Dulong de Rosnay Fellow, Science Commons and Berkman Center for Internet & Society at Harvard University This article

More information

Search and Information Retrieval

Search and Information Retrieval Search and Information Retrieval Search on the Web 1 is a daily activity for many people throughout the world Search and communication are most popular uses of the computer Applications involving search

More information

Search & Export Report Data

Search & Export Report Data Search & Export Report Data Version: Draft 2 Abstract This document describes how to export the data from a saved report document. Document Revisions Version Date Description of Changes Draft 2 08/12/2005

More information

Introduction. Overview of Bioconductor packages for short read analysis

Introduction. Overview of Bioconductor packages for short read analysis Overview of Bioconductor packages for short read analysis Introduction General introduction SRAdb Pseudo code (Shortread) Short overview of some packages Quality assessment Example sequencing data in Bioconductor

More information

Searching your Archive in Outlook (Normal)

Searching your Archive in Outlook (Normal) Searching your Archive in Outlook (Normal) 1. View the Archive Add in toolbar. In Outlook 2007, the toolbar displays below the standard Outlook toolbars. In Outlook 2010, select the McAfee tab. 2. In the

More information

OvidSP Quick Reference Guide

OvidSP Quick Reference Guide OvidSP Quick Reference Guide Opening an OvidSP Session Open the OvidSP URL with a browser or Follow a link on a web page or Use Athens or Shibboleth access Select Resources to Search In the Select Resource(s)

More information

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at

Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/

More information

EMC Documentum Content Services for SAP iviews for Related Content

EMC Documentum Content Services for SAP iviews for Related Content EMC Documentum Content Services for SAP iviews for Related Content Version 6.0 Administration Guide P/N 300 005 446 Rev A01 EMC Corporation Corporate Headquarters: Hopkinton, MA 01748 9103 1 508 435 1000

More information

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly

On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly On-line supplement to manuscript Galaxy for collaborative analysis of ENCODE data: Making large-scale analyses biologist-friendly DANIEL BLANKENBERG, JAMES TAYLOR, IAN SCHENCK, JIANBIN HE, YI ZHANG, MATTHEW

More information

Bindings for the Service Provisioning Markup Language (SPML) Version 1.0

Bindings for the Service Provisioning Markup Language (SPML) Version 1.0 1 2 3 Bindings for the Service Provisioning Markup Language (SPML) Version 1.0 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 OASIS Standard, Approved October 2003 Document identifier:

More information

DiskSavvy Disk Space Analyzer. DiskSavvy DISK SPACE ANALYZER. User Manual. Version 8.7. Jun Flexense Ltd.

DiskSavvy Disk Space Analyzer. DiskSavvy DISK SPACE ANALYZER. User Manual. Version 8.7. Jun Flexense Ltd. DiskSavvy DISK SPACE ANALYZER User Manual Version 8.7 Jun 2016 www.disksavvy.com info@flexense.com 1 1 Product Overview...3 2 Product Versions...7 3 Using Desktop Versions...8 3.1 Product Installation

More information

Web-Service Example. Service Oriented Architecture

Web-Service Example. Service Oriented Architecture Web-Service Example Service Oriented Architecture 1 Roles Service provider Service Consumer Registry Operations Publish (by provider) Find (by requester) Bind (by requester or invoker) Fundamentals Web

More information

5.1 Features 1.877.204.6679. sales@fourwindsinteractive.com Denver CO 80202

5.1 Features 1.877.204.6679. sales@fourwindsinteractive.com Denver CO 80202 1.877.204.6679 www.fourwindsinteractive.com 3012 Huron Street sales@fourwindsinteractive.com Denver CO 80202 5.1 Features Copyright 2014 Four Winds Interactive LLC. All rights reserved. All documentation

More information

Data Integration of Bioinformatics Database Based on Web Services

Data Integration of Bioinformatics Database Based on Web Services Data Integration of Bioinformatics Database Based on Web Services Yuelan Liu, Jian hua Wang College of Computer, Harbin Normal University Intelligent Education Information Technology Emphases Lab of Heilongjiang

More information

Web Services for Management Perl Library VMware ESX Server 3.5, VMware ESX Server 3i version 3.5, and VMware VirtualCenter 2.5

Web Services for Management Perl Library VMware ESX Server 3.5, VMware ESX Server 3i version 3.5, and VMware VirtualCenter 2.5 Technical Note Web Services for Management Perl Library VMware ESX Server 3.5, VMware ESX Server 3i version 3.5, and VMware VirtualCenter 2.5 In the VMware Infrastructure (VI) Perl Toolkit 1.5, VMware

More information

Scientific databases. Biological data management

Scientific databases. Biological data management Scientific databases Biological data management The term paper within the framework of the course Principles of Modern Database Systems by Aleksejs Kontijevskis PhD student The Linnaeus Centre for Bioinformatics

More information

MDM Server Web Services Reference Guide (Internal)

MDM Server Web Services Reference Guide (Internal) D Server Web Services Reference Guide (Internal) Version 2.1 obile Device anager 2.1 obile Device Sync anager 1.2 obile Consumer Device anagement Template 1.2 obile Device Backup & Restore Template 1.1

More information

ORACLE USER PRODUCTIVITY KIT USAGE TRACKING ADMINISTRATION & REPORTING RELEASE 3.6 PART NO. E17087-01

ORACLE USER PRODUCTIVITY KIT USAGE TRACKING ADMINISTRATION & REPORTING RELEASE 3.6 PART NO. E17087-01 ORACLE USER PRODUCTIVITY KIT USAGE TRACKING ADMINISTRATION & REPORTING RELEASE 3.6 PART NO. E17087-01 FEBRUARY 2010 COPYRIGHT Copyright 1998, 2009, Oracle and/or its affiliates. All rights reserved. Part

More information

Comparing Methods for Identifying Transcription Factor Target Genes

Comparing Methods for Identifying Transcription Factor Target Genes Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF

More information

Web-Programmierung (WPR)

Web-Programmierung (WPR) Web-Programmierung (WPR) Vorlesung X. Web Services Teil 2 mailto:wpr@gruner.org 1 21 Web Service World Wide Web seit Anfang 1990er Jahren Mensch Web-Browser Applikation HTTP XML over HTTP Web-Server Geschäftslogik

More information

FileMaker Server 15. Custom Web Publishing Guide

FileMaker Server 15. Custom Web Publishing Guide FileMaker Server 15 Custom Web Publishing Guide 2004 2016 FileMaker, Inc. All Rights Reserved. FileMaker, Inc. 5201 Patrick Henry Drive Santa Clara, California 95054 FileMaker and FileMaker Go are trademarks

More information