Molecular detection of poisonous mushrooms in different matrices

Mycologia, 102(3), 2010, pp. 747 754. DOI: 10.3852/09-124 # 2010 by The Mycological Society of America, Lawrence, KS 66044-8897 Molecular detection of poisonous mushrooms in different matrices Sara Epis 1 Dipartimento di Patologia Animale, Igiene e Sanità Pubblica Veterinaria, Università degli studi di Milano, Milano, Italy Caterina Matinato Responsabile U.O. Preparazione terreni di coltura Laboratorio di Sanità Pubblica, ASL di Milano, Italy Gabriella Gentili Responsabile U.O. Microbiologia Clinica, Sezione Specialistica di Micologia, Laboratorio di Sanità Pubblica, ASL di Milano, Italy Fabio Varotto Responsabile Servizio medico, Laboratorio di Sanità Pubblica, ASL di Milano, Italy Claudio Bandi Davide Sassera 2 Dipartimento di Patologia Animale, Igiene e Sanità Pubblica Veterinaria, Università degli studi di Milano, Milano, Italy Abstract: Amanita phalloides, Lepiota cristata, Lepiota brunneoincarnata and Inocybe asterospora are among the most important species responsible of mushroom poisoning in northern Italy. A real time PCR method for the identification of samples containing DNA from each of these species was developed. To test specificity all protocols were applied on DNA extracted from various mushroom species; sensitivity was assessed performing serial dilutions on all samples; versatility of the protocols was evaluated performing tests on DNA extracted from different matrices. The protocols showed high sensitivity (32 ng dried mushroom), high specificity and sensitive detection of DNA extracted from difficult samples, including pasta with mushroom, cooked mushrooms and gastric aspirates. Key words: Basidiomycetes, poisonous mushrooms, real time PCR, species identification INTRODUCTION Poisonous mushrooms are routinely identified by specialized mycologists based on their morphological characters, but the samples examined in the context Submitted 14 Sep 2009; accepted for publication 27 Oct 2009. 1 Current address: Dipartimento di Medicina Sperimentale e Sanità Pubblica, Università degli Studi di Camerino, Camerino, Italy. 2 Corresponding author. E-mail: davide.sassera@unimi.it of clinical diagnosis are generally not well preserved and thus frequently unsuitable for a rapid morphological identification. Furthermore morphological examination is time consuming and requires the professional knowledge of a mycologist. The analysis of cooked mushrooms or of gastric aspirates from poisoned patients is particularly difficult because the spores are often few and their morphology generally is altered (Hall et al. 1987, Barbato 1993, McPartland et al. 1997). This paper presents novel primer pairs and a real time PCR method for the detection of four species of poisonous mushrooms that are a common cause of human intoxication in Italy, Amanita phalloides, Lepiota cristata, Lepiota brunneoincarnata and Inocybe asterospora. In Italy 1996 2006 about 10 000 cases of mushroom poisoning were reported to the Centro Antiveleni of Milano. About 2400 of these cases showed a long incubation period; 22 cases resulted in the death of the patients; and nine required liver transplants due to severe hepatic insufficiency (Assisi et al. 2008). In northern Italy 2005 2008 15% cases have been caused by mushroom genera Lepiota, Amanita and Inocybe (data recorded at the Mycology Section, Laboratorio di Sanità Pubblica of Milano, ASL Via F. Juvara, 22 20129 Milano). Toxic mushrooms of genus Lepiota often are mistaken for the edible mushrooms of genus Macrolepiota and thus are common cause of poisoning. Similarly A. phalloides can be misidentified as an edible species of genera Amanita, Lepiota or Russula, thus causing 8% of the total fungal poisonings in Italy (Assisi et al. 2008). I. asterospora is widespread in northern Italy (data recorded by the Associazione Micologica Bresadola, Varese; http://digilander.libero. it/ambvarese/index.htm) and can be misidentified as Armillaria spp. The above poisonous fungi are characterized by different toxicity; A. phalloides, L. cristata and L. brunneoincarnata cause severe poisoning characterized by a lengthy incubation (Karlson-Stiber et al. 2003, Roux et al. 2008); I. asterospora causes milder symptoms with short latency, from 15 min to 4 h (Lurie et al. 2009). The availability of molecular techniques for the identification of poisonous fungi would support and integrate the work of the mycologist in cases of clinical poisoning. In this study we developed a rapid system for identification of four species of poisonous mushroom with real time PCR. We show the application of this technique on cooked mushrooms and gastric aspirates. The described technique allows 747

748 MYCOLOGIA TABLE I. Samples used in this study, accession number of ITS gene sequences from each species, place and year of collection of the samples and identification Isolate species ITS gene bank accession number Source Geography Collector Year of isolation Identification Amanita phalloides EU909444 LSP-MI-68 Parco delle Groane, Milano, Amanita phalloides EU909444 LSP-MI-CS17 Livigno, Sondrio, Amanita phalloides EU909444 LSP-MI-CS21 Clusone, Bergamo, G. Gentili 2007 molecular & standard 2008 standard 2007 standard Amanita virosa FJ755188 LSP-MI-79 Bellamonte, Trento, Trentino, Italy G. Gentili 1993 molecular & standard Amanita virosa FJ755188 LSP-MI-CS1 Valbondione, Bergamo, Lombardia, Italy 2008 standard Amanita verna EU909448 LSP-MI-78 Dossena, Bergamo, G. Gentili 1994 molecular & standard Amanita verna EU909448 LSP-MI-CS11 San Rossore, Pisa, 2006 standard Amanita cesarea AY486237 LSP-MI-50 Parco delle Groane, Milano, G. Gentili 2003 standard Amanita muscaria GQ267469 LSP-MI-CS10 Barni, Como, Amanita pantherina GQ401354 LSP-MI-CS15 Triuggio, Monza e, Lepiota lilacea AY176379 LSP-MI-768 Parco delle Groane, Milano, 2000 standard 2000 standard G. Gentili 2000 standard Lepiota cristata AJ237628 LSP-MI-757 Rozzano, Milano, G. Gentili 1996 molecular & standard Lepiota cristata AJ237628 LSP-MI-CS22 Cologno Monzese, Milano, Lepiota brunneoincarnata 2006 standard FJ481017 LSP-MI-750 Rozzano, Milano, G. Gentili 1996 molecular & standard Lepiota brunneoincarnata FJ481017 LSP-MI-CS2 Cologno Monzese, Milano, Lepiota subincarnata AY176491 LSP-MI-CS3 Cologno Monzese, Milano, Lepiota josserandii ND LSP-MI-765 Parco delle Groane, Milano, 2005 standard 2004 standard G. Gentili 1996 standard

EPIS ET AL.: POISONOUS MUSHROOMS 749 TABLE I. Continued. Isolate species ITS gene bank accession number Source Geography Collector Year of isolation Identification Russula heterophylla DQ422006 LSP-MI-CS6 Arcore, Monza e, Marasmius oreades FJ431267 LSP-MI-CS7 Vimercate, Monza e, Leucoagaricus leucothites AF482865 LSP-MI-CS8 Rozzano, Milano, 2007 standard 2005 standard 2005 standard Inocybe asterospora AM882897 LSP-MI-613 Trentino, Italy G. Gentili 1996 molecular & standard Inocybe asterospora AM882897 LSP-MI-CS24 Barni, Como, 2002 standard Agaricus xanthodermus DQ182534 LSP-MI-36 Parco delle Groane, Milano, Agaricus arvensis AF161015 LSP-MI-CS9 Cassina de Pecchi, Milano, Agaricus campestris FJ755230 LSP-MI-CS14 Cassina de Pecchi, Milano, G. Gentili 1994 molecular & standard Cortinarius orellanus AF389164 LSP-MI-CS5 Clusone, Bergamo, Cortinarius speciosissimus Cortinarius speciosissimus Chroogomphus helveticus AF261501 LSP-MI-CS12 Aprica, Sondrio, AF261501 LSP-MI-CS25 Bossico, Bergamo, AF205650 LSP-MI-CS13 Livigno, Sondrio, Chroogomphus rutilus DQ367894 LSP-MI-CS19 Vimercate, Monza e, Tricholoma equestre EF493263 LSP-MI-CS16 Chiesa Val Malenco, Sondrio, Entoloma lividum AF261294 LSP-MI-CS20 Milano, 2005 standard 2006 standard 2005 standard 2005 standard 2006 standard 2006 standard 2006 standard 2007 standard 2000 standard Armillaria mellea FJ664597 LSP-MI-82 Clusone, Bergamo, G. Gentili 2000 standard 2006 standard Armillaria mellea FJ664597 LSP-MI-CS23 Clusone, Bergamo, Armillaria ostoyae EU257717 LSP-MI-CS4 Clusone, Bergamo, 2008 standard

750 MYCOLOGIA TABLE I. Continued. Year of isolation Identification ITS gene bank accession number Source Geography Collector Isolate species G. Gentili 2006 standard Macrolepiota procera AM946456 LSP-MI-772 Parco delle Groane, Milano, Galerina marginata AY228347 LSP-MI-457 Pergine, Trento, Trentino, Italy G. Gentili 1994 molecular & standard Boletus calopus DQ679806 LSP-MI-106 Valtellina, Sondrio, G. Gentili 1996 standard 2006 standard Gyromitra esculenta AJ544209 LSP-MI-CS18 Sommalombardo, Varese, Lombardia, Italy Morchella esculenta EU600241 LSP-MI-750 Ballabio, Lecco, G. Gentili 2006 standard ND: Not done. LSP-MI & LSP-MI-CS: Collection deposited in the herbarium of the Laboratorio di Sanità Pubblica, of Milano, Italy. for rapid, sensitive and specific identification of four mushroom species that frequently are recorded as being responsible for poisonings in northern Italy. MATERIALS AND METHODS DNA extraction. Forty mushroom samples from 31 species of Basidiomycetes have been collected in northern Italy 1993 2008 from 23 locations (TABLE I). All samples were identified morphologically with standard (Moser 1993, Mazza 1995, Bon 1988) then subjected to rapid drying (in a food dehydrator). Ten milligrams of each sample were used for DNA extraction. Samples were put in cryotubes and left 10 min in liquid nitrogen, then disrupted by rapid vibration in Ribolyser (Hybaid, Middlesex, UK) with two sizes of microbeads (1 mm and 100 mm polystyrene beads). DNA was extracted with DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to manufacturer instructions. DNA was stored at 220 C for molecular analyses. The above protocol for DNA extraction also was used on 30 samples of gastric aspirates and on 10 samples of cooked mushrooms collected by the Laboratorio di Sanità Pubblica of Milano. Morphological identification on these clinical and cooked samples was possible only in a few cases. (See TABLE I for a description all examined samples.) Primer design and PCR. DNA quality was tested for each sample via spectrophotometer (NanoDrop ND 1000, Thermo Fisher Scientific, Wilmington, Delaware) and with two PCR protocols that amplify respectively the internal transcribed spacer 1 and 2 (ITS1-ITS2) fragments from all Basidiomycetes species (Withe et al. 1990, Palapala et al. 2002). The ITS regions are highly conserved within most species but are variable among species and thus are useful in taxonomy and for sensitive and selective species identification (Turenne et al. 2000). Four primer pairs (TABLE II) were manually designed based on an alignment of ITS1-5S rdna-its2 gene sequences from 40 species of Basidiomycetes (Bao et al. 2005, Schmidt et al. 2000), generated with Clustal X 2.0 (Larkin et al. 2007). These primer pairs were designed on ITS1 or ITS2 (see TABLE II) to be species specific for each of the following: A. phalloides, L. cristata, L. brunneoincarnata and I. asterospora. Primer specificity then was checked by BLAST analyses. Each primer pair was tested for PCR specificity with DNA from each of the 40 mushroom species with the same amplification conditions: 18 ml buffer (10 mm Tris-HCl [ph 8.3], 50 mm KCl, 1.5 mm MgCl 2 ) with 0.2 mm each deoxynucleoside triphosphate, 1 mm each primer, 0.5 U Taq Polymerase (Euroclone) and 2 ml DNA extraction obtained as above. The thermal profile was 2 min at 90 C; 35 cycles of 95 C for 40 s, 57 C for 40 s and 72 C for 40 s; the elongation was completed with 10 min at 72 C. PCR products were gel-purified with the QIAquick TM Gel Extraction Kit (QIAGEN) according to manufacturer protocols, resuspended in 30 ml deionized water and sequenced with PCR primers with the ABI PRISM BigDye Terminator Cycle Sequencing Reaction Kit 3.1 (Applera Europe, Warrington, UK) and run on an automated sequencer (ABI Prism 310 DNA sequencer, Applied

EPIS ET AL.: POISONOUS MUSHROOMS 751 TABLE II. Primers used in this study and PCR product lengths Primers Sequence (59 39) PCR product Amplified gene Reference ITS-Aph-F CTGTCTGCTTTTTTGATAGGTA 158 bp ITS2 This study ITS-Aph-R CAGAGAGAAGTGATATTGCTC This study ITS-Lcr-F TGACTCCTCGAACGGCTT 106 bp ITS1 This study ITS-Lcr-R TGGAAAAGACATAGACCTAG This study ITS-Lbr-F CATGCTGGCTTTGTAAGG 125 bp ITS2 This study ITS-Lbr-R ATTATCACACCGGCAACTGA This study ITS-Ias-F ATATGATGTGGCTTTTGGATGATG 94 bp ITS2 This study ITS-Ias-R AGTAGCCCCTCAGATACCA This study ITS1 TCCGTAGGTGAACCTGCGG Variable ITS1 Withe et al. 1990 ITS2 GCTGCGTTCTTCATCGATGC Withe et al. 1990 ITS3 GCATCGATGAAGAACGCAGC Variable ITS2 Withe et al. 1990 ITS4 TCCTCCGCTTATTGATATGC Withe et al. 1990 Biosystems, Foster City, California). ITS sequences were subjected to BLAST analysis (http://www.ncbi.nlm.nih. gov/blast) and compared to the sequences available in the databases to confirm species identification. The four novel primer pairs were used for Sybr green real time PCR. Serial dilutions corresponding to the DNA extracted from 0.1 mg to 32 ng dried mushrooms were prepared for each of the four target species, A. phalloides, L. cristata, L. brunneoincarnata and I. asterospora. These dilutions were used to test the sensitivity and the efficiency of the four protocols in triplicate. The four thermal profiles were identical: 95 C for 2 min, 35 cycles at 95 C for 15 s and at 57 C for 30 s, and melt curve 55 95 C with increments of 0.5 C per cycle. All reactions were performed in 25 ml, with 600 nm of each primer, 12.5 ml iq-sybrgreen Supermix and 1 ml DNA extraction. All dilutions also were tested in conventional PCR for a sensitivity comparison. Subsequently all extracted DNA (TABLE III) were analyzed on real time PCR with the primers targeted to the species present in the sample. Reconstruction of possible poisoning conditions was attempted by mixing gastric aspirates without mushroom spores with known quantities of dried mushrooms and incubating them for two different time spans (i.e. 12 h and 24 h) at 36 C. PCR protocols also were tested on different samples of food containing poisonous mushrooms obtained from the Laboratorio di Sanità Pubblica of Milano (Italy). RESULTS A total of 70 DNA samples were obtained, 40 from 31 species of both poisonous and edible fungi (TABLE I) and 30 from clinical samples. All samples were analyzed for DNA quantity and quality with a spectrophotometer. All samples exhibited a DNA concentration above 20 ng/ml and 260/280 ratio 1.7 2.1 and thus were considered suitable for subsequent analyses. All samples were positive in PCR for Basidiomycetes ITS, with the exception of the DNA samples obtained from gastric aspirates without mushrooms, used as negative controls. All these samples were used to test the specificity and sensitivity of each of the primers pairs designed for real time PCR. All protocols were specific (i.e. the amplification was obtained only when DNA from the target species was present), with no aspecific amplification observed on agarose gel or in real time PCR. The amplified fragments were sequenced, and the sequences matched those deposited in databanks for each of the four species. The maximum sensitivity and the efficiency for the four real time PCR protocols are indicated (respectively in TABLE III and FIG. 1). Conventional PCR amplification of mushroom DNA in serial dilution also was performed on all samples with the same primers pairs and thermal profile as for the real time PCR. Conventional PCR exhibited sensitivity 10 100 times lower than real time PCR (data not shown). Fragmented dried mushrooms were added to aliquots of gastric juice to simulate the samples that typically are obtained from poisoned patients. These samples were subjected to DNA extraction and real time PCR to evaluate the sensitivity of the protocols under conditions similar to those encountered in diagnoses. Real time PCR amplification of the samples treated with gastric juice showed Ct (cycle threshold) values that were actually slightly higher than those obtained from samples not treated with gastric juice (a portion of the results are shown in TABLE III). For example the DNA sample extracted from 10 ml aspirate with addition of 1 mg dried A. phalloides kept 24 h at 36 C presents a mean Ct value of 20.45, which is close to the 19.53 Ct obtained from 4 mg dried mushroom. DISCUSSION Mushrooms from species A. phalloides, L. cristata, L. brunneoincarnata and I. asterospora can be identified mistakenly as edible by the collector, thus possibly

752 MYCOLOGIA TABLE III. Samples examined by real time PCR and main results of the study Target species Samples Starting material Mean cycle-threshold Standard deviation A. phalloides A. phalloides dried mushroom 0.1 mg 12.72 0.07 A. phalloides A. phalloides dried mushroom 32 ng 31.00 0.15 A. phalloides 10 ml Aspirate with addition of 5 mg dried mushroom 0.05 mg 17.58 0.51 A. phalloides Aspirate without addition of mushrooms 0 mg N/A N/A A. phalloides 10 ml Aspirate with addition 10 mg dried mushroom Sample 1 0.1 mg 12.87 0.18 A. phalloides 10 ml Aspirate with addition 10 mg dried mushroom Sample 2 0.1 mg 12.98 0.12 A. phalloides 10 ml Aspirate with addition 10 mg dried mushroom Sample 3 0.1 mg 12.76 0.13 A. phalloides 10 ml Aspirate with addition 10 mg dried mushroom Sample 4 0.1 mg 13.90 0.14 A. phalloides 10 ml Aspirate with addition 10 mg dried mushroom Sample 5 0.1 mg 12.76 0.08 A. phalloides 10 ml Aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 17.89 0.11 A. phalloides 10 ml Aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 20.45 0.20 A. phalloides 10 ml aspirate at 36 C 12 h without mushroom 0 mg N/A N/A A. phalloides Mixed cooked mushrooms sample 1 0.2 mg 18.50 0.11 A. phalloides Mixed cooked mushrooms sample 2 0.2 mg 20.11 0.06 A. phalloides Mixed cooked mushrooms sample 3 0.2 mg 18.02 0.05 A. phalloides Pasta with mushrooms 0.2 mg 17.04 0.11 L. cristata L. cristata dried mushrooms 0.1 mg 17.96 0.062 L. cristata L. cristata dried mushrooms 32 ng 29.80 0.158 L. cristata 10 ml aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 24.57 0.09 L. cristata 10 ml aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 25.79 0.41 L. cristata 10 ml aspirate at 36 C 12 h without mushroom 0 mg N/A N/A L. cristata Mixed cooked mushrooms 0.2 mg 26.71 0.19 L. cristata Pasta with mushrooms 0.2 mg 27.06 0.50 L. brunneoincarnata L. brunneoincarnata dried mushroom 0.1 mg 14.73 0.03 L. brunneoincarnata L. brunneoincarnata dried mushroom 32 ng 27.57 0.08 L. brunneoincarnata 10 ml aspirate with addition 5 mg dried mushroom Sample 1 0.05 mg 24.91 0.12 L. brunneoincarnata 10 ml aspirate with addition 5 mg dried mushroom Sample 2 0.05 mg 25.24 0.05 L. brunneoincarnata 10 ml aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 25.17 0.11 L. brunneoincarnata 10 ml aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 26.72 0.12 L. brunneoincarnata 10 ml aspirate at 36 C 12 h without mushroom 0 mg N/A N/A L. brunneoincarnata Mixed cooked mushrooms 0.2 mg 26.05 0.35 I. asterospora I. asterospora dried mushroom 0.1 mg 12.39 0.095 I. asterospora I. asterospora dried mushroom 32 ng 25.03 0.03 I. asterospora 10 ml aspirate with addition 1 mg dried mushroom 12 h at 36 C 0.01 mg 19.02 0.26 I. asterospora 10 ml aspirate with addition 1 mg dried mushroom 24 h at 36 C 0.01 mg 22.06 0.02 I. asterospora 10 ml aspirate at 36 C 12 h without mushroom 0 mg N/A N/A I. asterospora 10 ml aspirate with 5 mg dried mushroom 0.05 mg 24.98 0.07 I. asterospora Pasta with mushrooms 0.2 mg 15.20 0.01

EPIS ET AL.: POISONOUS MUSHROOMS 753 FIG. 1. Serial dilution of each dried mushroom species. Amanita phalloides. A. Efficiency of the reaction: 101.1%. B. Inocybe asterospora. Efficiency of the reaction: 93.3%. C. Lepiota cristata. Efficiency of the reaction: 98.7%. D. Lepiota brunneoincarnata. Efficiency of the reaction: 98.6%. causing poisonings. In cases of suspected mushroom poisoning species identification based on morphologic characters is often difficult; the morphology of the mushrooms, particularly of the spores, may be distorted by handling and cooking, and a mycologist might be unable to identify the species. Examination of fungal spores in the gastric contents also may be inconclusive. If poisoning by A. phalloides-type mushrooms is suspected, gastric contents, mushroom samples and residuals of food if available must be assayed to verify the presence of mushrooms or spores. The development of methods for the identification of poisonous mushrooms thus is important. Maeta et al. (2008) present such a methodology for four poisonous species common in Japan. As for the four mushroom species for which we developed the real time PCR, a molecular method for detection so far has been published only for A. phalloides (Kotlowski et al. 2000). This method was based on a conventional PCR. It must be emphasized that the detection of a specific fungus requires a few hours with conventional PCR, while real time PCR requires only 1 h or less depending on the apparatus. In addition Kotlowski et al. did not present an application to clinical samples. Here we present a real time PCR protocol for the detection of four medically important poisonous mushroom species. All protocols were highly specific for the target species and sufficiently sensitive to detect up to 32 ng dried mushroom. Furthermore, as demonstrated by Maeta et al. (2008), fungal DNA is detectable in various cooked preparations. We focused on samples that are particularly difficult for morphological identification, such as pasta with mushrooms (TABLE III), where the action of starch on the spores makes morphological details indistinguishable while the DNA is expected to remain in sufficiently good condition. The real time PCR amplification of the samples of the four species of mushrooms treated with gastric

754 MYCOLOGIA juice showed higher Ct values than untreated ones. For example the DNA sample extracted from 10 ml aspirate with addition of 1 mg dried A. phalloides kept 24 h at 36 C (starting material 10 mg) presents a mean Ct value of 20.45 while the sample not treated with the gastric aspirate containing a similar starting quantity of mushroom (4 mg) had a Ct of 19.53 (data not shown). In any case the protocols also exhibited high specificity and sensitivity on the samples treated with gastric juice. The fact that the Ct values from these samples were not too divergent from the ones generated from dried specimens suggests that treatment with gastric juice lead only to a moderate degradation of the mushroom DNA. It must be emphasized however that some treatments can influence different samples in different ways and the result might not always be predictable. For example for I. asterospora the DNA sample obtained from 10 ml aspirate with addition of 1 mg dried mushroom for 24 h at 36 C shows a lower Ct value than the sample obtained from 10 ml aspirate with 5 mg dried mushroom while in the case of A. phalloides the DNA sample obtained from 10 ml aspirate with 5 mg dried mushroom shows a lower Ct. A possible explanation is a difference between the starting samples, which could contain DNA-degrading substances or PCR inhibitors, as well as a difference in the gastric aspirates collected from different patients and thus likely varying in ph, enzyme content, etc. In conclusion the real time PCR protocol presented here exhibits a number of features that make it a useful diagnostic tool. It is specific, sensitive, quick, relatively cheap and can function with samples that are difficult to identify morphologically. Future developments of this technique could include novel primers for other poisonous mushroom species and the implementation of a multiplex real time PCR protocol to test in a single analysis a clinical sample for the presence of different fungal DNA. ACKNOWLEDGMENTS The authors thank Dr Massimo Pajoro for help in DNA extraction procedures and Gruppo Micologico Ercole Cantù Agrate for mushroom samples. The authors also thank the two anonymous reviewers for useful comments and suggestions. LITERATURE CITED Assisi F, Balestreri S, Galli R. 2008. Funghi velenosi. Italy: Dalla Natura. 368 p. Bao DP, Aimi T, Kitamoto Y. 2005. Cladistic relationships among the Pleurotus ostreatus complex, the Pleurotus pulmonarius complex, and Pleurotus eryngii based on the mitochondrial small subunit ribosomal DNA sequence analysis. J Wood Sci 51:77 82. Barbato MP. 1993. Poisoning from accidental ingestion of mushrooms. Med J Aust. 158:842 847. Bon M. 1988. Champignons d Europe occidentale. France: Arthaud. 184 p. Hall AH, Spoerke DG, Rumack BH. 1987. Mushroom poisoning: identification, diagnosis and treatment. Pediatr Rev 8:291 298. Karlson-Stiber C, Persson H. 2003. Cytotoxic fungi an overview. Toxicon 15:339 349. Kotlowski R, Myjak P, Kur J. 2000. Specific detection of Amanita phalloides mycelium and spores by PCR amplification of the gpd (glyceraldehyde-3-phosphate dehydrogenase) gene fragment. J Food Biochem 24: 201 212. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Nov Clustal W and Clustal X version 2.0. Bioinformatics 1:2947 2948. Lurie Y, Wasser SP, Taha M, Shehade H, Nijim J, Hoffmann Y, Basis F, Vardi M, Lavon O, Suaed S, Bisharat B, Bentur Y. 2009. Mushroom poisoning from species of genus Inocybe (fiber head mushroom): a case series with exact species identification. Clin Toxicol 47:562 565. Maeta K, Ochi T, Tokimoto K, Shimomura N, Maekawa N, Kawaguchi N, Nakaya M, Kitamoto Y, Aimi T. 2008. Rapid species identification of cooked poisonous mushrooms by using real time PCR. Appl Environ Microbiol 74:3306 3309. McPartland JM, Vilgalys RJ, Cubeta MA. 1997. Mushroom poisoning. Am Fam Physician 55:1797 1800, 1805 1809, 1811 1812. Mazza R. 1995. I funghi Guida al riconoscimento. Italy: Manuali Sonzogno. 164 p. Moser M. 1993. Guida alla determinazione dei funghi. Vol. 1. Polyporales, Boletales, Agaricales, Russulales Italy: Saturnia. 565 p. Palapala VA, Aimi T, Inatomi S, Morinaga T. 2002. ITS-PCR- RFLP method for the distinguishing commercial cultivars of edible mushroom, Flammulina velutipes. J Food Sci 67:2486 2490. Roux X, Labadie P, Morand C, Fontaine B, Coutant G. 2008. Mushroom poisoning by brunneoincarnata: about two cases. Ann Fr Anesth Reanim 27:450 452. Schmidt O, Moreth U. 2000. Species-specific PCR primers in the rdna-its region as a diagnostic tool for Serpula lacrymans. Mycol Res 104:69 72. Turenne CY, Sanche SE, Hoban DJ, Karlowsky JA, Kabani AM. 2000. Rapid identification of fungi by using the ITS2 genetic region and an automated fluorescent capillary electrophoresis system. J Clin Microbiol 38: 944. White TJ, Bruns T, Lee S, Taylor J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. New York: Academic Press. p 315 322.